ID: 1161210347

View in Genome Browser
Species Human (GRCh38)
Location 19:3062390-3062412
Sequence GGCCCCGCTTCCTGCGCGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 184}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161210335_1161210347 5 Left 1161210335 19:3062362-3062384 CCCGCGCGCCCGGCCCCGGCGCG 0: 1
1: 2
2: 8
3: 103
4: 851
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210326_1161210347 24 Left 1161210326 19:3062343-3062365 CCGCTTCCTGCGCCCCCTCCCCG 0: 1
1: 0
2: 9
3: 119
4: 1203
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210329_1161210347 12 Left 1161210329 19:3062355-3062377 CCCCCTCCCCGCGCGCCCGGCCC 0: 1
1: 3
2: 36
3: 205
4: 1480
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210331_1161210347 10 Left 1161210331 19:3062357-3062379 CCCTCCCCGCGCGCCCGGCCCCG 0: 1
1: 2
2: 39
3: 145
4: 1150
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210327_1161210347 18 Left 1161210327 19:3062349-3062371 CCTGCGCCCCCTCCCCGCGCGCC 0: 1
1: 2
2: 33
3: 225
4: 1382
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210324_1161210347 30 Left 1161210324 19:3062337-3062359 CCTCGCCCGCTTCCTGCGCCCCC 0: 1
1: 1
2: 2
3: 65
4: 622
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210339_1161210347 -3 Left 1161210339 19:3062370-3062392 CCCGGCCCCGGCGCGCCCCGGGC 0: 1
1: 1
2: 14
3: 145
4: 959
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210336_1161210347 4 Left 1161210336 19:3062363-3062385 CCGCGCGCCCGGCCCCGGCGCGC 0: 1
1: 1
2: 16
3: 180
4: 1000
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210330_1161210347 11 Left 1161210330 19:3062356-3062378 CCCCTCCCCGCGCGCCCGGCCCC 0: 1
1: 6
2: 36
3: 228
4: 1659
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210334_1161210347 6 Left 1161210334 19:3062361-3062383 CCCCGCGCGCCCGGCCCCGGCGC 0: 1
1: 1
2: 22
3: 143
4: 872
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210342_1161210347 -9 Left 1161210342 19:3062376-3062398 CCCGGCGCGCCCCGGGCCCCGCT 0: 1
1: 1
2: 7
3: 74
4: 603
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210343_1161210347 -10 Left 1161210343 19:3062377-3062399 CCGGCGCGCCCCGGGCCCCGCTT 0: 1
1: 0
2: 1
3: 50
4: 355
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210332_1161210347 9 Left 1161210332 19:3062358-3062380 CCTCCCCGCGCGCCCGGCCCCGG 0: 1
1: 2
2: 24
3: 217
4: 1290
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210340_1161210347 -4 Left 1161210340 19:3062371-3062393 CCGGCCCCGGCGCGCCCCGGGCC 0: 1
1: 2
2: 12
3: 239
4: 1405
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210325_1161210347 25 Left 1161210325 19:3062342-3062364 CCCGCTTCCTGCGCCCCCTCCCC 0: 1
1: 1
2: 13
3: 170
4: 1336
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184
1161210341_1161210347 -8 Left 1161210341 19:3062375-3062397 CCCCGGCGCGCCCCGGGCCCCGC 0: 1
1: 1
2: 15
3: 154
4: 976
Right 1161210347 19:3062390-3062412 GGCCCCGCTTCCTGCGCGCCCGG 0: 1
1: 1
2: 0
3: 28
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161210347 Original CRISPR GGCCCCGCTTCCTGCGCGCC CGG Intronic