ID: 1161209187

View in Genome Browser
Species Human (GRCh38)
Location 19:3057415-3057437
Sequence CCGCTGCCAAGGACAGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 113}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161209176_1161209187 -7 Left 1161209176 19:3057399-3057421 CCCTCTCCTCCCTCCTCCGCTGC 0: 1
1: 0
2: 12
3: 251
4: 2047
Right 1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1161209172_1161209187 25 Left 1161209172 19:3057367-3057389 CCTGGCTGTTGGCTTTCACAGCC 0: 1
1: 0
2: 0
3: 39
4: 280
Right 1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1161209175_1161209187 -4 Left 1161209175 19:3057396-3057418 CCTCCCTCTCCTCCCTCCTCCGC 0: 1
1: 1
2: 49
3: 639
4: 4265
Right 1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1161209177_1161209187 -8 Left 1161209177 19:3057400-3057422 CCTCTCCTCCCTCCTCCGCTGCC 0: 1
1: 2
2: 25
3: 350
4: 3211
Right 1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113
1161209174_1161209187 4 Left 1161209174 19:3057388-3057410 CCGGTGAGCCTCCCTCTCCTCCC 0: 1
1: 0
2: 10
3: 80
4: 812
Right 1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161209187 Original CRISPR CCGCTGCCAAGGACAGCCGG GGG Intronic
900665413 1:3811639-3811661 CTACTGCCCAGGAAAGCCGGGGG - Intergenic
900924254 1:5693056-5693078 ACGCTGCCAGGGCCAGCCAGTGG - Intergenic
901875375 1:12164412-12164434 CCGCTCCAAAGGGCAGCAGGGGG - Intergenic
905010076 1:34741448-34741470 CAGATGCCAGGAACAGCCGGTGG + Intronic
910127551 1:83860711-83860733 CCGCTGCCTGGGACAGCCAAAGG + Intergenic
915445787 1:155974268-155974290 CTGCTGCCAGGTACAGCTGGAGG - Intronic
918766931 1:188499007-188499029 CCACTGCCATGGACAGCCTCAGG + Intergenic
919081809 1:192876163-192876185 CCACTGTCAAGTACAGCCAGTGG + Intergenic
919910902 1:202110123-202110145 CTACAGCCAAGGACAGCCAGAGG + Intergenic
920294442 1:204947256-204947278 CCTCTTCCCAGGGCAGCCGGGGG - Intronic
924379939 1:243453254-243453276 CCACTGCAGAGTACAGCCGGTGG - Intronic
1064033778 10:11899615-11899637 CCACTGCCCAGGCCAGACGGCGG + Intergenic
1067471863 10:46543476-46543498 ACACAGCCAAGGACAGTCGGGGG - Intergenic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1074137881 10:110643962-110643984 CCGTCCCCAGGGACAGCCGGAGG + Intergenic
1074896879 10:117784749-117784771 CCACACTCAAGGACAGCCGGCGG + Intergenic
1074962463 10:118459739-118459761 CCTCTGCCCAGGAAAGCCAGTGG + Intergenic
1075055818 10:119217680-119217702 CCTCTGCCAAGGAAAGGAGGTGG - Intronic
1076629347 10:131842935-131842957 CCTCTGCCATCGACAGCCTGGGG + Intergenic
1077077022 11:706506-706528 CCGCCGCCCAGGACCGACGGGGG - Intronic
1080834480 11:35927763-35927785 CCCCTGCCAAGGAGGGCCGGGGG - Intergenic
1082004032 11:47409960-47409982 GCTCTGGCAAGGACAGCAGGAGG + Intronic
1083954887 11:65977769-65977791 TCGATGACAAGTACAGCCGGAGG + Exonic
1090473528 11:127000516-127000538 GCGCAGCGAAGGAAAGCCGGCGG + Exonic
1091399351 12:173007-173029 CCGCTGCGAAGTCCAGGCGGAGG + Intronic
1096828118 12:54294766-54294788 CAGTTGCCAAGGGCAGGCGGAGG + Intronic
1101729762 12:107417229-107417251 CAGGTCCCAAGGCCAGCCGGTGG - Intronic
1103347350 12:120260055-120260077 CCACTGCCAAGGAGAACCTGGGG - Intronic
1105699536 13:22926208-22926230 CCGCTCCCCAGGACCGCCGTGGG - Intergenic
1113484911 13:110646577-110646599 GCGCTGCCCAGGACACCCGTGGG + Intronic
1113655661 13:112066845-112066867 CCGCGGCCAATGGGAGCCGGCGG - Intergenic
1122518631 14:102326803-102326825 CCGCTGGCATGGACAGCCCCAGG - Exonic
1122540592 14:102495833-102495855 CCCCTGCCCAGAGCAGCCGGCGG + Intronic
1122840618 14:104461176-104461198 CCGCTCCCCAGGACCGCCGTGGG - Intergenic
1123920756 15:25068198-25068220 CCCCTGCCAAGGAGAGCATGAGG + Intergenic
1128721930 15:69956448-69956470 CCCTTGACAAGGACAGCAGGAGG - Intergenic
1129992034 15:79973800-79973822 CCTCTGCAAAGGACAGAAGGAGG - Intergenic
1130366395 15:83243710-83243732 CCGCTGACAGGGACAGCCTGAGG - Intergenic
1132632294 16:924593-924615 CCACTGTCAGGGGCAGCCGGGGG + Intronic
1134056124 16:11170920-11170942 TCGCTGCAGATGACAGCCGGGGG + Intronic
1136616498 16:31401587-31401609 CCTCTGCCAGGGTCAGCCGCTGG - Intronic
1140830929 16:78750215-78750237 CCACTGCCCAGGTCAGCTGGTGG + Intronic
1141174073 16:81707928-81707950 CCCCGGCCAAGGGCTGCCGGGGG - Intronic
1142470539 17:161073-161095 CCGCTGCCAAGGTCAGGCCAGGG + Intronic
1145235926 17:21208410-21208432 CCACTGCCAAGAAGAGCGGGAGG + Intronic
1148337583 17:46851795-46851817 GCGGGGCCAAGGACAGCGGGAGG - Intronic
1150641697 17:66953812-66953834 CCGTTGGCAAGTACAGCGGGTGG + Intergenic
1151162987 17:72181481-72181503 CAGGTGCCAAGGGCAGCAGGAGG - Intergenic
1151557014 17:74851755-74851777 CCGCCGCCACCGACAGCAGGTGG + Intronic
1152469127 17:80481305-80481327 CCTCTGCCCAGGACACCCTGCGG - Intergenic
1153690225 18:7585040-7585062 CCCTTGCCAAGGCCAGCCTGGGG - Intronic
1158434773 18:57428105-57428127 GCGCGGCCAAGGACACCCGAGGG + Intergenic
1160559536 18:79747479-79747501 GCTCTGCCAAGGAAAGCAGGCGG - Intronic
1160802298 19:975998-976020 CCCCTGCCCAGCACAGCCAGGGG + Intergenic
1161209187 19:3057415-3057437 CCGCTGCCAAGGACAGCCGGGGG + Intronic
1165079379 19:33298783-33298805 CCTCTGCCAAGGGCGGCCGTGGG + Intergenic
1165983940 19:39751151-39751173 CTGCTGCCAGGGAGTGCCGGGGG - Intergenic
934105550 2:88691747-88691769 CCGCTGCCCGGGAGGGCCGGGGG + Exonic
938903211 2:135816075-135816097 ACGCTGCCAAAGAAAGCTGGTGG + Intronic
946113097 2:217437437-217437459 CCGCTGCCCAGGTCAGCAAGGGG - Intronic
1173365135 20:42378218-42378240 CTGGTGCCTAGGACAGCGGGAGG + Intronic
1174393843 20:50234028-50234050 CGGCTGCCAAGGAGAGCTGGAGG + Intergenic
1178413900 21:32388365-32388387 CTGCTGCTGAGGACACCCGGGGG - Intronic
1179365416 21:40754592-40754614 CCACGGCCAGTGACAGCCGGAGG - Intronic
1179406286 21:41128485-41128507 CCTGTGCCAAGGATAGCTGGTGG - Intergenic
1179911250 21:44450029-44450051 CCACTGCCACGGCCAGCCGCTGG - Intergenic
1179978335 21:44883470-44883492 CTGCTGCCAAGGCCAGCCTTGGG + Intergenic
1180231055 21:46426924-46426946 CTGGTGCCATGGAGAGCCGGTGG + Intronic
1181694213 22:24584941-24584963 CCCCTGCCAAGGGCAGCCCTAGG + Intronic
1182466495 22:30520061-30520083 TGGCTGCCAAGGACAGCCACTGG - Intergenic
1183439598 22:37815743-37815765 GCGCAGCCAACGACAGCAGGTGG - Exonic
1183929104 22:41225960-41225982 CTGATGGCAAGGACAGCAGGTGG - Intronic
1185246064 22:49773735-49773757 CCGCTGCCCGTGACCGCCGGTGG - Exonic
952902780 3:38120963-38120985 CAGCTGCGAAGGACAGCCCTGGG + Intronic
953928659 3:46995265-46995287 CCGCTGCCAAGAGCAGCTGCTGG + Exonic
955996939 3:64687698-64687720 CCGCAGCCAAGGAGGGCAGGAGG - Exonic
957775958 3:84757313-84757335 CAGGTGCCAAGAACAGCCAGAGG + Intergenic
966595161 3:181719437-181719459 GCGCTCCCCAGGGCAGCCGGCGG - Intergenic
966768080 3:183480078-183480100 GTGCCGCCAAGGACAGCCTGGGG - Intergenic
968046382 3:195626014-195626036 CCGCTCCCCAGGGCACCCGGTGG + Intergenic
968308271 3:197664077-197664099 CCGCTCCCCAGGGCACCCGGTGG - Intergenic
969428566 4:7139781-7139803 CCCCTCCCAAGGGCAGCCGGAGG - Intergenic
977349775 4:95867679-95867701 CCCCTGCCATGTACAGCCTGTGG + Intergenic
979919495 4:126479595-126479617 CCACTGCCCAGGGCTGCCGGGGG + Intergenic
984811184 4:183797632-183797654 CCGCTCCCAGGAACAGCCGCCGG - Intergenic
985272635 4:188208646-188208668 CCCCAGCCAAGGAGAGCCTGCGG - Intergenic
985791561 5:1931043-1931065 GCCCTGCCTAGGGCAGCCGGCGG + Intergenic
990081535 5:51921778-51921800 CCACTGCCAAGGACAAACGTAGG + Intergenic
994578588 5:101611305-101611327 CAGCTGCCAAGCACAGCAGAAGG + Intergenic
997727471 5:136133284-136133306 CCGCTCCCCAGGACAGCGCGGGG - Intronic
1007662400 6:43494961-43494983 CGGCAGCCAAGGACAGCCTCTGG - Intronic
1008482348 6:51998960-51998982 CTCCAGCCAAGGACAGCCAGGGG + Intronic
1013010963 6:106119555-106119577 CTGCTTCCAAGGACAACCTGCGG - Intergenic
1019641756 7:2107077-2107099 TGGCTGCCTGGGACAGCCGGAGG + Intronic
1022496291 7:30855089-30855111 CCTCTGCCCAGGCCAGGCGGTGG - Intronic
1026359755 7:69592023-69592045 CCGCCGCCAGGTACAGCAGGAGG + Intergenic
1026977104 7:74505572-74505594 CCGCTGTCTGGGGCAGCCGGGGG + Intronic
1027054853 7:75042972-75042994 CCTCTGCCAAGGAGTGCCAGTGG + Exonic
1029693636 7:102199054-102199076 CCTCTCCCAAGCACAGGCGGGGG + Intronic
1031597123 7:123661112-123661134 CTGCTGCTCAGGACAGCAGGAGG - Intronic
1034982461 7:155487791-155487813 CCTCTGCCCAGGACAGGCCGTGG + Intronic
1035862645 8:3046622-3046644 ACGCTGCCAAGGCCTGCCTGGGG - Intronic
1048144324 8:131825413-131825435 CCTCTGCCAAGGACAGAGGCAGG - Intergenic
1048556668 8:135484423-135484445 TGGCTGCCAGGCACAGCCGGCGG - Intronic
1049036025 8:140076683-140076705 CCGATGCCAAGGCCAGCCTTGGG - Intronic
1049362707 8:142219837-142219859 CCGCTGCCCAGGACAACCCATGG + Intronic
1049819906 8:144627170-144627192 CAGCTGCCAGGGACAGGCGGGGG + Intergenic
1051621006 9:19049439-19049461 CCGTTGCCACTGACAGCCGCGGG + Exonic
1057353837 9:94319777-94319799 CTGGAGCCAAGGACACCCGGAGG + Intronic
1057653914 9:96937815-96937837 CTGGAGCCAAGGACACCCGGAGG - Intronic
1060209445 9:121700807-121700829 CAGCTGCCAAGCCCAGCCTGAGG + Intronic
1060359559 9:122941541-122941563 GCGCAGCCCAGGACAGCCTGAGG - Intronic
1060400170 9:123344057-123344079 CCCATGCCAGGGACAGCCTGTGG - Intergenic
1061985579 9:134128468-134128490 CTGCTGCCACGGACATCCTGGGG + Intergenic
1062520524 9:136955859-136955881 CCGCTGCCTGGGACAGCTCGGGG - Intronic
1185722717 X:2395103-2395125 CTGGGGCCAAGGACAGCCCGAGG + Intronic
1185891804 X:3828568-3828590 CCGCTGGCACGGACAGCCCCGGG + Intronic
1185896913 X:3866982-3867004 CCGCTGGCACGGACAGCCTCGGG + Intergenic
1185902031 X:3905408-3905430 CCGCTGGCACGGACAGCCCCGGG + Intergenic