ID: 1161209683

View in Genome Browser
Species Human (GRCh38)
Location 19:3059899-3059921
Sequence CAGTTTGCCCAGCTTGAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 488}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161209681_1161209683 2 Left 1161209681 19:3059874-3059896 CCAGCACCTTCGACTGTCAGTGT 0: 1
1: 0
2: 0
3: 4
4: 135
Right 1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG 0: 1
1: 0
2: 1
3: 32
4: 488
1161209680_1161209683 21 Left 1161209680 19:3059855-3059877 CCTGCATGGAAAGCTGACTCCAG 0: 1
1: 1
2: 0
3: 17
4: 169
Right 1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG 0: 1
1: 0
2: 1
3: 32
4: 488
1161209682_1161209683 -4 Left 1161209682 19:3059880-3059902 CCTTCGACTGTCAGTGTCTCAGT 0: 1
1: 0
2: 0
3: 8
4: 125
Right 1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG 0: 1
1: 0
2: 1
3: 32
4: 488

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161209683 Original CRISPR CAGTTTGCCCAGCTTGAGAA TGG Intronic
900687334 1:3957109-3957131 CAGTTTGCCCATCTAGAAATTGG + Intergenic
901671999 1:10861584-10861606 CAGTTTCCCCAGCTTGAGTCTGG + Intergenic
901837768 1:11935211-11935233 CAGTTTGCCCAGCTGGAAAACGG - Intronic
902396642 1:16135531-16135553 CAGTTTCCCCATCTGCAGAAGGG + Intronic
902790859 1:18766922-18766944 CAGTTTCCCCAACTAGAAAATGG - Intergenic
902800761 1:18828586-18828608 CAGTTTTCCCATCTAGAAAATGG + Intergenic
902982526 1:20135795-20135817 GAACTTCCCCAGCTTGAGAAAGG - Intergenic
903247263 1:22025281-22025303 CAGTTTGCCCAACTGCAAAATGG - Intergenic
903326214 1:22570024-22570046 CAGTTTCCCCATCTATAGAAAGG + Intronic
904568173 1:31440962-31440984 CAGTTTCCCCATCTGCAGAATGG + Intergenic
904680188 1:32223588-32223610 CAGTTTTCTCATCTTGAAAATGG - Intronic
904847581 1:33431329-33431351 CAGTTTTCCCACCTTGCGGATGG + Intergenic
905269878 1:36780915-36780937 CAGTTTCCCCAGCTGTAGAAGGG + Intergenic
905329304 1:37181167-37181189 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
906117571 1:43366669-43366691 CAGTTTGTCCTACTTCAGAATGG + Intronic
906172371 1:43737950-43737972 CAGTTTGCTCAACTGGAAAATGG - Intronic
906931146 1:50170748-50170770 CACCATGCCCAGCTTAAGAATGG - Intronic
907020840 1:51065644-51065666 CACTGTGCCCAGCTTGGGAAAGG + Intergenic
907233212 1:53020585-53020607 CACTGTGCCCAGCCTGAAAATGG + Intronic
907334406 1:53690922-53690944 CAGTTGCCCCAGCTGGAAAAAGG - Intronic
907358473 1:53895584-53895606 CAGCCAGCCCAGCTTGTGAATGG + Intronic
907428358 1:54395677-54395699 CAGTTTTCCCATCTGTAGAATGG - Intronic
907664980 1:56426782-56426804 CAGTTTGCCCATCTGTAAAATGG + Intergenic
907910104 1:58817910-58817932 CAGTTTCCCCACCTGGAAAAAGG + Intergenic
908062052 1:60361048-60361070 CAGTTTGCTCATCTTTAAAATGG + Intergenic
909339365 1:74514586-74514608 CAGTTTTCCCATCTTCAAAATGG - Intronic
910660740 1:89669628-89669650 CTGTTTTCTCATCTTGAGAATGG - Intronic
911169588 1:94756848-94756870 CAGTTTGACTTGCTTGGGAAAGG - Intergenic
912901030 1:113648664-113648686 CAGTTTTCCCACCTAGAAAATGG + Intronic
913000811 1:114578875-114578897 CAGTTTTCCCAGCTAAAAAATGG + Intronic
916407843 1:164515090-164515112 CAGTGTGGGCAGTTTGAGAATGG + Intergenic
916568195 1:166000900-166000922 CAGTTTGCCCAGCTACAAAATGG + Intergenic
917708636 1:177660489-177660511 CAGGGTGCACAGCTTGGGAATGG + Intergenic
919051674 1:192519142-192519164 CATTTTGCCAAGTTTGAAAAAGG + Intergenic
920374395 1:205499735-205499757 CTGTTTGCTCACCTAGAGAATGG - Intergenic
920558538 1:206922287-206922309 CAATTTTCCCTGCCTGAGAAAGG + Intronic
921290669 1:213654033-213654055 CAGTTTGCCCATCTGTACAATGG - Intergenic
923428637 1:233897353-233897375 CAGTTTGTCCAGCTGGTGAGTGG + Intergenic
1063411374 10:5839247-5839269 CAGTTTGTTCATCTGGAGAATGG + Intronic
1063521473 10:6745237-6745259 CAGTTTTCCCATCTTTAAAATGG + Intergenic
1063531762 10:6840035-6840057 CAGTTTTCTCAGCTTGCTAAGGG - Intergenic
1063670695 10:8097411-8097433 CAGTTTGCCCAGCTAGTTAGTGG + Intergenic
1068561186 10:58515723-58515745 CAGTTTGCCCATCTGTAAAATGG + Intronic
1068874844 10:61984963-61984985 CAGTTTGCCCATCTGAAAAATGG + Intronic
1069644122 10:69979725-69979747 CAGTGTGTCCAGCTTGAAGATGG - Intergenic
1069821249 10:71230003-71230025 CAGTTTGCCCAGCCATAAAAGGG - Intronic
1069910139 10:71753954-71753976 CAGTTTCCCCAGCTCTAAAATGG - Intronic
1070342629 10:75511546-75511568 AAATTGGCCCAGCTTGGGAAAGG + Intronic
1070415233 10:76183054-76183076 CAGTCTGCCCATCTTTAGGAAGG + Intronic
1071267452 10:83976641-83976663 CAGTTTCCCCAGCTTCATCAGGG + Intergenic
1071498391 10:86186620-86186642 CAGTTTTCCCATCTGGAAAATGG + Intronic
1071538161 10:86454104-86454126 CCATTTGCCCTGTTTGAGAAAGG - Intronic
1072294650 10:93997453-93997475 CAGTTTTCCCATCTTCAAAATGG - Intronic
1072437004 10:95423004-95423026 CAGTTTGCCCATCTGAAAAATGG + Intronic
1072937665 10:99729171-99729193 CACCATGCCCAGCTGGAGAAAGG - Intronic
1073838607 10:107472440-107472462 CAGTGTGACCAGTTTCAGAAAGG - Intergenic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1075199687 10:120392212-120392234 CAGTTTGCCCATCTGTAAAATGG + Intergenic
1075210457 10:120486465-120486487 CAGTTTGACCAGCTGTAAAATGG + Intronic
1075629999 10:123995031-123995053 CAGTTTCCCCAGCCTCTGAACGG - Intergenic
1076481860 10:130789894-130789916 CACTTTGCTCAACATGAGAAGGG - Intergenic
1077424049 11:2466215-2466237 CAGTTTCCCCAGCTACAAAATGG - Intronic
1077583134 11:3430299-3430321 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1077712919 11:4554068-4554090 CAGTTTTCCAGGCTTGAGAGTGG - Intergenic
1078006640 11:7537181-7537203 AAGCTGCCCCAGCTTGAGAAGGG - Intronic
1078461808 11:11520250-11520272 CAGTTTTCCCATCTTTAAAATGG - Intronic
1078471784 11:11593416-11593438 CAGTTTTCCCAGTTTCTGAAAGG + Intronic
1078595699 11:12684615-12684637 CAGTTTCCCCATCTGGAAAATGG + Intronic
1079381179 11:19938848-19938870 ACGTTTGCCCAGAATGAGAATGG - Intronic
1080323807 11:31046814-31046836 CAGTTCTGCCAGTTTGAGAATGG - Intronic
1081353931 11:42090122-42090144 AAGTTTGCTCAGCTTCATAAAGG - Intergenic
1081758604 11:45561557-45561579 CAGTTTCCTCATCTTTAGAATGG - Intergenic
1081775364 11:45672413-45672435 CAGTTTCCTTAGCTTGAAAATGG - Intergenic
1081866662 11:46363965-46363987 CAGTTTCCCCATCTCTAGAATGG + Intronic
1083056918 11:59830763-59830785 CAGTTTCCACAGCTTTAAAATGG - Intronic
1083250381 11:61463076-61463098 CACTGTGCCCAGCCTGAGACTGG + Intronic
1083813840 11:65120795-65120817 CTGTTTGGCCACCTGGAGAAGGG + Exonic
1084102204 11:66957258-66957280 CTGTTTTCTCAGCTGGAGAACGG + Intronic
1084118021 11:67053163-67053185 CAGTTTCCCCATCTGAAGAATGG + Intergenic
1084240050 11:67813102-67813124 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1084266351 11:68007324-68007346 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1084528098 11:69709984-69710006 CACTTTGCCCCTCTTTAGAATGG - Intergenic
1084550712 11:69840206-69840228 CAGTTTCCCCATCTGTAGAATGG - Intergenic
1084755495 11:71235954-71235976 CAGTTTTCTCAGCAGGAGAATGG - Intronic
1084832396 11:71779739-71779761 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1084874332 11:72119734-72119756 CACCATGCCCAGCTTGACAACGG - Intronic
1084888952 11:72227264-72227286 CTGTTTCCTCAGCTGGAGAATGG + Intronic
1085205956 11:74731899-74731921 CTGTTTTCCCAGCTTTAAAATGG + Intergenic
1085263345 11:75221463-75221485 CAGTTTCCTCAGCTGTAGAATGG - Intergenic
1086575891 11:88338525-88338547 CGGCTTGCCCAGGGTGAGAAGGG + Intergenic
1087290751 11:96317660-96317682 CAGGCTGCCCAGCTTTGGAAAGG + Intronic
1087513050 11:99122479-99122501 CAGTATACCCAGTTTCAGAATGG + Intronic
1089365269 11:117917590-117917612 CAGTTTCCCCATCTATAGAAAGG - Intronic
1089399609 11:118156781-118156803 CAGTTTCCCCATCCTGAGACCGG - Intergenic
1089706305 11:120280486-120280508 CAGTTTCCCCAGCTTTATAATGG - Intronic
1089874486 11:121706515-121706537 CACTGTGCCCAGCCTGTGAATGG + Intergenic
1090347320 11:126082086-126082108 CAGTTTCCTCATCTTTAGAATGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091256068 11:134187120-134187142 CAGTCTGCCCAGGTGGGGAATGG - Intronic
1091620423 12:2083568-2083590 CAGTTTCCCCAGCTGTAGATTGG + Intronic
1091741430 12:2962774-2962796 CAGTTTCCCCATCTTTAAAATGG - Intronic
1092410287 12:8247645-8247667 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1092998786 12:13976545-13976567 CAGTTTTCCCATCTTTAGAATGG + Intronic
1095272801 12:40239852-40239874 TAGTTTATCTAGCTTGAGAATGG - Intronic
1096595875 12:52695238-52695260 CAGTTTTCCCATCTGTAGAATGG + Intronic
1096841307 12:54380859-54380881 CATGTTGCCCAGGCTGAGAATGG - Intronic
1096848604 12:54421176-54421198 GAGTTTGCCTAGACTGAGAAAGG - Intergenic
1099449991 12:82796862-82796884 CAGTTTCCCCAGCTTTAAAATGG + Intronic
1100823262 12:98451877-98451899 CACTGTGCCCAGTCTGAGAAAGG - Intergenic
1101607134 12:106255995-106256017 AAGGTGACCCAGCTTGAGAATGG + Intronic
1102021599 12:109687209-109687231 CAGTTTCCTCACCTTTAGAATGG - Intergenic
1102169414 12:110830723-110830745 CAGTTTCCCCATCTGTAGAATGG - Intergenic
1102211988 12:111133893-111133915 CAGTGTGCCCAGCTTCACCAGGG + Intronic
1102332499 12:112046272-112046294 CATTTTTCCCTGCTGGAGAAAGG + Intronic
1102475344 12:113185188-113185210 CAGTTTCCCCAGCTGGGGATTGG - Intronic
1102550824 12:113690909-113690931 CAGTTTCCTCACCTTGAAAATGG + Intergenic
1102604076 12:114055365-114055387 TAGTTTTCCCAGCTGGAAAATGG - Intergenic
1102633664 12:114303621-114303643 CAATTTGCTCAGCTATAGAATGG + Intergenic
1102726004 12:115065655-115065677 CAGTTTTCACACCTAGAGAATGG - Intergenic
1102751367 12:115297496-115297518 CAGCTTGTCCAGCTGTAGAACGG - Intergenic
1102760288 12:115379296-115379318 CAGTTTTTCCAGCTGGAAAATGG - Intergenic
1102772831 12:115493456-115493478 CAGTTTGCCCACCTGTGGAATGG + Intergenic
1103700134 12:122844954-122844976 CAGTTTCCCCACCTTCAAAATGG + Intronic
1103915354 12:124373042-124373064 CAGTTTTCCCATCTGCAGAACGG + Intronic
1103917801 12:124384976-124384998 CAGTTTCCCCAGCTCCAAAAAGG + Intronic
1103946934 12:124532078-124532100 CAGTTTCCTCATCTGGAGAATGG + Intronic
1103950733 12:124549667-124549689 CGGTTTCCCCATCTGGAGAAGGG - Intronic
1104433985 12:128741080-128741102 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
1104780567 12:131417364-131417386 CAGTTTCCACAGCTGTAGAATGG - Intergenic
1105066338 12:133202391-133202413 CAGTTTGCTCATGTTTAGAATGG - Intergenic
1106368166 13:29104279-29104301 CAGTTTGCTCAGCTGTAAAATGG - Intronic
1107840118 13:44449164-44449186 CAGCCTGCCCAGCCTCAGAAAGG - Intronic
1109318980 13:60786417-60786439 AAGTTTGCTTAGCTTTAGAAAGG + Intergenic
1109485062 13:63007804-63007826 TAGATTCCCCAGGTTGAGAATGG + Intergenic
1110054769 13:70953587-70953609 CAGTTTGCTCAGCTTGAATTTGG - Intergenic
1110846256 13:80193547-80193569 CAGTTTGCTCATCTTTAAAATGG + Intergenic
1111016534 13:82388493-82388515 CAGTGTCCCCAGCTTCATAAGGG + Intergenic
1112656891 13:101461132-101461154 AAGTTTCCCCAGAATGAGAAAGG + Intronic
1113356810 13:109588868-109588890 CAGTTTGCCCATCTGTTGAAAGG - Intergenic
1113421415 13:110174307-110174329 CAGTTTGCCCATCTGAAGATGGG + Intronic
1113514906 13:110886780-110886802 CAGTTTACTCAGTTTGGGAAAGG + Intronic
1114598195 14:23932272-23932294 CATGTAGCCCAGATTGAGAAGGG - Intergenic
1115330927 14:32197111-32197133 CAGTTTCCTCAGCTGTAGAATGG + Intergenic
1120999431 14:90440803-90440825 CAGTTTGCCCCGCTGTAAAATGG + Intergenic
1121091606 14:91186845-91186867 CAGTTTTCCCACATGGAGAATGG - Intronic
1121991635 14:98563449-98563471 CAGTTTGCTCAGCATGACAGAGG - Intergenic
1124155677 15:27223515-27223537 CACTTGGGCCAGCTTCAGAAAGG + Intronic
1124576212 15:30910734-30910756 CTGTTTGGCCAATTTGAGAAAGG - Exonic
1125124862 15:36208365-36208387 CAAGTTGCCTAGGTTGAGAAAGG - Intergenic
1126262135 15:46705434-46705456 AAGTGTGGCAAGCTTGAGAAAGG - Intergenic
1128361196 15:66963002-66963024 CAGTTTCCCCATCTTGAAAGTGG + Intergenic
1129182052 15:73883802-73883824 CAGTTTCCCCATCTGTAGAATGG - Intronic
1129846762 15:78771411-78771433 CAGTTTCCCCATCTTTAAAATGG - Intronic
1132245410 15:100292664-100292686 CAGTTTGCACATCTGTAGAATGG - Intronic
1132281692 15:100622703-100622725 CAGTTTTCCCAGCCTGAAGAGGG - Intronic
1133490261 16:6261325-6261347 CAGTTTTTCCATCTTGAGGAAGG + Intronic
1133901361 16:9978355-9978377 CAGTTTGCTCATTTCGAGAAAGG + Intronic
1134020990 16:10921570-10921592 CAGTTTGCCCATCTGTAAAATGG - Intronic
1134634149 16:15779450-15779472 TAGTTTTCCCAGCTTTAAAATGG - Intronic
1135857838 16:26028558-26028580 CACTGTGCCCAGCCTGAGAGAGG + Intronic
1135918026 16:26623638-26623660 CAGTTTTCCCATCTGGAGAATGG - Intergenic
1135918329 16:26625813-26625835 CAGTTTTCTCACCTGGAGAATGG - Intergenic
1136042041 16:27587134-27587156 CAGTTTCCTCAGCTGCAGAATGG + Intronic
1137451440 16:48578192-48578214 CAGGTGGCCCAGCTTGGTAATGG + Intronic
1137719548 16:50620032-50620054 CAGTTTCCCCATCTGGAAAATGG + Intronic
1138436111 16:57000964-57000986 CAGTTTCCCCATCTTTACAATGG + Intronic
1139268700 16:65662699-65662721 CAGTTTCCCCACCTTAAGATGGG + Intergenic
1140408700 16:74728112-74728134 CAGTTTCCCCAGCTATAAAATGG + Intronic
1141220108 16:82061396-82061418 CAGTTTCCCCATCTTTAAAATGG - Intronic
1141463791 16:84194140-84194162 CGGTTTGCCCAACTTGAGTCAGG - Exonic
1141515687 16:84543461-84543483 CAGTTTTCCCATCTGTAGAATGG + Intronic
1141676176 16:85518592-85518614 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1141750921 16:85957354-85957376 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1142150411 16:88510159-88510181 CAGTTTACCCATATGGAGAAGGG - Intronic
1142227136 16:88883017-88883039 CAGTTTCCTCAGCTGCAGAATGG - Intronic
1142715590 17:1745373-1745395 CTGGTTGCCCAACTTGAGGAGGG - Exonic
1144824704 17:18099281-18099303 CAGTTTCCTCAGCTGTAGAATGG + Intronic
1144835698 17:18155566-18155588 CAGTTTCCCCAGCTCTAAAATGG - Intronic
1144852978 17:18253432-18253454 CAGCTTGCTCAGCTTGCAAATGG + Exonic
1145317638 17:21744417-21744439 CAGTTTTCCCATCTGCAGAATGG + Intergenic
1146125881 17:30231134-30231156 CAGTTTCCCCAGCATGAAAATGG + Intronic
1146884008 17:36458993-36459015 CAGTGTCCCCAGCTAGAAAAAGG - Intergenic
1147186698 17:38716938-38716960 GAGCTTGCCCAGCTTGAGCCTGG + Exonic
1147265869 17:39234217-39234239 CAGTTTCCCCATCTATAGAATGG + Intergenic
1148103015 17:45104182-45104204 CAGCTTTCCCAGCGTGGGAAAGG + Intronic
1149010483 17:51851401-51851423 AAGATGGCACAGCTTGAGAATGG - Intronic
1150285599 17:63952074-63952096 CAGTTTCCCCATCTGCAGAAGGG - Intronic
1150286173 17:63955493-63955515 CAGTTTTCCCATCTGGAAAACGG - Intronic
1150581498 17:66477871-66477893 AAGTCTGCCCAGTTAGAGAATGG - Intronic
1150716150 17:67574177-67574199 CAGTTGCCCCAGGTGGAGAATGG - Intronic
1153946395 18:10021816-10021838 CAGTTTGGCCAACTTTAAAATGG + Intergenic
1154402682 18:14056617-14056639 CACCTTGCCCAGCTTCTGAAGGG - Intergenic
1155156752 18:23163949-23163971 CAGTTTGCCCATCAGTAGAATGG - Intronic
1156317771 18:35986822-35986844 GAATTTGCCCAGGTGGAGAATGG + Intronic
1157331742 18:46708984-46709006 CAGTTTTCCCATCTGGAAAATGG + Intronic
1157542542 18:48521935-48521957 CAGTTTCCCCAGGGAGAGAATGG + Intergenic
1157576996 18:48750221-48750243 CAGTATGCCCACCTGCAGAATGG - Intronic
1157714446 18:49873788-49873810 GACTTTGCCAGGCTTGAGAAAGG + Intronic
1157848800 18:51029112-51029134 AAACTTGCCCAGCTTGAGAAAGG - Intronic
1158690089 18:59652654-59652676 CATTTTTCCCAGCTAAAGAAAGG + Intronic
1160744013 19:702073-702095 CAGTTTTCCCATCTAGGGAATGG + Intergenic
1160879026 19:1311196-1311218 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1161209683 19:3059899-3059921 CAGTTTGCCCAGCTTGAGAATGG + Intronic
1161251497 19:3282763-3282785 CAGTTTGCTCATCTGGAAAATGG + Intronic
1161438397 19:4277629-4277651 CAGTTTTCCCATCTGGATAATGG + Intergenic
1161519657 19:4716720-4716742 CAGTTTCCCCACCTGTAGAATGG - Intronic
1161630663 19:5353668-5353690 CAGTTTGCTCAGCTGCAAAAAGG - Intergenic
1161760440 19:6167312-6167334 CAGTTTGCCCAACTGTAAAATGG + Intronic
1162106290 19:8371684-8371706 CAGTTTTCCCATCCTGAAAAGGG + Intronic
1162205242 19:9050858-9050880 CAGTTTGCCCAGATATAGCATGG + Intergenic
1162305838 19:9873037-9873059 CAGTTTTCCCATCTGTAGAATGG - Intronic
1162389290 19:10379678-10379700 CAGTTTCCCCATCTGGAAAAGGG + Exonic
1162452142 19:10761641-10761663 CAGTTTCCCCATCTGTAGAATGG - Intronic
1162532690 19:11245030-11245052 CAGTTTCCCCATCTGGAAAATGG + Intronic
1162553839 19:11374333-11374355 CAGTTTGCCCTGCTGTAAAATGG - Intergenic
1163042807 19:14615059-14615081 CAGTTTGCCCAGGTATAAAATGG - Intergenic
1163381845 19:16974287-16974309 CAGTTTACCCATCTTAAAAAGGG - Intronic
1163455991 19:17405963-17405985 CAGTTTCCCCAGGTGGAGACCGG - Intronic
1163586063 19:18164278-18164300 CAGTTTTCCCATCTGCAGAATGG + Intronic
1163599367 19:18239446-18239468 CAGTTTGCCCATCTGGGAAATGG + Intronic
1163626310 19:18391883-18391905 CAGTTTCCCCATCTGAAGAATGG - Exonic
1163690867 19:18737500-18737522 CAGTTTTCCCATCTGGAGAGTGG + Intronic
1163727054 19:18928806-18928828 CAGTTTCCTCATCTGGAGAATGG + Intronic
1164919430 19:32077712-32077734 CAGTTTTCCCACCTGTAGAATGG - Intergenic
1165226685 19:34359838-34359860 CAGTTTCCCCATCTTTAGAACGG + Intronic
1165438248 19:35808645-35808667 CAGTTTCCCCATCTAGAAAATGG - Intronic
1165486846 19:36101561-36101583 CAGTTTCCCCATCTGGAGGAGGG - Intronic
1165695292 19:37896058-37896080 CTGTTAGCCCAGATTGACAAAGG - Intronic
1166062620 19:40336122-40336144 CACTTTGGCATGCTTGAGAATGG + Exonic
1166175755 19:41068355-41068377 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1166313744 19:41977314-41977336 CAGTTTGCCCATCTCTAAAATGG - Intronic
1166352804 19:42208145-42208167 AAGCTTGCCCAACTAGAGAAAGG + Intronic
1166552334 19:43674515-43674537 CAGTTTTCTCAGCTGGAGAAGGG + Intergenic
1166658273 19:44627855-44627877 CAGTTTGCCCATCTGCAAAATGG + Intronic
1166863829 19:45824443-45824465 CAGCTGGACCACCTTGAGAATGG + Intronic
1167052672 19:47089315-47089337 AAGACTGCCCAGCCTGAGAATGG - Intronic
1167176445 19:47867829-47867851 CACTGTGCCCAGCCTGCGAATGG + Intergenic
1167570210 19:50282218-50282240 CAGTTCGCCCATCTGGAAAATGG + Intronic
1167618559 19:50549114-50549136 CAGTTTTCCCTGCTGCAGAATGG - Intronic
1167733940 19:51279819-51279841 CAGTTTGCTCACCTAGACAATGG + Intergenic
1168347923 19:55659932-55659954 CAGTTTCTCCAGCTAGAGACTGG + Intronic
925280581 2:2681930-2681952 CAGTTTCCCCAGATTGCGAGAGG + Intergenic
925499095 2:4484402-4484424 CATTTTGCCCACCTAGATAAAGG + Intergenic
926254343 2:11177169-11177191 CACTGTGCCCAGCCTAAGAAGGG - Intronic
926352949 2:12013990-12014012 CAGTTTCCCCAGCTTTGAAAAGG + Intergenic
926594744 2:14777980-14778002 CAGTTTCTCCAGCTTTAAAAGGG - Intergenic
926684604 2:15689423-15689445 CGGTTTGCCCATCTCCAGAATGG - Intergenic
927211604 2:20642319-20642341 CAGAATGCCCAGCCTGTGAAGGG + Intronic
928360222 2:30656521-30656543 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
928422673 2:31151118-31151140 CAGTTTCCTCATCTTTAGAAAGG + Intronic
928486536 2:31738032-31738054 AAGTTTCCCAAGCTTGTGAATGG - Intergenic
929001199 2:37348604-37348626 GAGTTGGCCCAGCTTGCAAAGGG - Intronic
929050208 2:37829992-37830014 CAGTTTTCTCAGTTTGAGGAGGG - Intergenic
929476364 2:42254080-42254102 CATTTTGCCCACTTTAAGAATGG - Intronic
929938742 2:46314555-46314577 CAGTTTCCCCATCTTCACAATGG + Intronic
930013731 2:46956858-46956880 CAGTTTGCCCAGGATCAGCATGG - Exonic
930510545 2:52338687-52338709 CAGTTTGCCATGGTTGAGATGGG + Intergenic
931053945 2:58447185-58447207 CAGAATGTCCTGCTTGAGAAGGG + Intergenic
931745144 2:65285383-65285405 CAGGTCGCACAGCTAGAGAATGG - Intergenic
934558708 2:95301091-95301113 CAGAGTGCCCATCTTGAGAGAGG - Intronic
934753276 2:96808174-96808196 CACTGTGCCCAGCCTAAGAATGG + Intronic
935054767 2:99555994-99556016 CAGTAGCACCAGCTTGAGAAAGG - Intronic
935763245 2:106341051-106341073 CAGTTTTCCCAGCTTAAAAATGG - Intergenic
936287316 2:111190794-111190816 CAGTTTCCCCATCTTTAAAATGG + Intergenic
936418413 2:112341192-112341214 CTGTTTGCCCATCTTTAAAATGG - Intergenic
937228407 2:120382991-120383013 CAGTTTTCCCATCTGTAGAAAGG + Intergenic
937254728 2:120547127-120547149 CAGTTTTCCCAGCTGCAGAGTGG - Intergenic
938409122 2:131049259-131049281 CTGTATGCCCAGCTGGGGAAGGG + Exonic
939360458 2:141164968-141164990 CAGTTTGGCAAGCTAGAGAGAGG - Intronic
942553010 2:177140004-177140026 CAGTTTACCCAGGTACAGAAAGG - Intergenic
943159384 2:184227786-184227808 CAGTTTCCTCATCTTGACAATGG + Intergenic
944268915 2:197759734-197759756 CAGTTTGACCAGCTAAAGAGTGG - Intronic
946282666 2:218677476-218677498 AAGTTTGCCAAACCTGAGAATGG + Intronic
947849834 2:233276952-233276974 CAGTTTGCTCAGCTCCAGAAAGG - Intronic
948034611 2:234847870-234847892 CAGTTTTCCCAGCTGTACAATGG - Intergenic
948289464 2:236814314-236814336 AAGTTTGCCCATCTTGCCAAGGG - Intergenic
948314833 2:237019747-237019769 CAGTTTGCACATCTTTAAAATGG - Intergenic
948942298 2:241202630-241202652 CAGTTTACCCAGCTTCTGGAGGG - Intronic
1168812094 20:710716-710738 CAGTTGACCCAGCCTCAGAAAGG + Intergenic
1168984769 20:2038719-2038741 CAGTTTCCCCATCTGGAAAATGG + Intergenic
1169036152 20:2453975-2453997 CAGTTTCCTCAGCTATAGAATGG - Intergenic
1170247860 20:14244147-14244169 CAGTTTCCCCAGCTACAAAATGG - Intronic
1170324238 20:15138278-15138300 CTGTTTGCTGAGGTTGAGAAAGG + Intronic
1170518101 20:17153028-17153050 CAGTGGGCCTAGCTAGAGAATGG - Intergenic
1171070414 20:22062766-22062788 CAGCTTGCCCAGCTGGGGCAAGG - Intergenic
1171310732 20:24142925-24142947 CAGTTTTCACAGCTTTAAAATGG + Intergenic
1172174889 20:32966299-32966321 CAGTTTGCCCTGCTGTAAAATGG - Intergenic
1172181203 20:33004574-33004596 CAATTTCCCCATCTTAAGAAAGG - Intergenic
1172229114 20:33325067-33325089 CAGTTTGCTCACCTGTAGAAGGG - Intergenic
1172407226 20:34698829-34698851 CAGTTTCCCCATCTGCAGAATGG - Intronic
1172794441 20:37527419-37527441 CAGGGTGCCCAGCTTGTGAGAGG - Intronic
1172971242 20:38874427-38874449 CAGTTTCCCCATCTGTAGAATGG - Intronic
1173762898 20:45579393-45579415 CAGCCTGCCCATGTTGAGAAAGG - Intergenic
1173858835 20:46268808-46268830 CAGTTTGCCCATCTATATAATGG - Intronic
1174161111 20:48551104-48551126 CAATTTGCTCAGCTTGAAAGTGG - Intergenic
1174161983 20:48557683-48557705 CAGTTTCCTCATCTTAAGAATGG - Intergenic
1174522224 20:51140678-51140700 CAGTTTTCCCATCTTTAAAATGG - Intergenic
1175129471 20:56778752-56778774 CAGTTTGCCCATCTGCAGAAGGG - Intergenic
1176029176 20:63002812-63002834 CTATTTGCCCAGCTCTAGAATGG + Intergenic
1176076422 20:63250395-63250417 CAGTTTCCTCATCTGGAGAATGG + Intronic
1176964572 21:15197431-15197453 CAGTTTTCCCAGCTGTAAAATGG + Intergenic
1178066495 21:28909717-28909739 CAGTTTCCCCATCTTCAAAATGG - Intergenic
1178386975 21:32160423-32160445 TAGTTTGCCAAGATTGAGGATGG + Intergenic
1178702875 21:34848346-34848368 CAGTTTTCCCATCTGTAGAATGG - Intronic
1179614756 21:42575233-42575255 CAGTTTCCACAGCTTTAAAATGG + Intronic
1181539816 22:23567075-23567097 CAGTTTCCCCATCTTCCGAAAGG + Intergenic
1181994398 22:26863975-26863997 CAGTTTTCCCAGCTATATAAGGG - Intergenic
1182079832 22:27521139-27521161 CAGTTTTCCCAGCTGCAGAATGG - Intergenic
1182096567 22:27630102-27630124 CAGTTTGCCCATCTGTAAAATGG + Intergenic
1182314263 22:29433456-29433478 CAGTTTTCCCAGCAGGAGATGGG - Intergenic
1182352379 22:29706061-29706083 CAGTTTGCTCAGCTAGAAAACGG + Intergenic
1182352968 22:29709212-29709234 CAGTTTCCCCACCTGTAGAATGG - Intergenic
1182453601 22:30435556-30435578 CAGTTTCCCCATCTATAGAATGG - Intergenic
1182572682 22:31250525-31250547 CCGTTTGCCCAGCTAGAGTCTGG + Intronic
1182787485 22:32919857-32919879 CAGTTTGCCCATCTGTAAAATGG + Intronic
1182911750 22:33990195-33990217 CAGTGTGCCTAGCTTGGAAAGGG + Intergenic
1183352795 22:37343361-37343383 CAGTTTCCCCACCTAGAGATGGG + Intergenic
1183541160 22:38430194-38430216 CAGTTTCCTCATCTTGAAAATGG + Intronic
1183735322 22:39641859-39641881 CAGTTTTCCCATCTTTAAAATGG + Intronic
1184093021 22:42302196-42302218 CAGTTTCCCCATCTGGAGAAGGG - Intronic
1184566212 22:45293636-45293658 CAGTTTCCCCATCTGGAAAATGG + Intronic
1184846643 22:47091759-47091781 CAGTTTCCTCAGCTGGAAAAAGG - Intronic
1185304394 22:50105387-50105409 CAGCTTGTCCAGTTTAAGAAAGG + Intronic
949539287 3:5019855-5019877 CAGTTTTCCCATCTCTAGAATGG + Intergenic
950306984 3:11923270-11923292 CAGTTTCCCCAACCTGATAATGG - Intergenic
950667865 3:14508169-14508191 CAGTTTTCCCACCTGGAGAATGG + Intronic
950672745 3:14536995-14537017 CAGTTTTCCCAGCTGTAAAATGG - Intronic
952212515 3:31242495-31242517 CTGTTTGACCATATTGAGAAGGG - Intergenic
953260776 3:41337055-41337077 CAGTTTCCCCATCTAGAAAATGG - Intronic
954877091 3:53809256-53809278 CAGTTTGCCCACGTTGAGGGCGG + Intronic
955321000 3:57974247-57974269 CAGTTTGCCCAGCTGTAAAATGG - Intergenic
955530706 3:59870040-59870062 CAGTTTCCCCAGCTATACAATGG - Intronic
955703373 3:61704232-61704254 CAGTTTGTCCAGCTGTAAAAAGG + Intronic
957055525 3:75439774-75439796 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
958820389 3:98967000-98967022 GAGTTTGCCCAGTTTGCCAATGG + Intergenic
960739309 3:120815459-120815481 CAGTTTCCCCACCTTTAAAATGG - Intergenic
960908495 3:122625109-122625131 CAGTTTGCTCAGCTAGAAATTGG - Intronic
961298864 3:125908832-125908854 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
961655307 3:128438541-128438563 CAGTTTCCCCACCTGAAGAATGG - Intergenic
961889198 3:130116159-130116181 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
963251340 3:143105870-143105892 CAGTTTGCACAGGGAGAGAAAGG - Intergenic
965085278 3:164088453-164088475 CAGGTTTCCAAGCTTGAGAGTGG - Intergenic
965116398 3:164495294-164495316 CAGTTTCCTCAGCTGGAAAATGG + Intergenic
965623002 3:170659257-170659279 CACTGTGCCCAGCCTGAGCAAGG + Intronic
965907450 3:173726385-173726407 CAGTTTTCCCATCTTTAAAATGG + Intronic
966721326 3:183064950-183064972 CAGTTTGCACAGAGAGAGAAAGG - Intronic
967916139 3:194579678-194579700 CAGTTGGCCCATCATGAGATGGG - Intergenic
968430526 4:555811-555833 CAGGTTGCCCAGGCTGAGACTGG + Intergenic
968998338 4:3960082-3960104 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
969134708 4:5020516-5020538 CAGTTTTCCCACCTGGAAAATGG - Intergenic
969311673 4:6356571-6356593 CGGTTTCCCCAACTTCAGAAGGG + Intronic
969755661 4:9148570-9148592 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
969845285 4:9915574-9915596 CAGTTTCCCCAGCTGTAGAGTGG - Intronic
970516515 4:16836432-16836454 AAATTTGCCCAGCTGGAAAATGG - Intronic
973262903 4:48182582-48182604 CACTTTGCAAAGCTTGAAAATGG + Intronic
974140294 4:57878157-57878179 CAGTTTTCCCAGCTGTAAAATGG + Intergenic
974341481 4:60619089-60619111 CAGTATGTACAGCATGAGAAAGG + Intergenic
976328334 4:83798568-83798590 CAGTTTGCTCAGCTGTAAAATGG - Intergenic
977243600 4:94603485-94603507 CAGTTTTCCCAGTTTGCGGAGGG - Intronic
978262466 4:106776801-106776823 AACTATGCTCAGCTTGAGAAAGG - Intergenic
978373247 4:108050375-108050397 GTGTTAGCCCTGCTTGAGAATGG + Intronic
978373333 4:108050882-108050904 GTGTTAGCCCTGCTTGAGAATGG - Intronic
978704130 4:111684810-111684832 TAATTTGCCCAGCTTGGGACAGG - Intergenic
979322963 4:119345695-119345717 CAGTTTCCCCATCTGGAAAATGG + Intergenic
979607826 4:122657740-122657762 CAGTTTCCTCATCTGGAGAATGG + Intergenic
983240799 4:165230344-165230366 CAGTTTCCCCATCTGGAAAATGG + Intronic
983905820 4:173181725-173181747 CTGTTTGCTTAGCCTGAGAAAGG + Intronic
984779910 4:183515697-183515719 CAGTTTGTTCAGCTGGAAAATGG + Intergenic
985869644 5:2544160-2544182 AAGTTTGCACACTTTGAGAACGG + Intergenic
986425602 5:7628198-7628220 CAGTCTGTACTGCTTGAGAAAGG - Intronic
986742637 5:10717436-10717458 CAGTGTGCCCAGCTTCATCAGGG - Intronic
987007050 5:13721413-13721435 CAGTTTTCCCACCTATAGAATGG - Intronic
988551723 5:32206243-32206265 CAGTTTCTCCATCTGGAGAATGG - Intergenic
988776111 5:34479354-34479376 CTGGTTGCCCAGCTAGAGCAAGG + Intergenic
989660248 5:43790537-43790559 CAATTTGCCCACCCTGAGCAGGG - Intergenic
989762296 5:45031016-45031038 CAGTTTGCCGGGCTTGGGAAAGG + Intergenic
991345212 5:65658480-65658502 CAGTCAGCCAAGCTGGAGAATGG + Exonic
992011958 5:72537316-72537338 CAGTTTGCTCAGCTCTAAAACGG - Intergenic
992353155 5:75951975-75951997 AAGATTTCCCTGCTTGAGAAGGG - Intergenic
992697365 5:79303349-79303371 CACTGTGCCCAGCCTGAGGAGGG + Intronic
992953480 5:81883873-81883895 CAGTTTGCCCTGCTCTAGATCGG + Intergenic
993980700 5:94540124-94540146 CAGTTTGCCCAGAGAGAAAAAGG - Intronic
995682806 5:114739410-114739432 CTTTTTGTCCAGCTTGAGAAGGG - Intergenic
997203495 5:132027012-132027034 CAGAGTGCCCACCTTGGGAAGGG - Intergenic
997397809 5:133578371-133578393 CAGTTTGCCCATCTGTAAAACGG + Intronic
997486633 5:134236459-134236481 CTGTCTGCTTAGCTTGAGAAAGG + Intergenic
997492417 5:134288786-134288808 CAGTTTTCCCAGCTGGATAATGG - Intronic
997801142 5:136863764-136863786 CAGTTTCCCCATCTTGATAATGG - Intergenic
998051097 5:139035987-139036009 CAGTTTGCCCAGTTTGTAATGGG + Intronic
998459164 5:142296657-142296679 CAGTTTCCCCATCTGGAAAATGG - Intergenic
998586698 5:143434490-143434512 CACTTTACCCAGCTATAGAATGG + Intronic
999061687 5:148642334-148642356 CAGTTTTCCCAACTGCAGAATGG + Intronic
999762609 5:154714069-154714091 CAGTTTTCCCAGCTGCAAAATGG + Intronic
1000278148 5:159757730-159757752 CAGTTTTCCTAGAGTGAGAAGGG - Intergenic
1000700363 5:164442216-164442238 CAGTTTCCCCATCTTGTCAATGG - Intergenic
1001061418 5:168492965-168492987 CAGTTTGAAAAACTTGAGAAAGG + Intronic
1001301391 5:170536345-170536367 CAGTTTTCCCAGCAGTAGAATGG + Intronic
1001687582 5:173605850-173605872 CAGTTTTCCCAACTAGAGAGAGG + Intergenic
1002334229 5:178466946-178466968 CAGTTTCCCCAGCTGTAAAATGG + Intronic
1002397536 5:178969769-178969791 CACTCTGCCCAGTTTGAGAAGGG + Intergenic
1002869175 6:1150432-1150454 CAATTTGCTCAGCCTCAGAAAGG - Intergenic
1003852850 6:10242562-10242584 CAGTTTGCCCAGCTTTGGGCAGG - Intergenic
1004638330 6:17489766-17489788 CAGTTTTCCCAGCTCCAGACTGG - Intronic
1004824660 6:19405899-19405921 CAGTGTCCCCAGCTTCAGCAGGG + Intergenic
1005637919 6:27768773-27768795 CAGCGGGCACAGCTTGAGAAAGG - Intergenic
1006779231 6:36620854-36620876 CAGTTTGCCTATCTGTAGAAAGG + Intergenic
1006833327 6:36982204-36982226 CAGTTTGCTAAGCCTGGGAATGG - Intronic
1007902562 6:45423945-45423967 TAGTTCGCCCAACTTGAAAACGG + Intronic
1008344171 6:50405711-50405733 CACTTTGCTCAGCTTCAGAAAGG + Intergenic
1008693477 6:54006989-54007011 CAGTTTGCCCACCATGAGTCAGG - Intronic
1009815362 6:68726335-68726357 CTGTGTGCACATCTTGAGAAAGG - Intronic
1012415399 6:99007402-99007424 GAGTTTGCCCAGCAGTAGAATGG - Intergenic
1013086340 6:106861148-106861170 CAGGTTGACCAGCTGCAGAAAGG - Intergenic
1013369710 6:109458305-109458327 CACTGTGCCCAGCCTTAGAATGG - Intergenic
1013718726 6:112996209-112996231 CAGTTTACCCAGCTTGTAAGAGG - Intergenic
1014032964 6:116728734-116728756 CAGTTTCCCCATCTTAAAAATGG - Intronic
1014880025 6:126712156-126712178 CAGTTTTCCCAACTTGACATTGG - Intergenic
1016219852 6:141654937-141654959 CAGTGTGCCCAGCTTCATCAGGG - Intergenic
1017240674 6:152164573-152164595 CAGTTTTCCCAGTGTGAGCAAGG + Intronic
1017512980 6:155130453-155130475 CAGTTTCCCCACCTGGAGAAGGG + Intronic
1018481046 6:164190653-164190675 CAGTATCCCCAGCTTCAGACAGG - Intergenic
1019415132 7:923603-923625 CAGTTTGCCCAGCTATAAGAGGG - Intronic
1019510369 7:1414625-1414647 CAGTTTCCCCAGCTTTGCAACGG - Intergenic
1021945337 7:25720615-25720637 CAGTTTTCCCATCTTTAAAATGG - Intergenic
1021963335 7:25894150-25894172 CAGTTTGCTCAGCTGGTAAATGG - Intergenic
1022059557 7:26778290-26778312 CAGTTTCCTCAGCTGCAGAAGGG + Intronic
1022412628 7:30150890-30150912 CAGTGTCCCCAGCTTTAAAATGG + Intronic
1023102610 7:36734414-36734436 TACTTTGCCCAGATTGTGAATGG + Intergenic
1023349832 7:39309290-39309312 CAGTCTACCCAGCGTGACAATGG - Intronic
1023821022 7:43980552-43980574 CAATTTTGCCAGCTGGAGAAGGG - Intergenic
1024481209 7:49865357-49865379 CAGTTTTCCCAGCTGAAAAATGG + Intronic
1025236491 7:57238116-57238138 CAATTTGCTCAGCTTGAAAGTGG - Intergenic
1025993630 7:66514205-66514227 CAGTTGGCCCAGATGCAGAATGG + Intergenic
1026034792 7:66823231-66823253 CAGTTTGCCCAGATGCAGAATGG - Intergenic
1026152797 7:67802531-67802553 CAGTTTACCCACCTTTAAAATGG - Intergenic
1026584649 7:71646520-71646542 CTCTTTGCCAAGCCTGAGAATGG + Intronic
1026984783 7:74547893-74547915 CAGTTTCCCCAGATGCAGAATGG + Intronic
1027328276 7:77065022-77065044 CAATTTTGCCAGCTGGAGAAGGG + Intergenic
1029597101 7:101543749-101543771 CAGTTTCCCCACATTGAAAATGG + Intronic
1029749295 7:102533991-102534013 CAATTTTGCCAGCTGGAGAAGGG - Intergenic
1029767238 7:102633095-102633117 CAATTTTGCCAGCTGGAGAAGGG - Intronic
1031899715 7:127395247-127395269 CAGTTTTCCCACCTGCAGAATGG - Intronic
1032153472 7:129449610-129449632 CAGTGTGCCCAGCTTCACCAGGG + Intronic
1032848029 7:135768458-135768480 CAGTTTGCCCACTTTGAAGAAGG - Intergenic
1033671597 7:143498663-143498685 CAGTTTCCCCAGCCTGATACGGG + Intergenic
1033671742 7:143499787-143499809 CGGTTTCCCCAGCTTGATATGGG - Intergenic
1034139268 7:148801368-148801390 CAGTTTCCCCACCTGCAGAAAGG - Intergenic
1035945443 8:3956307-3956329 CAGTTTCCCCATCTTGAGATGGG - Intronic
1036378908 8:8223876-8223898 CAGTTTCCCCAGCTGTAAAATGG + Intergenic
1036387870 8:8297452-8297474 CTGTTTGGCGATCTTGAGAAAGG + Intergenic
1036607403 8:10319811-10319833 CATTGTGCCCAGTTTGAGACTGG + Intronic
1036611033 8:10350074-10350096 CAAATGGCCCAGCTGGAGAATGG - Intronic
1036850658 8:12198724-12198746 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1036872023 8:12440989-12441011 CAGTTTCCCCAGCTGTAAAATGG - Intergenic
1037432767 8:18831095-18831117 CAGTTTGCCCATCTATAAAATGG + Intronic
1037434732 8:18850727-18850749 CAGTTTGCCCATCTGCAGAGGGG - Intronic
1037484675 8:19336143-19336165 CAGTTTCCCCAGCTGTAAAATGG - Intronic
1037768528 8:21786034-21786056 CACTCAGCCCAGCTTTAGAAGGG + Intronic
1037917382 8:22780958-22780980 CAGTTTCCTCAGCTGGAGATGGG - Intronic
1039380918 8:37084481-37084503 CAGTTTGCCCATCTGTAAAAGGG - Intergenic
1041987813 8:63946997-63947019 CACTGTGCCCAGCTTGTGAAAGG + Intergenic
1043257663 8:78156714-78156736 CAGTGTCCCCAGCTTCAGCAGGG - Intergenic
1043852054 8:85226814-85226836 CACTGTGCCCGGCCTGAGAAGGG - Intronic
1046023801 8:108698426-108698448 CAGTTTCCTCAGCTGTAGAATGG + Intronic
1047313361 8:123710765-123710787 CAGTTTCCTCAGCTGGAAAATGG + Intronic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1048216987 8:132505380-132505402 CAGTTTGCCCATCTGTAAAATGG - Intergenic
1049127142 8:140801533-140801555 CAGTTTCCTCAGCTACAGAATGG + Intronic
1049348797 8:142153103-142153125 AAGGTTGCCCAGGTAGAGAAAGG - Intergenic
1049933932 9:482507-482529 CAGTTTACCCATCTCGAGAGAGG - Intronic
1050087681 9:1983379-1983401 CAGGTTACCCAGCTTGCAAATGG + Intergenic
1051325708 9:15965463-15965485 CAGGTTGCACAGCTTGCTAATGG - Intronic
1051602720 9:18890831-18890853 CATTTTGCACAGCTTGGCAAGGG - Intronic
1052363040 9:27580444-27580466 CAGTTTCCCCAGCTACAAAATGG + Intergenic
1053320567 9:37094863-37094885 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1054716540 9:68562539-68562561 CAGTTTCCCCAGGATAAGAATGG + Intergenic
1054969477 9:71068657-71068679 CAGGTTGCCCAACTTCAGCATGG - Intronic
1057068579 9:92076737-92076759 CAATTTGCCAATCTTGAGCAGGG - Intronic
1057691688 9:97291696-97291718 CAATTTTCCCAGCTGGAAAATGG - Intergenic
1058678175 9:107419224-107419246 CAGTTTCCCCAGGCTGAGCACGG + Intergenic
1058730531 9:107845790-107845812 CAGTTTCCCCATCTTTAAAATGG + Intergenic
1059381412 9:113929692-113929714 CAGTTTTCCCAGCTTTATAGTGG + Intronic
1059800833 9:117748002-117748024 CAGTGTGCGCAGTTTTAGAAGGG - Intergenic
1059928927 9:119241593-119241615 CAGTTTTCCCATCTTTAAAATGG + Intronic
1060181119 9:121534452-121534474 CACTGTGCCCAGCCTGAGATTGG + Intergenic
1060209948 9:121703537-121703559 CAGTTTGCTCATCTGCAGAATGG + Intronic
1060862862 9:126969815-126969837 CAGTCTTCCCAGCCTCAGAAAGG - Intronic
1061266094 9:129505812-129505834 CAGTTTGCTCAGCTGTAAAATGG + Intergenic
1061276002 9:129569613-129569635 CAGTTTCCCCATCTTCTGAAAGG + Intergenic
1061384303 9:130279298-130279320 CAGTTTCCACATCTTTAGAAAGG + Intergenic
1061623072 9:131824263-131824285 CAGCTTGCCCAGCCCCAGAATGG - Intergenic
1061630053 9:131866648-131866670 CAGTTTTCCCATCTGGAAAATGG + Intronic
1061677762 9:132228018-132228040 CAGTCTGCTCATCTGGAGAAGGG - Intronic
1061932757 9:133841758-133841780 CAGTTTCCCCAACTGCAGAATGG + Intronic
1062122324 9:134840433-134840455 CAGTTTCCTCAGCTGGAAAATGG - Intronic
1062219743 9:135408833-135408855 CAGTTTCCTCAGATGGAGAATGG - Intergenic
1186634939 X:11392662-11392684 CAGTTTTCCTACCTTGAGAATGG - Intronic
1187208334 X:17204230-17204252 AAGGTTGCCCAGCTGGTGAATGG + Intergenic
1187529925 X:20086975-20086997 CAGTTTCCCCACCTGGAAAATGG - Intronic
1188893470 X:35637982-35638004 CAGATTGCTCAGCTTTAAAATGG - Intergenic
1191011159 X:55760934-55760956 CAGTTTCCCCATCTTCAAAATGG - Intergenic
1191941577 X:66486534-66486556 CAGTTTCCCCAGCTTCATCAGGG + Intergenic
1192119696 X:68443640-68443662 CAGTTTTCTCATCTGGAGAATGG - Intergenic
1192210227 X:69123233-69123255 CAGTTTCCCCATCTTTAAAACGG - Intergenic
1192233799 X:69283791-69283813 CAGTTTCCTCATCTGGAGAATGG + Intergenic
1192298070 X:69870663-69870685 CAGTGTGCCCAGCTTCATCAGGG + Intronic
1192576034 X:72243918-72243940 AAGTTTACACAGCTTGTGAATGG + Intronic
1192972694 X:76250747-76250769 CATCTTGCCCAGGTTGAGGAGGG - Intergenic
1195122085 X:101764935-101764957 CAGTTTTCTCATCTAGAGAATGG - Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195374750 X:104215840-104215862 CACCATGCCCAGCCTGAGAAAGG + Intergenic
1195375179 X:104219598-104219620 AAATTTGCCCATCTTGAAAAGGG + Intergenic
1195668646 X:107451366-107451388 GAGTTTTCCCAGCTGGAGACCGG + Intergenic
1196405375 X:115356606-115356628 CAGTTTCAACAGCTTCAGAAAGG - Intergenic
1197666467 X:129229445-129229467 CAGTTTTCTCAGCTTTAAAATGG + Intergenic
1197723172 X:129758802-129758824 CAGTTTCCCCAGCTGTAAAAAGG + Intronic
1197891940 X:131277525-131277547 CAGTTTGCCCATTTGGACAAGGG + Intronic
1199502532 X:148523820-148523842 CAGTTCCTCCAGATTGAGAAAGG + Intronic
1199573938 X:149294804-149294826 CAGTTTCCCCAGCTATAAAATGG - Intergenic
1200167594 X:154048016-154048038 CAGTGTGCCCAGCCTCAGATGGG - Intronic
1201695793 Y:16824142-16824164 CCCTTTGCCCAGCTAGTGAAGGG + Intergenic