ID: 1161209248

View in Genome Browser
Species Human (GRCh38)
Location 19:3057632-3057654
Sequence CAGTGTTGGGGGCGGGCGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161209248_1161209259 -10 Left 1161209248 19:3057632-3057654 CCTGTCGCCCGCCCCCAACACTG 0: 1
1: 0
2: 0
3: 20
4: 209
Right 1161209259 19:3057645-3057667 CCCAACACTGGACCTGGGGGCGG 0: 1
1: 0
2: 2
3: 12
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161209248 Original CRISPR CAGTGTTGGGGGCGGGCGAC AGG (reversed) Intronic
901749393 1:11396706-11396728 CAGTGTTGGGGTGGGGTGAGAGG - Intergenic
901909249 1:12441339-12441361 CACTGTCCGGGGCGGGGGACAGG + Intronic
902798652 1:18815873-18815895 CAGGGCTGGGGGTGGGGGACTGG - Intergenic
902873032 1:19325632-19325654 CAGTTGTGGGGGGGGGCGCCTGG + Intronic
903813803 1:26049865-26049887 CAGTATGGGAGGCGGGAGACAGG + Intergenic
905340394 1:37273909-37273931 TAGTGGTGGGGGCGGGGGGCTGG - Intergenic
906190714 1:43898001-43898023 CAGTGTTAGGGACGGGCTCCCGG + Intronic
906332272 1:44896365-44896387 AAGTGTTGTGGGGGGGTGACAGG + Intronic
906974775 1:50558379-50558401 CACTGGTGGGGTCGGGGGACGGG + Intronic
907301682 1:53490805-53490827 CAGGGTTGGGGGAGGGCAAGAGG - Intergenic
912804428 1:112744134-112744156 CAGGGTTAGGGACGGGTGACCGG - Intergenic
914430785 1:147619165-147619187 CAGTGTGGGGGGCTCGCCACTGG - Exonic
916975365 1:170071747-170071769 CAGTGTTGGGAGCTGGAGCCTGG - Intronic
918110350 1:181450235-181450257 CAATGTTGGGGGAGGGCACCTGG - Intronic
1063583626 10:7331561-7331583 CAGTGGTGGGTGCAGGAGACAGG - Intronic
1066254354 10:33664158-33664180 CAGTGTTGGGGCCTGGGCACGGG - Intergenic
1067216301 10:44307038-44307060 CAGTGTTGGAGGTGGGCCTCTGG - Intergenic
1068444503 10:57103935-57103957 CTGTGGTGGGGTCGGGGGACGGG - Intergenic
1068878047 10:62018604-62018626 CAGTGGTGGGGGCGGGGGAGGGG - Intronic
1069613837 10:69793429-69793451 CAGTGGTGGGGGCGGGCAGAGGG + Intergenic
1069783834 10:70975370-70975392 CAGTGTTGGAGGCAGGAGCCAGG - Intergenic
1074649918 10:115509371-115509393 CAGTGTTGGAGGTGGGGGCCTGG + Intronic
1074885375 10:117689055-117689077 CAGAGTTGGAGGGTGGCGACGGG + Intergenic
1075793822 10:125104909-125104931 CAGGGGTGGGGGCGGGAGAAGGG - Intronic
1077264575 11:1642414-1642436 CAGTGGAGGGGGCGGGCCAGGGG - Intergenic
1077332005 11:1987947-1987969 CGGCGTGGGTGGCGGGCGACGGG - Intergenic
1077351776 11:2096472-2096494 CAGGGTGGGGGGCGGGCTGCTGG + Intergenic
1077478512 11:2802307-2802329 CAGTGCTGCCGGCTGGCGACAGG - Intronic
1081204894 11:40263524-40263546 CAGTTTTGGGGGCGGGGGATGGG + Intronic
1081654164 11:44846402-44846424 CAGTGATGGGGGAGGGCGCTTGG + Intronic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1082892069 11:58150344-58150366 CAGTGTTGGGGGAGAACCACTGG + Intronic
1083980027 11:66159599-66159621 CAGTTTTGGGGGTGGGGGAGCGG + Intronic
1084068451 11:66718863-66718885 CAGTGTTGGGGAGGGGAGAGAGG + Intronic
1084321889 11:68377795-68377817 CAGAGCTGGGGGTGGGCGTCCGG + Intronic
1085411919 11:76296481-76296503 CAGTGTTGGGGCTGGGGTACAGG + Intergenic
1087183390 11:95160822-95160844 GTGTGTTGGGGGCGGGGGATGGG - Intergenic
1089273257 11:117315847-117315869 CAGACTTGGGGGCAGGCGCCAGG - Exonic
1202814986 11_KI270721v1_random:43123-43145 CGGCGTGGGTGGCGGGCGACGGG - Intergenic
1092852947 12:12647494-12647516 CAGTGTTGGGAGGTGGGGACTGG - Intergenic
1095327700 12:40917049-40917071 CAGTGGTGGGGGCGGGGGGGGGG + Intronic
1095506613 12:42905478-42905500 CAGGGTGGGAGGCGGGCAACTGG + Intergenic
1096647602 12:53047231-53047253 CAGTGGCGGGAGCGGGCGGCCGG - Intronic
1096647675 12:53047430-53047452 CAGTGCCAGGGGCGGGCGCCAGG + Intronic
1096921882 12:55096403-55096425 CAGTGGTGGGGTCGGGGGAGGGG - Intergenic
1097840014 12:64312465-64312487 CAGGTTTGGTGGCGGGCGCCTGG + Intronic
1103137289 12:118518568-118518590 CAGTGTTGGAGGTGGGAGCCTGG - Intergenic
1103373853 12:120439881-120439903 CTGTGATGGGGGCGGGGGAGGGG - Intronic
1103919214 12:124390723-124390745 GAGTGTTGGGGGCGTGTGCCTGG - Intronic
1106020448 13:25909796-25909818 CTGAGTTGGGGGAGGGCGGCGGG - Intronic
1107886961 13:44881570-44881592 CAGTGTGGGGGGCGAGGGAATGG + Intergenic
1109033121 13:57219476-57219498 CTGTGGTGGGGTCGGGGGACGGG - Intergenic
1114270732 14:21098463-21098485 CAGGGCCGGGGGCGGGGGACCGG - Exonic
1117547995 14:56808954-56808976 CAGCGCCGGGCGCGGGCGACGGG - Intronic
1117893593 14:60452498-60452520 AAAGGTTGGGGGCGGGGGACTGG + Intronic
1117898587 14:60511015-60511037 AGGTGGTGGGGGCGGGCGACGGG + Intronic
1119424072 14:74524608-74524630 CAGTGATGGGGGCGAGGGGCGGG - Intronic
1119994427 14:79237446-79237468 CAGGGTTGGTTGCGGGGGACAGG + Intronic
1120915108 14:89703602-89703624 CAGTGTTGGAGGTGGGGGCCTGG - Intergenic
1122274128 14:100582594-100582616 CTGTGTTGGGTGCTGGGGACTGG - Intronic
1122795744 14:104205315-104205337 CAGTGTAGGGGGCAAGGGACAGG + Intergenic
1122968663 14:105143687-105143709 CAGTGTTGGGGGCAGGCTGCTGG - Intronic
1202872437 14_GL000225v1_random:177262-177284 CTGTGACCGGGGCGGGCGACCGG - Intergenic
1124127079 15:26945807-26945829 CAGGGGTGGGGGCGGGTGGCAGG - Intronic
1125085199 15:35721737-35721759 CACTGTTGGGGGATGGCGGCAGG + Intergenic
1125508296 15:40279949-40279971 CGGGGTTGGGGGCGGGGGTCCGG - Intronic
1125534619 15:40436140-40436162 CGGGGTTGGGGGTGGGCGAGGGG + Intergenic
1128765378 15:70248111-70248133 CAGTGTTGGGGGTGGGCAGTGGG - Intergenic
1129910941 15:79225764-79225786 CAGGGTTGGGGGCGTGGGGCAGG + Intergenic
1133513513 16:6483683-6483705 GAGGGACGGGGGCGGGCGACAGG + Intronic
1135155590 16:20050218-20050240 CAGTGATGGGAGCGGGCAATAGG + Intronic
1136414665 16:30096004-30096026 CGGGGGTGGGGGCGGGCGCCGGG + Exonic
1140809730 16:78565899-78565921 CAATGTTGGGGGCGGGGGGCGGG - Intronic
1143375754 17:6466151-6466173 CAGTGTGGGGGGCGGGACAGCGG - Intronic
1143562428 17:7703873-7703895 CAGTGTGGAGTGTGGGCGACAGG - Intergenic
1144274780 17:13655921-13655943 CAGTGTTGGAGGTGGGTGCCTGG + Intergenic
1144877997 17:18412313-18412335 CAGTGTTGGCTGCGGGCGAAAGG + Intergenic
1144967884 17:19089355-19089377 GAGGGTTGGGGGCGGGGGCCTGG - Intergenic
1144980033 17:19162708-19162730 GAGGGTTGGGGGCGGGGGCCTGG + Intergenic
1144988189 17:19215524-19215546 GAGGGTTGGGGGCGGGGGCCTGG - Intergenic
1145954100 17:28842724-28842746 AAGTGGTGGCGGCGGGCGGCGGG - Exonic
1147213567 17:38886279-38886301 CAGGGCTGGGGGCTGGGGACTGG + Intronic
1147806158 17:43133325-43133347 CAGTGGTGAGGGCAGGGGACAGG + Intergenic
1148167564 17:45493899-45493921 CAGTGGTGAGGGCAGGGGACAGG - Intergenic
1148475865 17:47928173-47928195 CAGTGTTGGGAGCGGGGATCGGG - Exonic
1150285143 17:63950061-63950083 CAGTGTTGGGAGCGGGAGTGGGG + Intronic
1150313063 17:64145429-64145451 GTGTGTTGGGGGGGGGCGGCGGG + Intergenic
1151464251 17:74274342-74274364 CAGGGTAAGGGGCGGGCGCCAGG + Intronic
1155735184 18:29212982-29213004 CAGTGTTGGGAGGTGGGGACTGG - Intergenic
1160455214 18:78994703-78994725 CATTGCTGGGGGCCGGCGACAGG - Exonic
1160490886 18:79336005-79336027 CGGTGCTGGGGACGGGCGAGGGG - Intronic
1160490906 18:79336067-79336089 CGGTGCTGGGGACGGGCGAGGGG - Intronic
1160490926 18:79336129-79336151 CGGTGCTGGGGACGGGCGAGGGG - Intronic
1160927802 19:1555501-1555523 CAGGGGTGGGCGCGGGAGACGGG - Exonic
1161046673 19:2138585-2138607 CAGTGCTGGGCGCTGGCCACTGG + Intronic
1161209248 19:3057632-3057654 CAGTGTTGGGGGCGGGCGACAGG - Intronic
1161352849 19:3803481-3803503 CAGTGTTTGGGACGGGGGGCAGG - Intergenic
1162050421 19:8029201-8029223 CAGGGTGGGGGGCGGGGGGCAGG + Intronic
1165958484 19:39516102-39516124 CAGGGTTGGGGTAGGGCGAGGGG + Intronic
1166214665 19:41327489-41327511 CCGTCTTGGGGGCGGGGGAGGGG + Intronic
1167522063 19:49960998-49961020 CCGTGCTGGGGGCGGGTGAGTGG - Exonic
1167523319 19:49969727-49969749 CCGTGCTGGGGGCGGGTGAGTGG + Intergenic
1167723057 19:51192168-51192190 CAGTGTTTGGGGCAGGGGATGGG + Intergenic
1167748844 19:51368102-51368124 CCGGGTTGGGGGCAGGAGACGGG - Intronic
925366416 2:3315039-3315061 AGGTGTTGGGGGCGGGTGGCGGG - Intronic
925390988 2:3493845-3493867 CAGTGGTGTGGGCGGGAGACAGG + Intergenic
925934118 2:8736814-8736836 CAGCGCTGGGGGCGGAAGACAGG - Intronic
926622611 2:15060563-15060585 CAGTGTTGGGGGTGGGTCCCAGG + Intergenic
929398331 2:41550157-41550179 CAGTGGTGGGGTCGGGGGAGGGG - Intergenic
932055278 2:68437124-68437146 AAGTGTTGGGGGAGGGGGACAGG - Intergenic
932414378 2:71564828-71564850 CAGCTTTGGGGACGGGTGACAGG + Intronic
933969163 2:87456246-87456268 CAGCGCTGGGGGTGGGGGACTGG + Intergenic
934555098 2:95282918-95282940 CTGTGTTTGGGGAGGGCGAGGGG - Intronic
936020124 2:108988448-108988470 CTGTGTTGGTGGCGGGGGAGCGG - Intronic
936324628 2:111494262-111494284 CAGCGCTGGGGGTGGGGGACTGG - Intergenic
936983099 2:118282363-118282385 CAATGTTGGGGGCGGGGGGATGG + Intergenic
938064279 2:128272643-128272665 CAGAGTTGGGGGCCAGAGACAGG + Intronic
942609534 2:177728370-177728392 CAGGGTTGGGGGCGGGGGGAGGG + Intronic
945469511 2:210211466-210211488 CAGTGTTGGAGGAGGGGGCCTGG + Intronic
949010863 2:241677601-241677623 CAGCGGTGGGCACGGGCGACTGG + Intronic
1171205642 20:23278549-23278571 CAGTGTTGGTGGCTGCTGACTGG - Intergenic
1174411153 20:50337268-50337290 CAGGGTTGGGGGTGGGAGATGGG + Intergenic
1174613826 20:51820627-51820649 AAGTGTTGGGGGTCGGTGACAGG + Intergenic
1175225073 20:57439852-57439874 CAGTGATGTGGGAGGGGGACAGG - Intergenic
1176132337 20:63501658-63501680 CAGTGTGGGGGACGGGGGACAGG + Intergenic
1176987698 21:15456310-15456332 CAGGGTTGGGGGCGGGGGTGTGG - Intergenic
1178637389 21:34316225-34316247 CAGGGTTGGGGGTAGGGGACTGG + Intergenic
1179439480 21:41382982-41383004 CAGGGGTGAGGGAGGGCGACCGG + Intronic
1179788604 21:43743206-43743228 CAGTGCTGGGGGCGGGGGGAGGG - Intronic
1179788675 21:43743409-43743431 CAGTGCTGGGGGCGGGGGAGAGG - Intronic
1179940422 21:44636210-44636232 CAGGGTTGGGTGCTGGAGACCGG - Intronic
1181592809 22:23895298-23895320 CGGTGTTGGGGGCGGGGGTCAGG + Exonic
1182686113 22:32122602-32122624 CAATGTTGGTGGTGGGGGACGGG + Intergenic
1183105149 22:35610219-35610241 CAGGGTTGGGGGCAGGAGCCTGG - Intronic
1183301605 22:37061598-37061620 CAGCTCTGGGGGCGGGCGAGGGG - Exonic
1183617548 22:38954666-38954688 CTCTGTTGGGGGCGGGGCACAGG + Intronic
1184920621 22:47603274-47603296 CAGTGTTGGAGGTGGGGGCCTGG + Intergenic
1184920643 22:47603352-47603374 CAGTGTTGGAGGTGGGGGCCTGG + Intergenic
1184920665 22:47603430-47603452 CAGTGTTGGAGGTGGGGGCCTGG + Intergenic
1184920687 22:47603508-47603530 CAGTGTTGGAGGTGGGGGCCTGG + Intergenic
952451829 3:33440258-33440280 AAGGCTTGGGGGCGGGTGACGGG - Exonic
952481207 3:33763629-33763651 CAGTGTTGGGGGAGGAGGAGAGG + Intergenic
953282465 3:41572411-41572433 CAGTGGTGGGGGGAGGGGACAGG - Intronic
953385258 3:42502581-42502603 CAGGGCTGGGGGCGGGCCCCGGG - Intronic
957194052 3:77045042-77045064 CAATGTTGGGGGAGGGAGGCGGG + Intronic
957961292 3:87256921-87256943 CAGTGTTTGGGGATGGCGGCGGG - Intergenic
958774505 3:98466045-98466067 CTGTGGTGGGGTCGGGGGACCGG - Intergenic
959838981 3:110952003-110952025 CAGTGTTGGAGGTGGGGGCCTGG + Intergenic
961644736 3:128386889-128386911 CAGTGTTGGAGGTGGGCCTCGGG - Intronic
962241724 3:133755875-133755897 CGGTGATGGGGGCAGGAGACAGG - Intronic
962808874 3:138945705-138945727 CACTGGTGGGCGCGGGCGCCGGG + Exonic
965264032 3:166518123-166518145 CAGTGTTGGGGGCTGGGGGAGGG - Intergenic
967824831 3:193869752-193869774 CAGGGCTGGGGGCGGGAGCCGGG - Intergenic
967859469 3:194140825-194140847 CACTGCTGGGGGCCGGCGAGAGG - Intergenic
968110890 3:196045616-196045638 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
970093656 4:12437498-12437520 CGGGGTGGGGGGCGGGGGACAGG + Intergenic
971171912 4:24242316-24242338 CAGTGCTGGGGGTGGGCGTCAGG - Intergenic
977940348 4:102850924-102850946 CTTTGTTGGGGGCGGGTGAGAGG + Intronic
978133305 4:105226461-105226483 CAGTGTTGGAGGTGGGGGCCTGG + Intronic
978471901 4:109077431-109077453 GAGTGTTGGGGGCGGGGGGGTGG - Intronic
980153964 4:129081669-129081691 CAGTGTTGGAGGAGGGGGCCTGG - Intronic
981081444 4:140642813-140642835 CCCTCTTGCGGGCGGGCGACAGG + Intronic
983353375 4:166623149-166623171 CAGTGTTGGGGGCGGGGTCATGG - Intergenic
983559147 4:169083929-169083951 GAGTGTTGGGGGCTGGGGAGCGG + Intergenic
984627935 4:182029293-182029315 CAGTGTTGGAGGTGGGGGCCTGG - Intergenic
985973189 5:3393424-3393446 CACGGTGGGGGGCGGGGGACTGG - Intergenic
988957530 5:36333944-36333966 CAGTGGTGGGGGCAGTCTACTGG - Intergenic
996888849 5:128393156-128393178 CGGTGTGGGGGCCGGGGGACAGG - Exonic
997600751 5:135136802-135136824 TAGTGTTGTGGGCGGGGGAGGGG - Intronic
1000546686 5:162611207-162611229 CAGTGTTGGAGGTGGGGTACGGG + Intergenic
1001266532 5:170278370-170278392 CAGGGGTGGGGGCTGGCGAGGGG + Intronic
1002079760 5:176730384-176730406 CAGGGATGGGGGTGGGGGACAGG + Intergenic
1002521711 5:179796096-179796118 CGAAGCTGGGGGCGGGCGACGGG + Intronic
1002809493 6:613503-613525 CAGTGTTGGGCACAGGGGACAGG - Intronic
1003129544 6:3383776-3383798 GTGAGGTGGGGGCGGGCGACGGG + Intronic
1003664998 6:8102434-8102456 CAGTGCTCAGGGCGAGCGACAGG - Exonic
1003818070 6:9863873-9863895 CAATGTTGGTGGGAGGCGACTGG - Intronic
1004176386 6:13343840-13343862 CAGTGTTGGAGGTGGGGGCCTGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1007904049 6:45441059-45441081 CAGTGTTGGGGCAGGGGGAGTGG + Intronic
1013099603 6:106975260-106975282 CCGCGTGGGGGGCGGGCGCCGGG + Intronic
1014015685 6:116527373-116527395 CAGGCTTGGTGGCGGGCGCCTGG + Intronic
1015399529 6:132773271-132773293 CAGTTTTGGGGGCGGGGGGGTGG + Intronic
1017877822 6:158538121-158538143 CAGAGTAGGGGGCGGGGGACGGG - Intronic
1020101573 7:5397072-5397094 GAGTGTTGGGGGCCGGACACGGG - Intronic
1021907371 7:25348684-25348706 CAGAGTTGGGGGCAGGAGACTGG + Intergenic
1024480034 7:49853289-49853311 AAGTGCTGGGGGCCGGCCACAGG - Intronic
1025527651 7:61836423-61836445 CAGTGGTGGGGTCGGGGGAGGGG - Intergenic
1026848037 7:73708564-73708586 GAGTGTGTGGGGCGGGGGACGGG - Intronic
1027200655 7:76062059-76062081 CACTGTTGGAGGTGGGGGACGGG - Intronic
1029360095 7:100082013-100082035 CGGCCTTGGGGGCGGGCGGCGGG + Intronic
1029476205 7:100786248-100786270 CAGGGGTTGGGGCGGGCGACTGG + Intronic
1030241610 7:107332274-107332296 CAATGTTGAGGGTGGGCCACAGG + Intronic
1031271597 7:119656860-119656882 CTGTGGTGGGGTCGGGGGACGGG - Intergenic
1032079161 7:128850051-128850073 CAGTGTGTGGGGCGGGCGCCGGG - Exonic
1034482404 7:151332611-151332633 CAGTCTTGGGGGAAGGCAACAGG + Intergenic
1034499015 7:151438292-151438314 CAGCGTTGGAGGCTGGCGTCTGG + Intronic
1034720403 7:153286941-153286963 CAGCGTTGCGGGTGGGGGACGGG - Intergenic
1035367359 7:158357843-158357865 CAGAGTTGAGGGCTGGCGGCTGG - Intronic
1036146244 8:6257644-6257666 CAATGTTGGGGGAGGGGGCCTGG - Intergenic
1039697979 8:39932439-39932461 CTGGGATGGGGGCGGGCGAGTGG - Intergenic
1042194383 8:66220075-66220097 CAGGGGTGGGTGCGGGTGACGGG + Intergenic
1045676667 8:104614999-104615021 CAGTGGTGGGGGTGGGTGAAGGG + Intronic
1048484062 8:134831709-134831731 CAGGGTATGGGGCGGGCGGCGGG - Intergenic
1049204849 8:141358908-141358930 CAGGGTGGGGGGCGGGCGAGGGG + Intronic
1049441834 8:142613116-142613138 CGCTGTTGGGGGCGGGCGTGAGG + Exonic
1051629318 9:19127613-19127635 CGGCGTTGGGGGAGGGCGCCGGG - Intronic
1053283187 9:36834842-36834864 CAGGGTGGGGGGCGGGGGTCAGG + Exonic
1056357050 9:85811441-85811463 CTGTGGTGGGGTCGGGGGACGGG - Intergenic
1057739220 9:97697275-97697297 CAGAGATGGCGGCGGCCGACGGG - Exonic
1057801329 9:98192851-98192873 CAGTGATTGGGGCGGGCTGCCGG + Intergenic
1058153378 9:101486382-101486404 AAGGGCTGGGGGAGGGCGACTGG - Intronic
1059463914 9:114453372-114453394 CAGTGTTGGAGGGGGCCTACTGG - Intronic
1062232161 9:135487656-135487678 CAGTGTGGAGGGGGGGCGTCGGG + Exonic
1062478847 9:136742353-136742375 CAGAGTTGGGGGCCGGGGGCCGG - Intronic
1062543943 9:137053531-137053553 CAGGCCTGGGGGCGGGCGTCCGG + Intronic
1185760238 X:2685004-2685026 CAGTGTTGGAGGTGGGGGCCTGG - Intergenic
1186392329 X:9173417-9173439 CAGTGTCGGGGGCGGGGGGGGGG + Intergenic
1189760265 X:44314998-44315020 CAGTGTTGGAGGTGGGGGCCTGG + Intronic
1190735045 X:53250571-53250593 CACTGTTGGGGGCTGGTGGCAGG + Exonic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1194836333 X:98687642-98687664 CTGTGGTGGGGTCGGGGGACGGG - Intergenic
1195757160 X:108210870-108210892 CAGTGATGGGGGTGGGTGGCTGG - Intronic
1198173936 X:134135963-134135985 CAGTGTTGGGGGAGGGGGCCTGG + Intergenic
1198839424 X:140840835-140840857 CAGTGTTGGGTGAGGGAGCCAGG + Intergenic
1202276328 Y:23124315-23124337 GAGTGTTGGGGTTGGGGGACGGG + Intergenic
1202289700 Y:23296375-23296397 GAGTGTTGGGGTTGGGGGACGGG - Intergenic
1202429322 Y:24758040-24758062 GAGTGTTGGGGTTGGGGGACGGG + Intergenic
1202441469 Y:24912050-24912072 GAGTGTTGGGGTTGGGGGACGGG - Intergenic