ID: 1161215753

View in Genome Browser
Species Human (GRCh38)
Location 19:3094453-3094475
Sequence GCGGCTGGCGCGGCCCGAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 300}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161215749_1161215753 -9 Left 1161215749 19:3094439-3094461 CCGCGCGGGAGTCCGCGGCTGGC 0: 1
1: 0
2: 0
3: 8
4: 171
Right 1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG 0: 1
1: 1
2: 1
3: 29
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161215753 Original CRISPR GCGGCTGGCGCGGCCCGAGC GGG Exonic
900663217 1:3796383-3796405 GCTGCTGACGGGGCCCGGGCTGG - Exonic
902398532 1:16145160-16145182 GCAGCTGGCGGGGCCCCTGCTGG - Intronic
903190148 1:21651840-21651862 CCGGCTCGCGCGGGCCGGGCCGG - Intronic
903738203 1:25543674-25543696 GCGGCGGCGGCGGCCGGAGCGGG + Exonic
905789922 1:40784281-40784303 GCCGCAGGCGGAGCCCGAGCCGG - Exonic
905862568 1:41361282-41361304 GCGGCGGGGTCGCCCCGAGCTGG + Intergenic
906517505 1:46448313-46448335 GCGGCAGGCGGGGCGGGAGCGGG - Intergenic
906627044 1:47333887-47333909 GCGGCCGGCGCGGCGCGGGGCGG - Exonic
907051131 1:51330489-51330511 GCGGGCGGCGCTGCCCCAGCCGG + Intronic
908401233 1:63774432-63774454 GCGGCGGGCGCGTCCCGCGGCGG - Exonic
910876773 1:91885750-91885772 GCGGCTGGAGCGACCCTGGCCGG + Intronic
913519460 1:119631607-119631629 GGGGCTGGCGGGGCCCAGGCGGG - Intronic
917141811 1:171842137-171842159 GGGGCTGGCGCGCACCGAGGGGG - Intronic
919092836 1:192994709-192994731 GGGGCTGGAGCAGCCGGAGCAGG + Intergenic
920500011 1:206480051-206480073 GCGGCTGGCACGGGCCCTGCTGG + Exonic
922729412 1:227942074-227942096 GCTGCTGGGGTGGCCCGGGCTGG - Intronic
923141341 1:231163183-231163205 GCGGCTGGCCCGGCCTGCGGCGG + Exonic
1063593140 10:7410957-7410979 GCGGCGGGCGGGGAGCGAGCGGG - Intronic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1066141847 10:32511812-32511834 GCTGGTGGCGCGGGCAGAGCTGG - Intronic
1067066044 10:43104894-43104916 GCGGCTGGCCCGGTCCCGGCTGG + Intronic
1067274060 10:44819053-44819075 GCTGCTGGCGAGGCTCCAGCTGG - Intergenic
1071347593 10:84707395-84707417 GGGACTGGCGGGGCCAGAGCTGG + Intergenic
1075885468 10:125896150-125896172 GGGGCGGGCGCGCCCCGAGCCGG - Intronic
1076156114 10:128206997-128207019 GCTGCTGGCCAGGCCTGAGCAGG + Intergenic
1076216122 10:128694752-128694774 GCGTCTGCCCCGGCCCCAGCCGG + Intergenic
1076374312 10:129973084-129973106 GCGGCGGGCTAGGGCCGAGCGGG + Intergenic
1076880675 10:133237839-133237861 CCGCCTGGCGAGGCCCGAGGTGG + Exonic
1076948182 10:133665614-133665636 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076949171 10:133668924-133668946 GCGGCTGCAGGGGCCCGGGCGGG - Intronic
1076950155 10:133672223-133672245 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076951140 10:133675522-133675544 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076952130 10:133678832-133678854 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076953118 10:133682142-133682164 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076954102 10:133685441-133685463 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076955086 10:133741793-133741815 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076956076 10:133745103-133745125 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076957065 10:133748413-133748435 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076958053 10:133751722-133751744 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076959037 10:133755021-133755043 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076960026 10:133758331-133758353 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1076961010 10:133761630-133761652 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
1077051466 11:568718-568740 GCGGATGGTACGGCCCGAGGTGG + Intergenic
1077078319 11:711137-711159 GCGGCTGGTCCGGCGCGTGCAGG - Intronic
1077406321 11:2384000-2384022 GCAGCAGGCGCTGCCCGGGCAGG - Intronic
1077554758 11:3220617-3220639 GTCGCTGGAGCGGGCCGAGCAGG - Intergenic
1078986703 11:16605172-16605194 GCGGGTGGCGGGGCCCCGGCAGG + Intronic
1080503687 11:32892906-32892928 GCGGGCGGCGAGGCCCCAGCTGG - Intergenic
1080517797 11:33039814-33039836 GAGGCTGGCGGGGCCCGTCCGGG + Intronic
1083636873 11:64125555-64125577 GCTGCTGGCGGGGCAGGAGCAGG - Intronic
1083681324 11:64353126-64353148 CCGGCTGGCGCGGCTGGAGCTGG + Exonic
1084146140 11:67266395-67266417 GCGGCAGGCGGGGCCGGAGGCGG + Exonic
1084183552 11:67458442-67458464 GCCGCTGGCGGGTCCTGAGCTGG + Exonic
1084264447 11:67997659-67997681 GCTGCTGGTGCGGCCCGGGATGG - Exonic
1085266705 11:75241718-75241740 GCAGCAGGCGCGGCCCGGGGAGG - Exonic
1085525325 11:77160462-77160484 GGGCCTGGGGCGGCCAGAGCTGG - Intronic
1089543452 11:119205339-119205361 GCTGCTGGCTCCGCCCGAGGGGG - Intergenic
1091219680 11:133922677-133922699 TGGGCTGGCGCGGCCTGTGCTGG - Exonic
1091558604 12:1594215-1594237 GCGGCGGCGGCGGCCGGAGCCGG - Intronic
1092860629 12:12716901-12716923 GCCGCTGGGGAGGGCCGAGCTGG + Intronic
1095476279 12:42589911-42589933 CCCCCGGGCGCGGCCCGAGCCGG - Intronic
1095584557 12:43836028-43836050 GCGGCGGGTGTGGGCCGAGCCGG + Intronic
1095976184 12:47942461-47942483 GCAGCTGGCGCGGTCAGAGAAGG - Intronic
1096981216 12:55729021-55729043 GCGGCAGGCGGGGCGGGAGCCGG - Intronic
1097284791 12:57869030-57869052 GGGGCTGGCTCGGCCCAGGCTGG - Intergenic
1099956225 12:89354119-89354141 GCGGCCGGCGCGGCGCGAGAGGG + Intergenic
1100963116 12:99984904-99984926 GCCCCTGGTGCGGCCCGAGTTGG + Intergenic
1102151019 12:110689176-110689198 GGGGCGGGGGCGGCCCGGGCGGG - Intronic
1102247233 12:111363058-111363080 GCGGCTGGTGGTGCGCGAGCTGG - Exonic
1102248379 12:111369136-111369158 GGGGCGGGCCCGGCGCGAGCAGG - Intergenic
1103363896 12:120368994-120369016 GGGGCGGGCGCGGGCCAAGCAGG + Intronic
1103392483 12:120584623-120584645 GCGGCTGGCGCAGCCCGAGCCGG - Intergenic
1103567338 12:121823226-121823248 GTGGCTGGCCCGGCAGGAGCAGG - Exonic
1103698689 12:122836054-122836076 GGGGCCGGCGCGGCCCGACTGGG + Intronic
1105011892 12:132761765-132761787 GCGGCTGGCGGCGGCCGAGTGGG - Exonic
1105040354 12:132956263-132956285 GCGGCGGACACGGCCCGATCGGG + Exonic
1105571146 13:21604012-21604034 GTGGCCGGCGCGGCCCTGGCAGG - Exonic
1106157385 13:27171447-27171469 GCGGCCCGGGCGGCCCGGGCGGG - Intronic
1106480474 13:30133599-30133621 GCGGCTGGGGCGTCCCAGGCAGG - Intergenic
1107133480 13:36920203-36920225 GCGGCGGCGGCGGCCCCAGCCGG + Exonic
1110119597 13:71865762-71865784 GCGGCTGGCGAGCCCCGAGCAGG + Intronic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1113378470 13:109784221-109784243 GCGGCCCGCGCTGCCCGAGAAGG + Exonic
1113653955 13:112056845-112056867 GGGGCTGGCGCTGCCGGAGCCGG + Intergenic
1114664259 14:24368887-24368909 GCAGATGGCGGGGACCGAGCCGG + Intronic
1117722065 14:58638003-58638025 GCGGACGGCGCTGCCCGGGCCGG + Intronic
1119701982 14:76761803-76761825 GGCGGTGGCGCGGCCCGGGCGGG - Intergenic
1119722018 14:76898114-76898136 GCGGCTGGCGGGGCGGGGGCTGG + Intergenic
1122717685 14:103705427-103705449 GCGGTGGGCGGGGCCCCAGCAGG + Intronic
1122741153 14:103872194-103872216 GCGGCAGGCAAGGCCCGGGCTGG - Intergenic
1122800411 14:104226600-104226622 GAGGCTAGCCCGGGCCGAGCTGG + Intergenic
1122937453 14:104966699-104966721 GGGGCTGGGGTGGCCCCAGCTGG - Intronic
1122959446 14:105087750-105087772 GGCGCTGGCGCGGGGCGAGCTGG + Intergenic
1123036778 14:105474830-105474852 GCGGAGGGCGCGGGCCGACCGGG + Intronic
1202872590 14_GL000225v1_random:177767-177789 GGGGCGGGCGCGCCCCGAGCCGG + Intergenic
1124971610 15:34495022-34495044 CCTGGTGGCGCGCCCCGAGCCGG + Intergenic
1126113267 15:45187689-45187711 GCGGGGGGCGCGGCCGGAGAGGG + Intronic
1127488176 15:59438198-59438220 GCCGCTGGCGCTGGCTGAGCAGG - Exonic
1127982719 15:64046374-64046396 GCGGCGGGCGCGGCGGGAACGGG + Intronic
1128280156 15:66387460-66387482 CCGGCTGGGGAGGCCCGAGCCGG + Intronic
1128605391 15:69033082-69033104 TCAGCTGGCGCGGCCGGCGCGGG - Exonic
1129188989 15:73926858-73926880 GCAGCAGGCGCAGCCCGGGCAGG + Exonic
1129742828 15:77998246-77998268 CCGGCTGGAGCTGACCGAGCTGG - Exonic
1129842642 15:78753200-78753222 CCGGCTGGAGCTGACCGAGCTGG + Intergenic
1129853771 15:78810600-78810622 GCTGCTGGCGCGGCCCCTGGCGG - Intronic
1132055638 15:98648850-98648872 GCGGCGGGCGGGGGCCGGGCGGG + Intergenic
1132464862 16:72656-72678 GGGGCGGGCCCGGCCGGAGCGGG + Intronic
1132512808 16:352620-352642 GCCGCTGCCGCCGCCAGAGCCGG - Exonic
1132692280 16:1186983-1187005 GCGGCTGGCCCGGCCCCTCCTGG + Intronic
1132703001 16:1229915-1229937 GCTGCTGGCGCTGCCCGTCCTGG - Exonic
1132705322 16:1240953-1240975 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132708451 16:1256316-1256338 GCTGCTGGCGCTGCCCGTCCTGG + Exonic
1132805520 16:1773419-1773441 GCGGCTGCTGCGGCCGGAGCAGG + Exonic
1132926064 16:2429631-2429653 GCGGATGTCGCGTCCCGCGCAGG + Intronic
1133063406 16:3189560-3189582 GCGGCTGGGGCGGACCCAGCAGG - Intergenic
1133233031 16:4375238-4375260 GAGGCTGGCCCGGCCCCAGGTGG - Intronic
1134172107 16:11976854-11976876 GCAGCTGGAGCGGCGGGAGCCGG - Intronic
1134524059 16:14930986-14931008 GGGGATGGCGCGGCCCCGGCTGG - Intronic
1134548843 16:15129949-15129971 GGGGATGGCGCGGCCCCGGCTGG + Intronic
1134849871 16:17470899-17470921 GCGGCGGCGGCGGCCCGAGCGGG - Intergenic
1136242128 16:28951079-28951101 GCGGCTGGGGCGGTCGGGGCCGG + Exonic
1136536375 16:30902269-30902291 GCAGCAGGCGCGGCGCGCGCGGG - Exonic
1137574028 16:49586601-49586623 GCGGCAGGCGCAGCCCACGCTGG + Intronic
1137668623 16:50266503-50266525 GCTGCTGCCGCTGCCGGAGCAGG + Exonic
1138178736 16:54928879-54928901 GCGGCTGCGGCGGGCGGAGCCGG + Intergenic
1138619155 16:58197916-58197938 GCGGGGGGCGCCGGCCGAGCCGG + Exonic
1139575971 16:67842353-67842375 GCGGGCGGCGCGGCGCGGGCCGG + Exonic
1140442573 16:74999083-74999105 GCGGCTGGCGGGGCCGGCGGCGG + Exonic
1142050000 16:87951773-87951795 GCGGCTGCCGCAGCCCGGCCCGG + Intronic
1142504985 17:357662-357684 GCAGCTGGCACGGCCGGGGCTGG + Intronic
1143150748 17:4806799-4806821 GCGGCTGGAGGGGCCCGGGGCGG + Intergenic
1143164178 17:4889742-4889764 GCGGCAGGCGGAGCGCGAGCAGG + Exonic
1143299403 17:5898588-5898610 GAGGCTGGCGTGGCCGGCGCAGG + Intronic
1143579768 17:7818675-7818697 GCGGAAGGAGCGGCCTGAGCTGG + Exonic
1144758385 17:17693836-17693858 GCGGCTGGACCAGCCCGGGCTGG + Intronic
1147285686 17:39401407-39401429 CCGGCGGGTGCGGCCCGGGCCGG + Exonic
1148090262 17:45019099-45019121 GCGGCGCGGGCGGCCCGGGCGGG + Intergenic
1148105951 17:45118959-45118981 GCTGCTGAAGCGGCCGGAGCTGG - Exonic
1148388596 17:47254068-47254090 CTGGCTGGCGCGGTCGGAGCCGG + Intronic
1150675811 17:67245274-67245296 GCGGGAGGCGCGGCCGGAGGGGG - Intronic
1150821999 17:68442675-68442697 GAGGCTGGCAGGGCCTGAGCTGG - Intronic
1151557222 17:74852615-74852637 GGGGCGGGCGGGGCCTGAGCGGG + Intronic
1152622613 17:81372835-81372857 GTGGCTGGGAAGGCCCGAGCTGG - Intergenic
1152627719 17:81395986-81396008 GCGTCTGGCGCGAGCCGCGCGGG + Intronic
1153451868 18:5238570-5238592 GCGGCTCGCGCGGGCCCGGCCGG - Intergenic
1154049030 18:10935796-10935818 GCTGCTGGCGAGGCAGGAGCAGG - Intronic
1154214875 18:12408321-12408343 GGGGCGGGGGCGGCCGGAGCCGG + Intronic
1154367704 18:13726485-13726507 GCGGCTGGCGGGGCCGGGGGCGG - Exonic
1157338211 18:46756651-46756673 CTGGTTGGCGCGGCCGGAGCTGG + Exonic
1160499717 18:79395749-79395771 GCGGCTGCCGCGGCGCGGGGAGG + Intergenic
1160592163 18:79951087-79951109 GCGGCTGGCGCGGGTCGGGTCGG - Intronic
1160792579 19:929444-929466 GCGGCGGGGGCGGCCCCTGCGGG - Exonic
1160828590 19:1092016-1092038 GCGGAAGCCGAGGCCCGAGCAGG - Intronic
1160844442 19:1160241-1160263 GCGGCTTGCTGGGCCCCAGCCGG - Intronic
1160860417 19:1235174-1235196 GCGCCTGGCGTGGCCCGCCCGGG - Intronic
1160875833 19:1295876-1295898 GGGGCTGCCGGGGCCCGAGTGGG + Intronic
1160904470 19:1445942-1445964 GAGGCTGGGGGGGCCCGAGGCGG - Intergenic
1161215753 19:3094453-3094475 GCGGCTGGCGCGGCCCGAGCGGG + Exonic
1161264608 19:3358614-3358636 GCGGCTCGCGCGGCAGGGGCGGG + Intergenic
1161461513 19:4400391-4400413 GTCGCTGGCGCGGTCCGGGCGGG - Exonic
1161560271 19:4969203-4969225 GCGGCGTGCGCGGCCCGGTCCGG - Exonic
1161560323 19:4969354-4969376 GCGCGAGGCCCGGCCCGAGCAGG - Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162954714 19:14091371-14091393 GCGGCGGGGGCGGCCCTGGCAGG - Intergenic
1163019377 19:14474364-14474386 GAGGCTGGCTGGGCCCGGGCGGG + Intronic
1163287113 19:16355758-16355780 GCGGCTGCGGCGGCAGGAGCAGG - Exonic
1163287124 19:16355812-16355834 GCAGCTGGCGTGGGCCAAGCGGG - Exonic
1163687443 19:18719763-18719785 GCGGCTGACCCGGGGCGAGCAGG + Intronic
1165080231 19:33302529-33302551 GCGAATGGCCCGGCCCGCGCCGG + Exonic
1165313012 19:35039973-35039995 GCGGCCGGCGGGGCAGGAGCTGG - Intronic
1165469533 19:35995436-35995458 GCAGCTGGCGCCGCCCGCGGCGG - Exonic
1167258223 19:48443402-48443424 GGGGCTGGCGCGCCGGGAGCTGG + Exonic
1167472611 19:49684063-49684085 GTGGCTGGTGAGGCCCCAGCGGG + Exonic
1167501540 19:49851308-49851330 ATGGCGGGCGCGGGCCGAGCGGG - Exonic
1168080217 19:54004670-54004692 GAGGCTGGCGTGGCCGGAGCAGG - Intronic
1168092707 19:54096112-54096134 GCTGGTGGCGCTGCCCGGGCCGG - Exonic
1168241746 19:55092242-55092264 GCGGCTGGCGCAGCTCAAGGTGG - Exonic
1168694416 19:58396578-58396600 GGGCCTTGCGCGGCCCGGGCGGG - Exonic
926801841 2:16665914-16665936 GCGGCTGCCGCGAGCCGGGCTGG - Intronic
927606455 2:24491132-24491154 GCGGCCCGGGCGGCCGGAGCCGG + Intergenic
927932079 2:27051825-27051847 GGGGCTGGCGGGGCCGGGGCTGG - Intronic
927982119 2:27380683-27380705 GCGGCGGGAGCGGCCTGAGCTGG - Exonic
930700566 2:54455905-54455927 GCTGCTGCCGCTACCCGAGCAGG - Intergenic
932601927 2:73133502-73133524 GAGGCTGGTGTGGCCTGAGCAGG + Intronic
932700020 2:73985514-73985536 GCGGCGGGCGCGGCGGGCGCGGG + Intergenic
933772600 2:85753818-85753840 GCGGCTCGGGCGGCCCGGGCTGG + Intronic
937127284 2:119482681-119482703 GCTGCTGGCTGGGCCTGAGCAGG + Intronic
940775181 2:157876650-157876672 GCGGCGGGGCAGGCCCGAGCTGG + Intergenic
940883317 2:158968510-158968532 GCGGGAGGCGCGGCCGGGGCGGG + Intergenic
941384914 2:164841327-164841349 GGGGCTGGAGCGGCTCGGGCGGG - Exonic
942043497 2:172085943-172085965 GAGGCTGGCGCTGCCCGGGTAGG - Exonic
945306777 2:208266385-208266407 GCAGCCGGCGCGGCCGGGGCAGG + Exonic
945386615 2:209209331-209209353 GCAGCTGGGGCAGCCCGGGCCGG + Intergenic
945988169 2:216371455-216371477 GCTGCGGGCGCGGGCCGACCCGG - Exonic
947593057 2:231395923-231395945 GAGGCCGGCGCGGCGCGCGCGGG - Intronic
947983243 2:234427408-234427430 GCTGATGGCGGGGCCAGAGCTGG + Intergenic
948408261 2:237739284-237739306 AGGGCTGGCCCGGGCCGAGCTGG - Intronic
948518909 2:238523420-238523442 GCGGCTGGCTTGGCCCCACCGGG - Intergenic
1169557634 20:6767736-6767758 GCGACTAGCGCAGCGCGAGCCGG - Exonic
1172118065 20:32583549-32583571 GAGGCCGGCGCGGCCCGACCGGG + Intronic
1172118586 20:32585080-32585102 GCCGCCGCCGCCGCCCGAGCAGG - Intronic
1172431900 20:34899169-34899191 GCGGAGGGAGAGGCCCGAGCGGG - Intronic
1174494667 20:50931112-50931134 GCGGCCGCCGCCGCCCGCGCCGG - Exonic
1174497537 20:50959037-50959059 GCAGCTAGTGCTGCCCGAGCTGG + Exonic
1176238178 20:64063782-64063804 GGGGCTGGCGCGGCCCGCAGAGG - Intronic
1178513801 21:33229833-33229855 GCCGCTGGCGGGGCTGGAGCAGG - Intergenic
1179522404 21:41953830-41953852 GCGGCGGCCGCGGCCCGGGCTGG + Exonic
1180239362 21:46490017-46490039 GCAGCTGGCCCGGCCTGAGCAGG + Intronic
1180285511 22:10741709-10741731 GGGGCGAGCGCGCCCCGAGCCGG - Intergenic
1180702435 22:17788942-17788964 GCGGCTGGAGCGCCCCTGGCAGG + Exonic
1180732830 22:17994675-17994697 CCGGCTGGAGTGGCCCCAGCTGG - Intronic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1180841481 22:18960863-18960885 GCTGCTGGCGCGCCCTGAGCAGG + Intergenic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181516102 22:23414735-23414757 GCTGCTGGCGCAGCCCAAGGAGG + Intergenic
1183408431 22:37641382-37641404 GCGGCTGGAGCCGGCCAAGCGGG + Exonic
1183411736 22:37658917-37658939 GCGGCTGGCGCGGGCCGGCAAGG + Exonic
1183411742 22:37658965-37658987 CCGGCGCGCGCGGCCCGAGCTGG + Exonic
1183821125 22:40346690-40346712 GTGGCTGGCGGAGGCCGAGCAGG + Exonic
1184680699 22:46071080-46071102 GCGGCGGGGGCGGGCCGGGCCGG + Intronic
1184759443 22:46536581-46536603 GCGGCTGGCGCCGTCCGGGTGGG - Exonic
1184825776 22:46949903-46949925 GGGGCTGGAGCAGCCTGAGCAGG + Intronic
1185278901 22:49961558-49961580 GGTGCTGGAGCGGCCCGAGCCGG + Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949606623 3:5660539-5660561 GCAGCTGGTGTGGCCGGAGCAGG + Intergenic
950890839 3:16402325-16402347 GCGGCTGGCGCAGGCCTTGCAGG - Intronic
954392849 3:50276463-50276485 ACGACTGGCGCGGGCCGAGGAGG + Exonic
954838930 3:53494632-53494654 GCGGCGGGCGCGGAGCGAGCGGG + Intergenic
961574456 3:127823230-127823252 GCGGCGGGGGCGGCCCGAGGTGG + Intronic
963038324 3:141051228-141051250 GCGCCGGCAGCGGCCCGAGCTGG + Intergenic
965977309 3:174641036-174641058 GGGGCTGGTGGGGCCAGAGCAGG + Intronic
967055348 3:185825115-185825137 GCGGCCGGCCCGGCCCGCCCGGG + Intergenic
968471919 4:786359-786381 GCGGCGGGCGCGGGCAGGGCGGG + Exonic
968542518 4:1175310-1175332 GCCGCTGCCACGGCCAGAGCTGG - Intronic
968810721 4:2798604-2798626 GTGGCTGGCGCTGCCCGAGGCGG + Intronic
969075563 4:4575290-4575312 TCGGCTGGCGCGGCCCCGCCCGG + Intergenic
969115290 4:4867326-4867348 GCGGCTGGCGCCGGCCTGGCCGG + Intergenic
969138794 4:5051635-5051657 GCGGAAGGCGCGGCGAGAGCGGG + Exonic
975166850 4:71187155-71187177 GCGCCGGGCGCGGAGCGAGCGGG - Intergenic
975870845 4:78776607-78776629 GGGGCTGGCGGGGCCGGGGCCGG + Exonic
985452626 4:190069714-190069736 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985453613 4:190073011-190073033 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985454603 4:190076304-190076326 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985455591 4:190079597-190079619 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985456575 4:190082891-190082913 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985457563 4:190086191-190086213 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985458550 4:190089484-190089506 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
985459539 4:190092784-190092806 GCGGCTGCAGGGGCCCGGGCGGG - Intergenic
986315220 5:6582685-6582707 GAGGCTGGCGCTGCCTAAGCGGG + Intergenic
990347337 5:54883762-54883784 GCGGCTGGCGCCTCCAGGGCAGG - Intergenic
992105918 5:73448672-73448694 GGGGGTGGCGGGGCCCGGGCGGG + Intergenic
992124308 5:73625848-73625870 GAGGCTGGCGCGGACCTGGCGGG - Intergenic
992400046 5:76403505-76403527 GCGGGGGGCGCGCCCCGGGCGGG + Exonic
992473154 5:77077413-77077435 GGAGCTGGAGCGGCGCGAGCTGG - Exonic
995199246 5:109409253-109409275 GCGACTGCTGCGGCTCGAGCGGG + Intronic
996329528 5:122312796-122312818 GAGGCTGGCGGAGCCCGGGCTGG - Intronic
997453978 5:134004486-134004508 GCGGCCGGCGCGGGCCTGGCTGG - Intronic
1001822514 5:174721127-174721149 GCGCCCGGCGCGGCTGGAGCCGG + Intergenic
1002405035 5:179023939-179023961 GCGGCTGCCGCGGCGGGACCAGG + Intronic
1002612736 5:180432112-180432134 TGGGCTGGCGAGGCCGGAGCCGG + Intergenic
1002926951 6:1610369-1610391 GCGGCCGGCGCGGCGCGGCCCGG + Exonic
1004140547 6:13013782-13013804 GCGGCCGGCGCGGGCGGGGCGGG + Intronic
1006183453 6:32167408-32167430 GCGCCTGGAGCGGCTGGAGCAGG + Exonic
1007682669 6:43645296-43645318 GCGTCTTGCGCGGTGCGAGCTGG - Exonic
1007769384 6:44180704-44180726 GGGGCTGGAGGGGCCCGAGTGGG + Intronic
1010980362 6:82364089-82364111 GGGGCTGGCGGGGCGCGGGCTGG + Intronic
1010980594 6:82365009-82365031 GCGGCTGGCGCGACTAGCGCTGG + Exonic
1013514772 6:110875502-110875524 GCGGGCGGCGCGGCCCGGGGTGG + Intronic
1013576066 6:111483899-111483921 GCGGCTCGCGCGGCACGTTCGGG - Intergenic
1015965468 6:138692710-138692732 GCGGCTGCGCCGGCCCGAGGCGG - Intergenic
1017880578 6:158560130-158560152 GCGGCAGCCGCAGCCGGAGCCGG - Intronic
1018717021 6:166541264-166541286 GGGGCAGGCGAGGCACGAGCTGG + Intronic
1018802613 6:167235824-167235846 GCGGCTGCAGCCGCCCGAGTTGG - Intergenic
1018876524 6:167826860-167826882 GCGGCGGGCGGGGCGCGGGCGGG + Intergenic
1019342999 7:517326-517348 GCGGCCTGTGCGCCCCGAGCTGG - Intronic
1019637599 7:2084407-2084429 GCGAGTGGCGCTGCCCGGGCAGG + Intronic
1019738072 7:2660210-2660232 GAGGCTGGCGGGCCCAGAGCCGG - Intronic
1020137065 7:5593539-5593561 CCTGGTGGCGCGCCCCGAGCCGG + Exonic
1021827944 7:24573369-24573391 GCGGCGGGGGCGACCGGAGCTGG + Exonic
1023049164 7:36236241-36236263 GGGGCTGGCGAGGCCGGAGCCGG + Intronic
1024957023 7:54933226-54933248 GCGGCTGGCGCTGGGAGAGCGGG + Intergenic
1026732648 7:72925131-72925153 GCGGCTGCGGCGGCTGGAGCAGG + Intronic
1026909456 7:74083876-74083898 GCGGAGGGCGCGGGCCGGGCCGG - Intronic
1027111416 7:75442688-75442710 GCGGCTGCGGCGGCTGGAGCAGG - Intronic
1027283645 7:76627221-76627243 GCGGCTGCGGCGGCTGGAGCAGG - Exonic
1027421186 7:78019592-78019614 GCGGCGGACGCGGCGCGGGCGGG - Exonic
1029111731 7:98216189-98216211 GAGGCTGGCCCGGCCCGGCCAGG - Exonic
1029535407 7:101154751-101154773 GCGGCGGGGCCGTCCCGAGCCGG + Intronic
1030216015 7:107044652-107044674 GCGGCTGGAGCGGGAGGAGCAGG + Exonic
1032020707 7:128405965-128405987 GCTGCTGCCGCGGGCCGGGCGGG + Intronic
1032119267 7:129144828-129144850 GCGGCGGGAGGCGCCCGAGCCGG - Intergenic
1032159874 7:129502288-129502310 GCGGCGGGCGCGGGGCGAGGGGG - Intergenic
1032160080 7:129502988-129503010 GCGGCTGCTGCGCCCCCAGCAGG - Intronic
1032192306 7:129772036-129772058 CCGGCTGGTGCGGCCACAGCTGG - Intergenic
1032345167 7:131110056-131110078 GCGGCGGCGGCGGCCGGAGCTGG + Intergenic
1034335961 7:150323599-150323621 GCGGCTGTCGGGGCCCGTGCCGG + Intronic
1034417894 7:150974792-150974814 GCTGCGTGCGCGGCCCGTGCAGG + Exonic
1034977715 7:155457900-155457922 GCGGCGGCGGCGGCCGGAGCCGG + Intergenic
1036432234 8:8702061-8702083 GCGGCTGCCGCGGCCAAACCTGG - Exonic
1036739288 8:11347045-11347067 GGGGCTCGCGCGCCCCCAGCGGG - Intergenic
1039996786 8:42541388-42541410 GCGGCGCGCGCAGCCCGGGCGGG + Intronic
1040386424 8:46917830-46917852 GCGCCTGGCGCGCCCCCTGCTGG - Intergenic
1042155687 8:65841955-65841977 GCGGCGGCGGCGGCCCGAGCTGG - Intronic
1045047599 8:98294164-98294186 GAGGCGGCCGCAGCCCGAGCCGG - Exonic
1045098934 8:98825866-98825888 GCGGCCGGCGCGGCCGGGGGCGG - Intronic
1049021027 8:139957786-139957808 GCTGATGGCTCGGCCCGAGGGGG - Intronic
1049032319 8:140047102-140047124 GAGGCTGGCGGGGCCCAGGCAGG - Intronic
1049818301 8:144618780-144618802 GGGGCTGGGGAGGCCCCAGCAGG - Intergenic
1051170260 9:14314144-14314166 GCGGGTGGCGGGGCGCGCGCGGG + Intronic
1053306222 9:36986367-36986389 GCGGCCGGCGCTGCCCCCGCCGG - Intronic
1054731418 9:68705590-68705612 GCGGCGGGCGGGGCCGGGGCCGG - Intronic
1057138951 9:92715318-92715340 GCGGCTGGAGCTGCTCGAGCTGG - Exonic
1057227606 9:93300777-93300799 GGGGCTGGGGAGGCCCGAACTGG - Intronic
1058937185 9:109780209-109780231 TCGGCTGGCGCGGCCGGCGGCGG + Intronic
1059119780 9:111631497-111631519 GCTGCTGGTGCGGCCCGCGGGGG + Exonic
1060825112 9:126683303-126683325 GCGGCGGCCGCGGGCCGGGCGGG - Intronic
1060945823 9:127568978-127569000 GCGGCGGGAGCGGCGGGAGCGGG - Exonic
1061050304 9:128191344-128191366 GCGGCTGGCGGGGTGGGAGCGGG - Intronic
1061263779 9:129494204-129494226 GCAGCTGGGGTGGCCAGAGCTGG - Intergenic
1062461984 9:136665999-136666021 GCGGCTGGGTCGGGCCGGGCCGG + Intronic
1062620403 9:137417899-137417921 GGGGCTGGCGGGGCCGGAGGGGG + Intronic
1203731865 Un_GL000216v2:98775-98797 GGGGCGGGCGCGCCTCGAGCCGG - Intergenic
1185736528 X:2500574-2500596 GCGCCTGGCCCGGCCCGACCCGG - Intronic
1185877684 X:3713526-3713548 GCGGGGGCCGCGGCCCGGGCTGG + Exonic
1187332673 X:18354790-18354812 GCCGCGTGCGGGGCCCGAGCCGG + Intergenic
1194077670 X:89417077-89417099 GGGACTGGCGAGGCCAGAGCCGG + Intergenic
1197749115 X:129952993-129953015 GCGGCTGGAACTGCCCGAGAAGG - Intergenic
1197754464 X:129984200-129984222 ACGGCTGCGGCGGCCCCAGCAGG - Intronic
1198424051 X:136497259-136497281 GCGGCTGCGTCGGCCTGAGCAGG + Exonic
1198480221 X:137033922-137033944 GCTGCGGGCGCGGCAGGAGCGGG + Intergenic
1198750463 X:139932677-139932699 GCGGCAGCCGCGGACCGAGGAGG - Intronic
1200036360 X:153334223-153334245 GGCGCTGGCGCGGCCCAGGCAGG - Exonic