ID: 1161208967

View in Genome Browser
Species Human (GRCh38)
Location 19:3056538-3056560
Sequence TCCAGGGCGGGCTGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 363}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161208967_1161208989 18 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208989 19:3056579-3056601 GGGGCTGCGGATGGAGACTGGGG 0: 1
1: 0
2: 2
3: 48
4: 549
1161208967_1161208987 16 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208987 19:3056577-3056599 CTGGGGCTGCGGATGGAGACTGG 0: 1
1: 0
2: 3
3: 51
4: 542
1161208967_1161208981 -3 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208981 19:3056558-3056580 GGAGAGGGGCAGGGGGCCGCTGG 0: 1
1: 0
2: 14
3: 131
4: 1136
1161208967_1161208991 28 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208991 19:3056589-3056611 ATGGAGACTGGGGGCACTTTAGG 0: 1
1: 0
2: 2
3: 24
4: 195
1161208967_1161208978 -10 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208978 19:3056551-3056573 CCGCCCTGGAGAGGGGCAGGGGG 0: 1
1: 0
2: 8
3: 59
4: 533
1161208967_1161208984 5 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208984 19:3056566-3056588 GCAGGGGGCCGCTGGGGCTGCGG 0: 1
1: 2
2: 1
3: 104
4: 938
1161208967_1161208990 19 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208990 19:3056580-3056602 GGGCTGCGGATGGAGACTGGGGG 0: 1
1: 0
2: 2
3: 43
4: 389
1161208967_1161208988 17 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208988 19:3056578-3056600 TGGGGCTGCGGATGGAGACTGGG 0: 1
1: 0
2: 4
3: 30
4: 384
1161208967_1161208985 9 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208985 19:3056570-3056592 GGGGCCGCTGGGGCTGCGGATGG 0: 1
1: 0
2: 5
3: 65
4: 626
1161208967_1161208982 -2 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208982 19:3056559-3056581 GAGAGGGGCAGGGGGCCGCTGGG 0: 1
1: 0
2: 4
3: 62
4: 485
1161208967_1161208983 -1 Left 1161208967 19:3056538-3056560 CCAGCATCCCAGCCCGCCCTGGA 0: 1
1: 0
2: 2
3: 43
4: 363
Right 1161208983 19:3056560-3056582 AGAGGGGCAGGGGGCCGCTGGGG 0: 1
1: 0
2: 2
3: 57
4: 611

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161208967 Original CRISPR TCCAGGGCGGGCTGGGATGC TGG (reversed) Intronic
900121785 1:1051401-1051423 TCCGGGGCGGGCGGGGTGGCAGG + Intronic
900465918 1:2825368-2825390 TCCAGGGCAGAATGGGCTGCTGG + Intergenic
900489784 1:2942101-2942123 TCAAAGGGGAGCTGGGATGCAGG - Intergenic
900506935 1:3034283-3034305 TCCTGGGCGAGCTGCGATACTGG + Intergenic
900867136 1:5276588-5276610 TTCAGGGCAGGCTGGCAGGCTGG - Intergenic
901704079 1:11060251-11060273 TCCGGGGCGGGCTGGGCCGGCGG + Intergenic
902245925 1:15120364-15120386 GCCAGGGCTGCCTGGGGTGCCGG - Intergenic
902658057 1:17883077-17883099 GCCAGGGAAGGTTGGGATGCTGG + Intergenic
902787391 1:18741868-18741890 TGCAGGGGTGGCTGGGATCCAGG + Intronic
903592801 1:24470032-24470054 TCCAGGGGGCACTGGTATGCAGG - Intronic
903648414 1:24908761-24908783 TGCAAGGCAGGCTGGGATGCTGG - Intronic
904206013 1:28855664-28855686 CCCAGAGGGGGCTGGGATGCTGG - Intronic
904423653 1:30409871-30409893 TCCAGGACGGCCTGGGCCGCTGG - Intergenic
905201603 1:36320371-36320393 TCAAGGGCAGGCCTGGATGCTGG - Exonic
905264261 1:36740155-36740177 TCCAGGGTGGGCTGGGATTGAGG + Intergenic
905912582 1:41664125-41664147 TCAAGGGCAGGCTTGGATTCAGG - Intronic
907924704 1:58944530-58944552 TCCAGAGAGGGCTGGCAGGCAGG + Intergenic
908123128 1:61004575-61004597 ACTAGAGGGGGCTGGGATGCTGG - Intronic
910884352 1:91949789-91949811 TCAAGGGAGGGCTGGGAAGGAGG + Intronic
912506232 1:110158420-110158442 TCCAGGGCGTTGTGGGATGTGGG + Intronic
912956409 1:114156735-114156757 GCCTGGGAGGGCTGGGATTCAGG + Intergenic
914901939 1:151715826-151715848 TTCGGGGTGGGCTGGGAGGCTGG - Intronic
918276775 1:182960183-182960205 TCCAGGGCGGCATGGGGTCCGGG - Intergenic
918512018 1:185321935-185321957 CCCAGGGCCGGCAGGGATGGCGG + Intergenic
919802980 1:201364655-201364677 GCCAGGGCAGGGTGGGATGGAGG - Intronic
920538421 1:206758130-206758152 AGCAGGACGGGGTGGGATGCAGG - Intergenic
921290546 1:213652780-213652802 TGCAGGGTGGGTTGGGCTGCAGG - Intergenic
922353379 1:224753882-224753904 TCAAGGGCCGTCTTGGATGCTGG + Intergenic
922729137 1:227940936-227940958 TCCAGGCCGGGCAGGGTGGCAGG - Intronic
923043168 1:230334094-230334116 TCCAGTGCAGGGTGGGATGCGGG - Intronic
923337911 1:232986048-232986070 ACCAGGACAGGCTGGGATGGTGG - Intronic
923465228 1:234242291-234242313 TCTAGAGCAGGCTGGGAAGCGGG - Intronic
1063115596 10:3069181-3069203 TGCAGGGCGGGCTGCGGGGCGGG - Intronic
1067040732 10:42951927-42951949 CTCAGGGCGGGCTGGGATCTGGG + Intergenic
1067083696 10:43227370-43227392 TCCAGGCCTGGCCAGGATGCAGG - Intronic
1067415320 10:46097888-46097910 TCCAGGCCAGGCTGGGAAACTGG - Intergenic
1067435362 10:46272963-46272985 TCCAGGCCAGGCTGGGAAACTGG - Intergenic
1067438365 10:46294400-46294422 TCCAGGGCAGGCTGGGAAAGTGG + Intronic
1067570621 10:47368621-47368643 GGCAGGGCGGGCCGGGATGTGGG - Exonic
1067582155 10:47452655-47452677 TCCAGGCCAGGCTGGGAAGCTGG - Intergenic
1067786525 10:49253493-49253515 TCCAGGGCTGGGTGGGAGGAAGG + Intergenic
1067786583 10:49254730-49254752 TCCAGGGCTGGGTGGGAGGAAGG + Intergenic
1067990588 10:51207410-51207432 GCCAGTGCAGGATGGGATGCTGG - Intronic
1069183840 10:65397123-65397145 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1070354559 10:75627017-75627039 TCCAGGGAGGGCTGAGAAGGTGG - Intronic
1070933943 10:80279213-80279235 TCCTGGCCTGGCTGGGATGATGG + Intronic
1070956079 10:80464506-80464528 GCCAGGGCAGGGTGGGAAGCAGG + Intronic
1071086561 10:81874304-81874326 GCCGCGGCGGGCTGGGATTCGGG - Intergenic
1072249039 10:93567320-93567342 TCCTGCGCAGGCTGGGAAGCGGG + Intronic
1073582722 10:104682631-104682653 TCCAGAGCAGCCTGGGAGGCAGG - Intronic
1073599687 10:104834567-104834589 TCCAGGGTGGGCTGGGGGGGTGG - Intronic
1075280216 10:121132518-121132540 TCTAGGGCAGGCTGGATTGCTGG - Intergenic
1076096252 10:127736884-127736906 TCCAGGGCAGTCGGGGCTGCGGG + Intergenic
1076883843 10:133252401-133252423 TGCAGGGAGGGATGGGGTGCAGG - Intergenic
1076883850 10:133252418-133252440 TGCAGGGCGGGCTGGGGTGCAGG - Intergenic
1076883865 10:133252452-133252474 TGCAGGGTGGGCTGGGGTGCAGG - Intergenic
1076883873 10:133252469-133252491 TGCAGGGCGGGCCGGGGTGCAGG - Intergenic
1076883886 10:133252503-133252525 TGCAGGGAGAGCTGGGGTGCAGG - Intergenic
1077135521 11:996254-996276 TCCAGGGGAGGCTGGTGTGCAGG + Intronic
1077144126 11:1037187-1037209 TTCAGGGGGTGCTGGGATTCAGG - Intergenic
1077159954 11:1108113-1108135 TGTTGGGCTGGCTGGGATGCTGG + Intergenic
1077560891 11:3259982-3260004 TCCAGGGGTGGCTGGGGGGCCGG - Intergenic
1077566788 11:3305812-3305834 TCCAGGGGTGGCTGGGGGGCCGG - Intergenic
1077877239 11:6319263-6319285 TCCAGCGCAGGCTGGGCTTCCGG + Exonic
1078413229 11:11144603-11144625 TGCAGGGTGGGCTGGCAGGCTGG - Intergenic
1078448310 11:11421496-11421518 ACCAGGGCTAGCTGGGAAGCTGG + Intronic
1079243456 11:18736853-18736875 TCCAGGTAGGGCTGGGATCGGGG + Intronic
1081712888 11:45228879-45228901 TCCAGGGGGGGCTGGAAGGAAGG - Intronic
1083266777 11:61550544-61550566 TCCAGGCCAGGCTGAGATGTGGG + Intronic
1083719955 11:64599164-64599186 TCCTGGGAGGGCTGGGAGCCAGG + Intronic
1083827686 11:65212461-65212483 TCCAGGGCCTGCTGGGATCTGGG + Intergenic
1083899550 11:65636943-65636965 TCCAGCAGGGGCTGGGCTGCCGG - Exonic
1084064055 11:66693338-66693360 TCCAGAGCTGGCTGAGCTGCAGG - Exonic
1084410821 11:69005107-69005129 TCCAGGGGTGGCTGGGAGACTGG - Exonic
1084470746 11:69357613-69357635 TCCATGGTGGGGTGGGATGGGGG + Intronic
1084517004 11:69642727-69642749 TCCAGGGCGGGCCAGGGTCCCGG + Intronic
1084664639 11:70569768-70569790 TCCCTGGGGGGCTGTGATGCTGG + Intronic
1084768794 11:71329331-71329353 GACAGGGAGGGCGGGGATGCAGG + Intergenic
1084773639 11:71360790-71360812 TCCATGGCTGTCTGGGATCCAGG + Intergenic
1088234551 11:107708448-107708470 TGCAGGGTGGGCTGGTAGGCTGG - Intronic
1088266401 11:107991888-107991910 TGCAGGGTGGGCTGGCAAGCTGG + Intergenic
1088819928 11:113448336-113448358 TCTGGGCTGGGCTGGGATGCTGG - Intronic
1089273385 11:117316224-117316246 TCCCGGGCGGGCTGGGGAGGCGG + Exonic
1089603519 11:119628767-119628789 TAAGGGGCCGGCTGGGATGCAGG + Intronic
1089660597 11:119982810-119982832 TGCAGCCCGGGCTGGGCTGCTGG + Intergenic
1090426219 11:126608653-126608675 GCCAGGGAGGGCTGGGAAGGGGG - Intronic
1090856143 11:130610705-130610727 TCCAGGGCTGGCCGGGGTGAAGG + Intergenic
1091454914 12:599793-599815 CCCCGGGCGTGCTGGGGTGCAGG - Intronic
1092024296 12:5227940-5227962 TCCAGGAAGGGCTGGGCAGCAGG - Intergenic
1092161049 12:6315750-6315772 TTCAGGCCAGTCTGGGATGCAGG + Intronic
1095286089 12:40412131-40412153 TCCAGAGAACGCTGGGATGCTGG + Exonic
1096214717 12:49792727-49792749 TGCAGGGAAGGCTGGCATGCTGG + Exonic
1097195026 12:57238449-57238471 TCTCGGGAGGGCTGGGCTGCTGG - Intronic
1098893504 12:76032124-76032146 TCCTGGGCGAGCTGGGAGGCCGG + Exonic
1100978027 12:100142536-100142558 TCCAGTGCGGGCTGGGGTGGAGG + Intronic
1101139897 12:101784376-101784398 TGCAGGGAGGGCAGGGATGTGGG + Intronic
1101513905 12:105417156-105417178 TGCAGGGCAGACTGGCATGCTGG + Intergenic
1101803257 12:108041195-108041217 TCCAGTGAGGGCTGGCATGCAGG + Intergenic
1101903940 12:108811652-108811674 GCCAGGCCGGGCTTGGCTGCCGG - Intronic
1102076576 12:110064831-110064853 TCCAGTGCAGGGTGGGAGGCTGG + Intronic
1102534531 12:113570651-113570673 TCCAGGGTGGGCAGGGGGGCGGG + Intergenic
1103347264 12:120259610-120259632 TCCAGGGAGGCCTTGGATGCTGG - Intronic
1103361816 12:120359053-120359075 TCCATGGCGGGCTGTGTTTCAGG - Exonic
1103696638 12:122820965-122820987 TCCCGGGGTGGCTGGAATGCAGG + Intronic
1103699391 12:122840946-122840968 TGCAGCGCTGGCTGGGAGGCTGG - Intronic
1104207575 12:126654926-126654948 TCCTGGGCTGGATGGGATGTTGG - Intergenic
1104880822 12:132069235-132069257 TCCCGGGTGGGGTGGGCTGCAGG + Intronic
1105547367 13:21360609-21360631 AGCAGGGCTGGCTGGGATGCAGG + Intergenic
1108375934 13:49814292-49814314 TGCAGGGTGGGCTGGCAGGCTGG - Intergenic
1108569472 13:51735183-51735205 TCCAGGACAGCCTGGGATGGCGG - Intronic
1109406581 13:61908200-61908222 TCCAGGGCAAGCTGGGATAGAGG + Intergenic
1110192040 13:72741279-72741301 CCAAGGGCAGGCAGGGATGCTGG - Intronic
1112652738 13:101416405-101416427 CCCAGGGCGGGCGGGGACGCGGG + Intronic
1113734144 13:112665080-112665102 TCCAGGTTGGGCTGGGTTGCAGG + Intronic
1119420201 14:74503720-74503742 TCCAGGCTGGGCTGGGTTGAGGG - Intronic
1119422688 14:74516962-74516984 TCCAGGGCTGGCTGTGACTCAGG - Intronic
1119463912 14:74837714-74837736 ACCAGGGCAGGGTGGGAAGCTGG + Intronic
1121377798 14:93430426-93430448 TCCGGGGCGGGCTGGAGCGCCGG - Intronic
1121528514 14:94636898-94636920 TCCTGGGCTGGCTTGGAGGCAGG - Intergenic
1121570811 14:94945273-94945295 GCCAGGGCAGGCTGGGAGGAGGG - Intergenic
1121879933 14:97490856-97490878 TCAAGGGCGGGATGGAATGGAGG + Intergenic
1122794122 14:104197165-104197187 TGAAGTGGGGGCTGGGATGCTGG + Intergenic
1122920530 14:104878141-104878163 TCCACGGGGGGCCGGGCTGCAGG - Intronic
1123126752 14:105952422-105952444 TCCAGGAGGAGCTGGGCTGCAGG - Intergenic
1123126777 14:105952526-105952548 TCCAGGAGGGGCTGGGCTGCAGG - Intergenic
1123666159 15:22610703-22610725 TCCAAGAAGGGCTGGGAGGCGGG - Intergenic
1124319982 15:28705109-28705131 TCCAAGAAGGGCTGGGAGGCGGG - Intronic
1124482529 15:30090308-30090330 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1124488986 15:30142410-30142432 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1124521045 15:30406901-30406923 TCCAAGAAGGGCTGGGAGGCGGG - Intronic
1124537617 15:30559319-30559341 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1124544072 15:30611374-30611396 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1124754544 15:32395913-32395935 TCCAAGAAGGGCTGGGAGGCGGG - Intronic
1124761039 15:32448268-32448290 TCCAAGAAGGGCTGGGAGGCGGG - Intronic
1124777595 15:32600795-32600817 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1125719060 15:41836391-41836413 CCCAGGGCTGGCTGGGGTGGAGG + Intronic
1127973519 15:63980431-63980453 CCCAGGGCTGGCAGGGCTGCAGG + Intronic
1129029884 15:72610385-72610407 TCCAAGAAGGGCTGGGAGGCGGG + Intergenic
1129038093 15:72663133-72663155 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1129211797 15:74074098-74074120 TCCAAGAAGGGCTGGGAGGCGGG - Intronic
1129398606 15:75266986-75267008 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1129402214 15:75291262-75291284 TCCAAGAAGGGCTGGGAGGCGGG + Intronic
1129728920 15:77918370-77918392 TCCAAGAAGGGCTGGGAGGCGGG - Intergenic
1129839592 15:78735491-78735513 TCCAAGAAGGGCTGGGAGGCGGG + Intergenic
1130035863 15:80360965-80360987 TGCAGGACGGGCTGGCAAGCTGG - Intronic
1130096886 15:80862635-80862657 TCCAGGGCGGGCTGGACTGGGGG + Intronic
1130789351 15:87135755-87135777 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1131150650 15:90045521-90045543 CCCAGGGGCCGCTGGGATGCAGG + Intronic
1131318722 15:91366136-91366158 TCTAGGGCTGGCTAGGAGGCAGG + Intergenic
1131421807 15:92312574-92312596 TCCAGTGAGGGCAGGGCTGCTGG + Intergenic
1132346455 15:101111881-101111903 TGCAGGGCTGGCTGGGCTGGAGG - Intergenic
1132383835 15:101386042-101386064 CCCAGGGCTCGTTGGGATGCAGG + Intronic
1132432868 15:101774900-101774922 TCCAAGAAGGGCTGGGAGGCGGG - Intergenic
1132546084 16:534133-534155 TTCAGGGCAGGCAGGGCTGCCGG - Intronic
1132688274 16:1171270-1171292 TCCTGGGCGGGCTGGGCGTCTGG + Intronic
1132873232 16:2124752-2124774 GCCAGCGCGGGCGGGGGTGCCGG - Intronic
1133022353 16:2972373-2972395 TGCTGGGAGGGCTGGTATGCAGG - Exonic
1133148218 16:3806722-3806744 TACAGGGTGGGGTGTGATGCAGG - Intronic
1134552320 16:15143931-15143953 GCCAGCGCGGGCAGGGGTGCCGG - Intergenic
1135220737 16:20612275-20612297 CCAATGCCGGGCTGGGATGCTGG + Intronic
1136552631 16:30989698-30989720 TGCAGGGCGGGCTGGGGGGCAGG + Exonic
1136561265 16:31040441-31040463 ACCAGGCCAGGCTGGGACGCAGG + Intronic
1137621291 16:49878071-49878093 TCCTGGGCTGGCTGGGTGGCTGG - Intergenic
1138487809 16:57358034-57358056 TCCACCTCAGGCTGGGATGCTGG - Intergenic
1139505517 16:67396368-67396390 TCCCGGGCGGGGTGGGAGCCGGG + Intronic
1139955757 16:70692289-70692311 TCCGGGGTGGGGTGGGAGGCAGG - Intronic
1140480144 16:75258001-75258023 CCCAGGGTGGGCAGGGCTGCTGG - Intronic
1141206128 16:81934363-81934385 TGCAGGGCGAGCTGGGAAGATGG + Intronic
1141596847 16:85102376-85102398 CCCAGGGAAGCCTGGGATGCAGG + Intronic
1141998497 16:87649633-87649655 TCCACGGCGGGTGGGGATGAGGG - Intronic
1142245066 16:88966590-88966612 TCCAAGGGAGGCTGGGAAGCTGG - Intronic
1142683030 17:1561712-1561734 TGCAGAGGGGGCTGAGATGCGGG - Intronic
1142712785 17:1732508-1732530 GCCAGGGCGGGCTGGGGCGGGGG + Intronic
1142815727 17:2423638-2423660 TACAGGGCGGGCTGGCAGGGAGG - Intronic
1142887009 17:2919226-2919248 TCCAGGTCTGGCTCAGATGCTGG - Intronic
1142976197 17:3646066-3646088 TCTAGGCCGGGCGGGGAAGCAGG - Intronic
1143135676 17:4711014-4711036 TCCCGTGCAGGCTGCGATGCAGG + Intronic
1143725220 17:8839836-8839858 TCCAGCCCTGGCTGGCATGCTGG - Intronic
1144256284 17:13471509-13471531 TCCTGGGCGTGCTGGGGTGCTGG - Intergenic
1144583761 17:16475396-16475418 TGCAGGGCAGGCTGGGAAGCTGG + Intronic
1144642335 17:16944513-16944535 TTTAGGGCAGGCTGGGGTGCGGG - Intronic
1144742329 17:17590978-17591000 CCCAGGGCCGGCTGGGAGACAGG + Intronic
1144840755 17:18184194-18184216 TCCGGGGCGGGCGGGGCAGCCGG - Intronic
1145241556 17:21243419-21243441 TCCAGGGCGGCCTGGGAGCCGGG + Exonic
1145294270 17:21575522-21575544 TCCAGGGGGGCCTGGCATCCAGG - Intergenic
1145369557 17:22297664-22297686 TCCAGGGGGGCCTGGCATCCAGG + Intergenic
1147155977 17:38544682-38544704 TCCGGGGGAGGCTGGGAAGCCGG - Intronic
1147237152 17:39066287-39066309 CCCAGGGAAGGCTGGGCTGCAGG + Exonic
1147864898 17:43545701-43545723 TCCAGGGAGGGCTGCGATGGGGG + Intronic
1148075290 17:44932196-44932218 TGCAGGGCTGGCTGGGAGGGTGG + Exonic
1148154266 17:45413699-45413721 TCCAGGGCGGGGTGGGAGCTGGG + Intronic
1148440717 17:47710424-47710446 GACAGGGCAGGCTGGGATGTGGG + Intronic
1148447156 17:47744768-47744790 TCCAGGCGGGGAGGGGATGCTGG - Exonic
1148666253 17:49377200-49377222 TCCAGGGCATGCTGGCAGGCAGG - Intronic
1148739758 17:49886166-49886188 CCCAGGGCTTGCTGTGATGCTGG - Intergenic
1148915499 17:50973854-50973876 TGCAGGGCAGGCTGGCAGGCTGG - Intronic
1151179307 17:72314448-72314470 TCCTGGGTGGGATGGGATCCTGG - Intergenic
1151574360 17:74944298-74944320 TGCTGGGAGGGCTGGGCTGCAGG - Intronic
1152142478 17:78544987-78545009 TCCAGTGGGGGATGGGATGGAGG - Intronic
1152667597 17:81580269-81580291 TCCAGGCCAGGCTGGAAGGCTGG - Intronic
1153278257 18:3390254-3390276 TCCAGTGCTGGCAGGGATGCTGG + Intergenic
1153445593 18:5169045-5169067 TGCAGGGCGGGCTGGCAATCTGG + Intronic
1155319672 18:24606957-24606979 TTCAGGGTGGGCTGGCAGGCTGG - Intergenic
1156397259 18:36709424-36709446 GCCAGGGAGGCCTGGGGTGCAGG + Intronic
1156796396 18:41051311-41051333 TCCAGGAATGCCTGGGATGCAGG + Intergenic
1157444342 18:47733519-47733541 TCCAGCACAGGCTGGGATGCTGG + Intergenic
1157504617 18:48217760-48217782 GACAGGGCTGGCTGGGAGGCAGG - Intronic
1157856600 18:51110383-51110405 TGCAGGGCGGGCTGGGAGCAGGG + Intergenic
1160303212 18:77705184-77705206 TCCAGGTGGGGCTAGGATGGTGG + Intergenic
1160519007 18:79493913-79493935 GGCAGGGCGGGCCGGGCTGCGGG + Intronic
1161087317 19:2341082-2341104 TCCAGGGAGGGCAGGGAGTCAGG - Exonic
1161089174 19:2351776-2351798 TCCTGTGCCGGGTGGGATGCGGG + Intronic
1161208967 19:3056538-3056560 TCCAGGGCGGGCTGGGATGCTGG - Intronic
1161224394 19:3136366-3136388 TCCAGGGCCGGCTGGGCTGGGGG + Exonic
1161477211 19:4493504-4493526 CCCAGGGCCGCCTGGGATCCCGG + Intronic
1162464058 19:10830255-10830277 TCCAGGCCGGGATGGGATTGGGG - Exonic
1162968451 19:14166645-14166667 TCCAGGGCGGGTGGGGAGGGAGG - Intronic
1163015477 19:14451613-14451635 TCCAGGAGGGGCTCAGATGCGGG - Intronic
1163715051 19:18868574-18868596 CCCGGGGCGGGCAGGGACGCGGG - Exonic
1164682536 19:30145218-30145240 TCTAGGGTGGGATGGGATGAGGG - Intergenic
1164814338 19:31183106-31183128 TGCAGGGCAGGCTGGTAGGCTGG - Intergenic
1165247397 19:34505260-34505282 CCCAGGGTGGCCTGGGATCCTGG + Exonic
1166317958 19:41999115-41999137 GCCGGCGCGGGCGGGGATGCGGG - Exonic
1166644142 19:44518771-44518793 ACCAGGAGGAGCTGGGATGCAGG - Intronic
1167149867 19:47702326-47702348 TGCAGGGGCGGCGGGGATGCGGG - Exonic
1167419321 19:49394004-49394026 CCCAGGGTGGGCTGGGAGACCGG + Intronic
1168242918 19:55096222-55096244 TCCAGGGCTGGCGGGGTGGCTGG - Intronic
926580654 2:14630745-14630767 TTCAGGGCTGTCTGGGATGAGGG - Intergenic
926669264 2:15561002-15561024 TCTAGGGCGGGGTGGGGTGGTGG - Intronic
928243953 2:29611160-29611182 ACCAGGGATGGCTGGGCTGCAGG + Intronic
928285611 2:29987751-29987773 TCCAGGGCAAGCTGGGGTGTAGG - Intergenic
931465836 2:62486161-62486183 TTCAGGCCTGGCTGGGGTGCTGG + Intergenic
931973115 2:67612445-67612467 TGCAGGGTGGGCTGGCAGGCTGG - Intergenic
932485096 2:72079907-72079929 CCAAGGGTGGGCTGGGATGCAGG + Intergenic
934553152 2:95274420-95274442 TCCAAGGCAGGCAGGGAGGCGGG + Intergenic
934746776 2:96764443-96764465 TCCAGGGCGGCCTGCTGTGCTGG - Intronic
934933792 2:98450153-98450175 TCCAGGGAGGCCTGGCATGCAGG - Intronic
937298801 2:120825965-120825987 CCCAGGGAGGGATAGGATGCTGG + Intronic
942072696 2:172329791-172329813 TTTAGGGCTGGCTGGGAGGCTGG + Intergenic
946164197 2:217853881-217853903 TGCAGCTCAGGCTGGGATGCAGG + Intronic
946278953 2:218652125-218652147 GCCAGGGAGGGTTGGGTTGCTGG + Intronic
946404226 2:219484079-219484101 TCTTGGGCAGGCTGGGGTGCGGG - Exonic
947683755 2:232062086-232062108 TACGGGGCGGGCTGGGTTGGGGG + Intronic
948166183 2:235864450-235864472 TCCAGGGCGGTCTGGGTGGGAGG + Intronic
948671852 2:239574043-239574065 TGCAGGCAGGACTGGGATGCTGG + Intergenic
948679799 2:239626058-239626080 CCCGGGGCGGGCAGGGCTGCTGG + Intergenic
948811007 2:240478447-240478469 CTCAGGGGGGTCTGGGATGCTGG - Intergenic
948831140 2:240598790-240598812 TCCTGGCAGGGCTGGGAGGCAGG - Exonic
948907545 2:240986950-240986972 CCCTGGGCAGGCTGGGCTGCGGG - Intronic
948990554 2:241551817-241551839 GCGAGGGTGGGCTGGGATGGTGG + Intergenic
1171372537 20:24670738-24670760 CCCAGGGTGGGCTGGTGTGCAGG + Intergenic
1172065750 20:32219071-32219093 TCAAGGGCTGGTTTGGATGCTGG + Intronic
1172483521 20:35285374-35285396 TCCAGGGTGGGCAAGGATGTGGG + Intergenic
1172752105 20:37258293-37258315 TCCGGGGCTGGCTGGGCTTCTGG - Intronic
1173868562 20:46328365-46328387 CCCAGGGCGGGCCGGCAGGCGGG - Intergenic
1175480387 20:59306497-59306519 TCCAGGGCAGCCTGGGAAGCCGG - Intronic
1175518382 20:59583722-59583744 GCCGGGGCTGGCTGGGATGAGGG + Intronic
1175804298 20:61818937-61818959 TGCAGGCCAGGCTGGGACGCAGG - Intronic
1175879008 20:62245955-62245977 TCCAGGGAGGTCTGGGAAGGAGG + Intronic
1176039031 20:63054810-63054832 GCCAGGGTGGGCTGACATGCCGG - Intergenic
1176061227 20:63173807-63173829 GCCTGGGCGGGCAGGGAGGCGGG - Intergenic
1178772555 21:35519243-35519265 TTCAGGGTGGGCTGGCAGGCTGG - Intronic
1179181887 21:39052784-39052806 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1179435861 21:41361720-41361742 TCCAGGGGAGGCTGGCATGGGGG - Intergenic
1179893810 21:44350611-44350633 TGCAGGGCGCGGTGGGGTGCAGG + Intronic
1179976691 21:44872610-44872632 TCCAGGGCCTGGTGGGCTGCGGG - Intronic
1180800482 22:18629586-18629608 TGCAGTGCAGACTGGGATGCTGG + Intergenic
1180851717 22:19025143-19025165 TGCAGTGCAGACTGGGATGCTGG + Intergenic
1181005390 22:20011025-20011047 TACAGGGAGGGCGGGGAAGCAGG + Intronic
1181023759 22:20116518-20116540 TCCAGGGCTGCCGGGGCTGCAGG + Exonic
1181221237 22:21365676-21365698 TGCAGTGCAGACTGGGATGCTGG - Intergenic
1181667348 22:24407333-24407355 TCCAGGTGGGGCGGGGGTGCTGG + Intronic
1182368289 22:29793203-29793225 TTCAGGGTGGGCTGGGGTGGAGG + Intronic
1184458802 22:44625767-44625789 CCCAGGGCAGGCAGGGCTGCTGG + Intergenic
1184642087 22:45878145-45878167 TCCAGGGCTCACTGGGAAGCGGG + Intergenic
1184679359 22:46061900-46061922 TCCGCGGCGGGCGGGGAGGCCGG - Intronic
1184858720 22:47161062-47161084 CCCAGGGCCAGCTGGGAGGCAGG - Intronic
1185056460 22:48581262-48581284 TGCAGGGAGGCCTGGGAGGCTGG - Intronic
1185299406 22:50071849-50071871 AGCAGGCCGGGCTGGGGTGCTGG - Intronic
1185375705 22:50481830-50481852 GCCATGGCGGGCGGGGCTGCAGG - Exonic
949132154 3:516436-516458 TACAGGGCACCCTGGGATGCAGG - Intergenic
950017967 3:9767639-9767661 TCCAGGGCAGGATTGGGTGCTGG - Intronic
950661520 3:14469656-14469678 TCCAGGGTGGGCTGGATGGCAGG - Intronic
950860810 3:16145883-16145905 CTCAGGGCTGGTTGGGATGCAGG - Intergenic
954316395 3:49803925-49803947 ACCAGGGCGGGCGGGCAGGCAGG - Intronic
954688160 3:52381846-52381868 TCCAGGGCGTGCTGGGCAGTGGG + Intronic
954800819 3:53186049-53186071 GCCAGGGTGGGGTGGGAAGCAGG - Intronic
957850691 3:85803601-85803623 TGCAGGGCAGGCTGGTAGGCTGG + Intronic
959441790 3:106385678-106385700 TGCAGGGTGGGCTGGCAGGCAGG + Intergenic
961079815 3:124016660-124016682 TCCAGGGAGGGCTGCGGTGGTGG + Intergenic
961386363 3:126525330-126525352 TCCAGGGTGGGCGGGGATGTTGG + Intronic
961667059 3:128499006-128499028 TCTAGGGAGGGCTGGCCTGCTGG + Intergenic
961682360 3:128607902-128607924 TCCAGCGCGGCCTGCGATTCAGG - Intergenic
962059670 3:131912455-131912477 TCCAGGGAAGGCTAGGGTGCTGG + Intronic
962932627 3:140051950-140051972 TGCAGGGCAGGCTGAGCTGCTGG + Intronic
964087402 3:152834978-152835000 TCCAGGGCGCAGTGGGAAGCAGG - Exonic
964690383 3:159443475-159443497 ATCAGGGCTGGCTGGGATGGAGG - Intronic
966939232 3:184734999-184735021 TTCAGGTGGGGCTGGGAGGCTGG - Intergenic
968430586 4:556100-556122 CCCAGGGCCGGCTGTGCTGCGGG - Intergenic
969503673 4:7570545-7570567 TACAGGGCGGTGTGGGAGGCAGG - Intronic
974328315 4:60444145-60444167 TCTAGGGCTGGCTTGGAAGCTGG + Intergenic
976668674 4:87627725-87627747 TGCAGGGTGGGCTGGCAGGCTGG - Intergenic
977736593 4:100424530-100424552 TGCAGTGCGTGCTGGGATGTGGG - Intronic
981346193 4:143679420-143679442 TCCAGGCCTGGCTGGACTGCTGG + Intronic
981688601 4:147481544-147481566 CCCAGGGCGCGCGGGGAGGCGGG + Intronic
982758343 4:159251114-159251136 TGCAGGGCGGGCAGGCAGGCGGG - Intronic
982767831 4:159368526-159368548 TCCTGGTCAGGCTGGCATGCAGG + Intergenic
985486829 5:156569-156591 TCCTGGCCGGCCTGGGTTGCAGG - Intronic
985719736 5:1482648-1482670 GCCGGGGTGGGCTGGGATGGGGG + Intronic
986376468 5:7137001-7137023 TCCAGGGCTGTCACGGATGCCGG - Intergenic
986647296 5:9930034-9930056 TCCATGGGTGGCTGGCATGCTGG - Intergenic
987084702 5:14457751-14457773 TGCAGGGCAGGCAGGGACGCAGG - Intronic
987396302 5:17427710-17427732 CACAGTGAGGGCTGGGATGCAGG - Intergenic
987405389 5:17519049-17519071 TCCAGGTGGGACTGAGATGCGGG - Intergenic
987405834 5:17522483-17522505 TCCAGGTGGGACTGAGATGCGGG - Intergenic
987406282 5:17525917-17525939 TCCAGGTGGGACTGAGATGCGGG - Intergenic
987406728 5:17529351-17529373 TCCAGGTGGGACTGAGATGCGGG - Intergenic
987407416 5:17585054-17585076 TCCAGGTGGGACTGAGATGCGGG + Intergenic
987408118 5:17590256-17590278 TCCAGGTGGGACTGAGATGCGGG + Intergenic
987408562 5:17593690-17593712 TCCAGGTGGGACTGAGATGCGGG + Intergenic
987409018 5:17597124-17597146 TCCAGGTGGGACTGAGATGCGGG + Intergenic
988323966 5:29737963-29737985 TACAGAGGGGGCTGGGTTGCCGG - Intergenic
993973137 5:94444202-94444224 TCCATGGTGGGGTGGGATGGGGG + Intronic
994746291 5:103682469-103682491 TGCAGGGTGGGCTGGCAGGCTGG - Intergenic
997202193 5:132017761-132017783 TTCAGTGAGGGCTGGGGTGCTGG + Intergenic
998531443 5:142888969-142888991 TGCAGGGTGGGTTGGGATCCTGG + Intronic
999200569 5:149813382-149813404 TTCAGGTCGGCCTGGGATGGTGG - Intronic
999240141 5:150122770-150122792 TCCAGGGCAGGCAGTGATGGAGG - Intronic
1001518852 5:172376617-172376639 GCCAGGTCGGGCTGGGCTGGTGG + Intronic
1001651814 5:173321099-173321121 TCCAGAGCAGGCTGGGGTGGGGG + Intronic
1001663165 5:173411727-173411749 TCCAGGGAGGGCAGGCATTCTGG + Intergenic
1001949904 5:175809039-175809061 TCCTGGCAGAGCTGGGATGCGGG - Exonic
1002419678 5:179139172-179139194 TCCCGGGGGGGCTGGCATGGAGG - Intronic
1002561342 5:180084249-180084271 TCCAGGGAGGGGTGGGGAGCTGG + Intergenic
1003404315 6:5816088-5816110 AGCAGGGCTGGCTGGGATGCAGG - Intergenic
1003624057 6:7726940-7726962 GCCCGGCCGGGCGGGGATGCCGG + Exonic
1009045930 6:58237578-58237600 TCTAGGATGGGCTGGCATGCAGG + Intergenic
1009221747 6:60991891-60991913 TCTAGGATGGGCTGGCATGCCGG + Intergenic
1010577325 6:77548493-77548515 TCCTTGGGGGGCTGGGAAGCTGG + Intergenic
1011668257 6:89656923-89656945 TCCAGGGCAGGCAGGTAGGCAGG - Intronic
1011696569 6:89918356-89918378 TCCAGGATTGGCTGGGATCCTGG - Intergenic
1012221776 6:96657743-96657765 TCCTGGGGGCACTGGGATGCTGG - Intergenic
1017377830 6:153791198-153791220 TGCAGGGTGGGCTGGCAGGCTGG + Intergenic
1017907632 6:158767921-158767943 TCTAGGGCTGGCTGGGATGGAGG - Intronic
1018727500 6:166625377-166625399 TGCAAGGAGGGCTGGGCTGCAGG - Intronic
1019139421 6:169934178-169934200 GCCTGGGCTGGCTCGGATGCTGG + Intergenic
1019331890 7:464409-464431 TCCAGGGCAGGGTGGGGTGAAGG - Intergenic
1019510118 7:1413643-1413665 TCCAGGGCAGGCTGGGAGGCCGG + Intergenic
1019875682 7:3808517-3808539 TGCAGGTCGGGCTGGGATTGAGG - Intronic
1019934683 7:4246587-4246609 TCCTGGGCAGGGTGGGAGGCTGG - Intronic
1021629579 7:22631250-22631272 CACAGGGCAGGCTGGCATGCTGG + Intronic
1021894907 7:25224091-25224113 TCCATGGCTGGCTGGGCTGGTGG - Intergenic
1022396125 7:29989469-29989491 GCCCGGGCGGGCTGGGAGCCTGG - Intronic
1023927418 7:44679861-44679883 TGCAGGGCGGGCTGGCAGGCTGG - Intronic
1023994740 7:45152366-45152388 TGCAGGGCTGGCTGGAAGGCTGG + Intergenic
1024156291 7:46629158-46629180 TCCAGGGCAGGCCAGGAAGCTGG + Intergenic
1024315716 7:48014820-48014842 TTCAGGGCAGGCTGGCAGGCTGG + Intronic
1024565328 7:50675650-50675672 TGCAGGGCAGGCTGGCAGGCTGG - Intronic
1024730316 7:52246538-52246560 TGCAGGGCAGGCTGGCAGGCTGG + Intergenic
1024942712 7:54778857-54778879 TCCAGGGCAGTCTGTGATGCTGG - Intergenic
1026015221 7:66666779-66666801 TCCAGGGCCGGATGGGAGGCTGG - Intronic
1026891620 7:73985916-73985938 TCCAGGGCCGGATGGAAGGCTGG - Intergenic
1029379653 7:100204802-100204824 TCCAGGGAGGGCTGGGAACGAGG + Intronic
1029528879 7:101112265-101112287 TCCAGGCAGGGCTGGAGTGCTGG - Intergenic
1032080766 7:128857368-128857390 TCCAGGCTGGGCTGGGCTGCAGG - Intronic
1032091487 7:128913792-128913814 TCCAGGCTGGGCTGGGCTGCAGG + Intergenic
1033031864 7:137834574-137834596 TCCAGGAGCAGCTGGGATGCTGG - Intronic
1033348316 7:140542130-140542152 CCCAGGAAGGGCTGAGATGCGGG - Intronic
1034271550 7:149805600-149805622 CCCAGGGGTGGCTCGGATGCTGG + Intergenic
1034552481 7:151830374-151830396 TCCAGGGCGCCCTGAGATGCAGG + Intronic
1034805766 7:154088003-154088025 TCCTGGGTGTGCTGGGATGGAGG + Intronic
1035314531 7:157989882-157989904 GGCAGGGCGGGGTGGGATGCGGG - Intronic
1035599990 8:891760-891782 TCCTGGGCTGGCTGGGATCCTGG - Intergenic
1035600009 8:891827-891849 TCCTCGGCTGGCTGGGATGCAGG - Intergenic
1037764063 8:21761069-21761091 TGCAGGGAGGGCTGGGATTAGGG - Intronic
1037994658 8:23343461-23343483 TCCAAGCCGGGCTGGAAGGCAGG + Intronic
1039212965 8:35236423-35236445 TCCAGGGCTGGCTGGGACCTCGG - Intronic
1040561792 8:48529017-48529039 TACAGGGTGGGCTGGCAAGCTGG - Intergenic
1040901260 8:52419332-52419354 TGCAGGGCAGGCTGGCAGGCTGG - Intronic
1045037588 8:98187956-98187978 GCCAGGGCGTGCAGGGATGGAGG + Intergenic
1047286573 8:123492376-123492398 TCCAGGGTAGGCTGGCAGGCTGG + Intergenic
1047773411 8:128049151-128049173 TGCAGGGCTGGCAGGGAGGCTGG + Intergenic
1047956918 8:129983627-129983649 TCCAGGGCAGGGAGGGATCCAGG + Intronic
1049160745 8:141096059-141096081 TCCAGGGTGCCCTGGGATGCAGG - Intergenic
1049657058 8:143803616-143803638 CCCAGGGCGGGCTGGGGTGGGGG + Intronic
1049781465 8:144430919-144430941 TCCAGGGCAGCCTGAGAGGCTGG + Intronic
1049803708 8:144529707-144529729 TACACGGTGGGCTGCGATGCAGG + Exonic
1050102069 9:2129648-2129670 TCCAGGGAGGGCAGAGAGGCTGG - Intronic
1053010280 9:34628971-34628993 GCCAGGGCCGCCTGGGAGGCGGG - Intergenic
1056035245 9:82597776-82597798 TCCAGGGAGGGCTGGATTTCTGG - Intergenic
1057229136 9:93308363-93308385 TGCAGGGCGGGCTGGGGGCCTGG - Exonic
1057436545 9:95045525-95045547 TCCAGTGCGGTCAAGGATGCTGG + Intronic
1059382257 9:113935466-113935488 TCCAGGGCCAGGTGGGGTGCAGG - Intronic
1059436864 9:114282384-114282406 TCCAGGGAGGGGAGGGATGTGGG - Intronic
1060281874 9:122220489-122220511 TCCCAGGCGGGCTGCGAGGCCGG + Intronic
1061062986 9:128260039-128260061 TCCAAGAAGGGCTGGGAGGCGGG - Intronic
1061601188 9:131671300-131671322 TCCCTGGCGGGCTGAGATGTAGG - Intronic
1061840479 9:133356238-133356260 TGCAGGCCGGGCTGTGATCCAGG - Intronic
1062036428 9:134384614-134384636 TGCAGGGCGTGCTGGGGGGCAGG + Intronic
1062091565 9:134681156-134681178 TGCAGGGAGGGCTGGGGTGGGGG + Intronic
1062544411 9:137055111-137055133 CCCTGGCCGGGCTGGGATGCGGG - Intergenic
1062708893 9:137960745-137960767 ACCAGGGCGGCCTGGGGTCCCGG - Intronic
1185700389 X:2227095-2227117 TGCAGGGCTGGCTGGGGTGCAGG - Intronic
1185755044 X:2646438-2646460 TCCAGGACTGGCTGGGTTCCTGG + Intergenic
1186350184 X:8732186-8732208 TCGAGGGCGAGCTGGGAGGGAGG - Exonic
1188180566 X:27050482-27050504 TGCAGGGCGGGGTGGGTTGTAGG - Intergenic
1197691926 X:129510600-129510622 TCCTGGGGAGGCTGGGATTCTGG - Intronic
1198005675 X:132490097-132490119 TGCAGCGGGGGCTGGGCTGCTGG - Intergenic
1200827698 Y:7660647-7660669 TCCAGGAGAGGCTGGCATGCAGG + Intergenic