ID: 1161212605

View in Genome Browser
Species Human (GRCh38)
Location 19:3075403-3075425
Sequence ACAGCCTCCTAGACCCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161212602_1161212605 5 Left 1161212602 19:3075375-3075397 CCCACTGAGGGTGTGGATTTCAA No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data
1161212596_1161212605 17 Left 1161212596 19:3075363-3075385 CCTCTCTCCCTCCCCACTGAGGG No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data
1161212594_1161212605 20 Left 1161212594 19:3075360-3075382 CCTCCTCTCTCCCTCCCCACTGA No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data
1161212603_1161212605 4 Left 1161212603 19:3075376-3075398 CCACTGAGGGTGTGGATTTCAAT No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data
1161212600_1161212605 9 Left 1161212600 19:3075371-3075393 CCTCCCCACTGAGGGTGTGGATT No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data
1161212599_1161212605 10 Left 1161212599 19:3075370-3075392 CCCTCCCCACTGAGGGTGTGGAT No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data
1161212601_1161212605 6 Left 1161212601 19:3075374-3075396 CCCCACTGAGGGTGTGGATTTCA No data
Right 1161212605 19:3075403-3075425 ACAGCCTCCTAGACCCAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161212605 Original CRISPR ACAGCCTCCTAGACCCAGTA GGG Intergenic
No off target data available for this crispr