ID: 1161216364

View in Genome Browser
Species Human (GRCh38)
Location 19:3096848-3096870
Sequence TCAGTGCCACGCAGAGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161216362_1161216364 -7 Left 1161216362 19:3096832-3096854 CCAAGGAGGACTGGTGTCAGTGC 0: 1
1: 0
2: 1
3: 14
4: 152
Right 1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG 0: 1
1: 0
2: 1
3: 37
4: 339
1161216361_1161216364 -6 Left 1161216361 19:3096831-3096853 CCCAAGGAGGACTGGTGTCAGTG 0: 1
1: 0
2: 1
3: 13
4: 121
Right 1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG 0: 1
1: 0
2: 1
3: 37
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161216364 Original CRISPR TCAGTGCCACGCAGAGAGCC GGG Intronic
900389020 1:2426009-2426031 TCAGTTCCGTGCAGGGAGCCAGG - Intronic
900930066 1:5730858-5730880 ACAGTGCCCCTCAAAGAGCCAGG + Intergenic
901166146 1:7222933-7222955 TCTGTGCCACACAGGGTGCCGGG - Intronic
901938757 1:12645880-12645902 CCAGTCCCACTCACAGAGCCTGG + Intronic
902819622 1:18936054-18936076 CCAGTGCCCAGCACAGAGCCTGG + Intronic
902973383 1:20071313-20071335 TCTGTGCCATGCAGAGTGCTAGG + Intronic
903386480 1:22930347-22930369 ACAGTGCCCAGCAGACAGCCTGG + Intergenic
903694853 1:25199202-25199224 TCAGAGCCCCGCAGAGGGCGAGG + Intergenic
904187650 1:28718217-28718239 TCAGTGCCTAGCACAAAGCCTGG - Intronic
904492190 1:30868033-30868055 CCAGTTCCAAGCACAGAGCCAGG + Intergenic
904942148 1:34171388-34171410 TCAGTGCCATTCAGAGTGCCTGG + Intronic
904964664 1:34362146-34362168 TCCGTGCCCTGCAGAGTGCCTGG - Intergenic
905104535 1:35556950-35556972 TGAGAGCCAGGCAGACAGCCGGG - Intronic
905256167 1:36686855-36686877 TCAGTGCCAGGGAGACAGTCAGG + Intergenic
905271141 1:36788406-36788428 TCAGAGCCAAGCACAGTGCCAGG + Intergenic
906153565 1:43601417-43601439 TGAGTGCCAAGCTCAGAGCCTGG - Intronic
906613692 1:47220779-47220801 TCAGTGCCTAGCACAGTGCCTGG - Intronic
906691255 1:47794247-47794269 TCAGGCCCACCCACAGAGCCAGG - Intronic
907490873 1:54808030-54808052 GGAGTCCCAAGCAGAGAGCCTGG + Intronic
907672782 1:56491648-56491670 TCAGTGCCAGGCAGACATGCAGG + Intergenic
907734786 1:57101705-57101727 CCAGTGCCTAGCAGAGTGCCTGG - Intronic
908459128 1:64332376-64332398 TCAGTGCCTAGTAGAGAGTCTGG - Intergenic
908967222 1:69780405-69780427 TCAGTGACAGGCACAGTGCCAGG - Intronic
909644766 1:77904931-77904953 TCAGTGCCCAGTAGAGTGCCTGG + Intronic
910227853 1:84954767-84954789 TCAGTGCCTAGCACAGTGCCTGG - Intronic
911448045 1:98024480-98024502 TCAGTGCCTTGCATAGTGCCCGG + Intergenic
912126462 1:106544951-106544973 ACAGTGCCTCCCAGAGTGCCTGG + Intergenic
912522460 1:110255141-110255163 CCAGTGCCTGGCACAGAGCCTGG + Intronic
913158212 1:116121094-116121116 TAAGTGCCACCAACAGAGCCAGG + Intronic
913207648 1:116555923-116555945 ACAGTGCCTGGCACAGAGCCAGG - Intronic
913211011 1:116582312-116582334 TTAGTGTCACGCAGACAGCAGGG - Intronic
913592679 1:120343172-120343194 TCAGTGCCACGTACAGTGCCTGG + Intergenic
913650672 1:120911958-120911980 TCAGTGCCACGTACAGTGCCTGG - Intergenic
913962413 1:143350619-143350641 TCAGTACCACGCAGATGGACAGG - Intergenic
914056768 1:144176196-144176218 TCAGTACCACGCAGATGGACAGG - Intergenic
914122378 1:144790166-144790188 TCAGTACCACGCAGATGGACAGG + Intergenic
914170441 1:145217109-145217131 TCAGTGCCACGTACAGTGCCTGG + Intergenic
914525557 1:148461075-148461097 TCAGTGCCACGTACAGTGCCTGG + Intergenic
914598113 1:149174754-149174776 TCAGTGCCACGTACAGTGCCTGG - Intergenic
914640841 1:149606053-149606075 TCAGTGCCACGTACAGTGCCTGG - Intergenic
915327577 1:155088574-155088596 ACAGTGCCAATTAGAGAGCCTGG - Intergenic
915557056 1:156666675-156666697 TCAGAGGCAGGAAGAGAGCCTGG - Intergenic
916514616 1:165504210-165504232 TCAGTGCCTAGCACAGAGCCTGG + Intergenic
916801804 1:168222967-168222989 CCAGTGCCAAGCACAGTGCCTGG - Intergenic
917682847 1:177385140-177385162 TCAGTGCCAGTGAGAGAACCTGG + Intergenic
919444814 1:197689782-197689804 TCAGTGCCAAGCATAGTGCCTGG - Intronic
920177138 1:204109017-204109039 TCAGAGCCAGGCCGAGAGCAGGG - Intronic
922130081 1:222769017-222769039 TCTCTGCCACTCAGTGAGCCAGG - Intergenic
922191442 1:223322408-223322430 TCAGTGTCAAGCATAGAGCATGG + Intronic
922766753 1:228160079-228160101 TCGGTGCCAGGCAGCGTGCCGGG + Intergenic
923056536 1:230430326-230430348 CCAGTGCCTAGAAGAGAGCCTGG - Intergenic
924088250 1:240476675-240476697 CCAGTGCCACCCAGAAAGCCGGG + Intergenic
924412230 1:243818821-243818843 TCAGTCCCATGGAGAGAACCTGG - Intronic
924539760 1:244970330-244970352 TCAGCGCCCCGCGGCGAGCCTGG - Exonic
1065845123 10:29736991-29737013 TCCGAGCCACTCAGAGCGCCTGG - Intergenic
1067080304 10:43208823-43208845 TCAGTGCCAAGTGGAGAGGCAGG + Intronic
1067415043 10:46096469-46096491 ACAGTGGCACCCAGAGAGCTTGG - Intergenic
1067829609 10:49602982-49603004 TCTGTGCCAGGCAGTGAGCCTGG + Intergenic
1068516203 10:58028447-58028469 CCAGTGCCAAGCACAGTGCCTGG + Intergenic
1069753185 10:70757925-70757947 TCAGTGCCAGGCATAGCGGCCGG - Intronic
1070657564 10:78281938-78281960 TGAGTGCCAGGCACAGAGCCAGG + Intergenic
1072489527 10:95890181-95890203 TCAGAGCTAAGCAGAGTGCCAGG + Intronic
1072640189 10:97205781-97205803 CCAGAGCCACACACAGAGCCTGG - Intronic
1072928572 10:99639667-99639689 TCAGTGCCAAGAAGGTAGCCTGG - Intergenic
1073301013 10:102470989-102471011 CCAGTGTCACGCAGAAAGCGCGG - Exonic
1074338991 10:112607496-112607518 TCAGTGCCTAGCACAGTGCCTGG + Intronic
1075432571 10:122400830-122400852 CCAGTGCCAAGCACAGTGCCTGG - Intronic
1075844868 10:125537038-125537060 TCTGTGCCATGCACAGGGCCTGG + Intergenic
1075845012 10:125538281-125538303 TGGGTGCCACCCAGTGAGCCAGG + Intergenic
1075995190 10:126871386-126871408 CCAGTGCCAAGCACAGTGCCTGG - Intergenic
1076020912 10:127072281-127072303 TCAGTGCCTAGCACAGTGCCTGG - Intronic
1076353968 10:129839177-129839199 TCAGCACCCAGCAGAGAGCCTGG + Intronic
1077218707 11:1405812-1405834 TCACTGCCACGCAGGTAGGCAGG - Intronic
1077269107 11:1666668-1666690 TCTGTGACACGGAGTGAGCCAGG - Intergenic
1077271440 11:1684046-1684068 TCTGTGACACGGAGTGAGCCAGG + Intergenic
1077461289 11:2712067-2712089 TCCCTGCCTCCCAGAGAGCCAGG + Intronic
1077562449 11:3272334-3272356 TCTGTGCTACCCAGAGAGCGGGG + Intergenic
1077568343 11:3318154-3318176 TCTGTGCTACCCAGAGAGCGGGG + Intergenic
1077671814 11:4164791-4164813 TCAGTGCCTGGCAGACTGCCTGG - Intergenic
1078084051 11:8223224-8223246 ACAGTGCCAAGCACAAAGCCTGG - Intergenic
1078149731 11:8748362-8748384 CCAGTGCCCAGCACAGAGCCTGG + Intronic
1079041881 11:17066969-17066991 CCAGTGCCCAGCACAGAGCCTGG - Intergenic
1080031008 11:27661193-27661215 GAAGTGCCACTCAGAGAGCAGGG - Intronic
1080650275 11:34216957-34216979 TCATTGCCACGGAAAGAGGCAGG - Intronic
1082125844 11:48430222-48430244 TCAGTCACACACAGAGACCCAGG - Intergenic
1082785989 11:57316975-57316997 TCACTGCCAGGCAGACATCCTGG + Intronic
1083290485 11:61687187-61687209 TCAGGGACACTCAGAGAGGCAGG + Intronic
1083554448 11:63614495-63614517 TGAGAGCCTCGCAGAGCGCCCGG + Intronic
1084434825 11:69132563-69132585 CCAGTGCCACCCAGGGAGGCTGG - Intergenic
1084944572 11:72631824-72631846 GCAGTGCCCCTCAGAGAGGCTGG - Intronic
1085051685 11:73383220-73383242 TCAGGGCCACTCAGTGAGACAGG - Intronic
1085051937 11:73384381-73384403 TCAGTGCCTGGCACAGAGTCTGG - Intronic
1085055700 11:73402342-73402364 TCAGTGCCTCGCTGGGAACCTGG + Intronic
1085255009 11:75167588-75167610 CCAGTGCCCTGCAGAGGGCCTGG - Intronic
1085769559 11:79312665-79312687 TCAGTGCCTAGCAAAGAACCAGG + Intronic
1085821769 11:79801505-79801527 TCAGTGCCTAGAAGAGAACCTGG + Intergenic
1087752097 11:102018243-102018265 ACTGTGCCCCGCAGAGTGCCTGG - Intergenic
1088022318 11:105134718-105134740 TCAGTGTCAAGCATAGAACCTGG - Intergenic
1089343500 11:117775533-117775555 TCAGTTCCAAGCAGATGGCCAGG - Intronic
1089794785 11:120971555-120971577 TCAGAGCCTCGCACAGTGCCTGG - Intronic
1091716906 12:2784073-2784095 CCAGTGCCTGGCACAGAGCCTGG + Intergenic
1092534934 12:9378846-9378868 CCAGTGCCTAGCACAGAGCCTGG - Intergenic
1093894387 12:24561180-24561202 TGACTGCCACCCAGAGTGCCTGG + Intergenic
1094272324 12:28630472-28630494 TCAGTGCACCTCAGAGAGCAGGG - Intergenic
1096089717 12:48890883-48890905 TCAGCGCCCGGCCGAGAGCCCGG + Intergenic
1096280562 12:50249213-50249235 TCAGTGCCAGGGAGAGAGCTGGG + Intronic
1096511373 12:52131462-52131484 TCAGTGCCTCGCAAAGTGTCTGG - Intergenic
1096620537 12:52861970-52861992 TCAGTGCCAAGCACTGTGCCGGG + Intergenic
1097348322 12:58519767-58519789 TAAGTGCCAAACAGAGTGCCTGG + Intergenic
1098335688 12:69402221-69402243 TCAATGCCAGGCACAGAGTCTGG + Intergenic
1098979119 12:76936018-76936040 CCAGTGCCTAGCACAGAGCCTGG - Intergenic
1100100086 12:91092310-91092332 TCAGTCACACACAGAGACCCAGG - Intergenic
1102411542 12:112724629-112724651 TCAGTGCCTAGCACAGTGCCTGG + Intronic
1102866420 12:116378548-116378570 TAAGTGCCAGGCAGAGAACATGG - Intergenic
1103378716 12:120477390-120477412 CCAGTGCCCAGCACAGAGCCAGG - Intronic
1103402844 12:120654938-120654960 TCTGGGCCAGGCAGGGAGCCAGG + Intronic
1104019344 12:124981224-124981246 CCAGGGCCTAGCAGAGAGCCTGG + Intronic
1104660186 12:130606442-130606464 TCAGTTCCACGCAAGGAGGCAGG + Intronic
1107317664 13:39150947-39150969 CCAGTGCCTAGCAGAGAGCCTGG - Intergenic
1108167241 13:47706497-47706519 TCAGTTCCAACCAGTGAGCCAGG + Intergenic
1108625664 13:52226229-52226251 TGAGTGCAGTGCAGAGAGCCAGG + Intergenic
1109862237 13:68215265-68215287 TCAGTGCCAGGCAGCTATCCAGG - Intergenic
1112113069 13:96323882-96323904 TCAGTGCCAAGAACAGTGCCTGG + Intronic
1112996765 13:105584260-105584282 TCAGTGCCTACCATAGAGCCCGG - Intergenic
1113130298 13:107029117-107029139 TCAGTTCCAGGCAGAGAACCTGG + Intergenic
1113313998 13:109159536-109159558 TCAGTGCCTAGAATAGAGCCCGG - Intronic
1113450547 13:110406328-110406350 GCAGTCCCAGGCTGAGAGCCCGG + Intronic
1114281158 14:21193278-21193300 CCACAGCCTCGCAGAGAGCCAGG + Intergenic
1114532026 14:23402396-23402418 TCTGAGTCCCGCAGAGAGCCTGG + Intronic
1115378633 14:32707611-32707633 CCAGTGCCAAGCACAGTGCCTGG + Intronic
1115711342 14:36054482-36054504 TCAGTGACACCCAGTGACCCTGG + Intergenic
1115760563 14:36576876-36576898 TCAGGGCCACTCACAGAGGCTGG - Intergenic
1119401444 14:74365387-74365409 TCCCTGCCAGGCAGAGAGCTGGG + Intergenic
1121576385 14:94991797-94991819 TCAGTACCCAGCAAAGAGCCTGG + Intergenic
1121776234 14:96592859-96592881 TCAGTGCCACGCGGTGAGATAGG + Intergenic
1121876398 14:97457126-97457148 TCACTGCCACTCACAGGGCCTGG + Intergenic
1122227468 14:100287971-100287993 TCAGTGGGAAGCAGAGAGCTAGG + Intergenic
1122455509 14:101847568-101847590 TCAGTGCCTAGCACAGTGCCTGG + Intronic
1122797542 14:104213524-104213546 TCTGGGCTACGCAGAGAACCCGG + Intergenic
1124052788 15:26214431-26214453 GCAGAGCCAAGCAGAGAGCCTGG + Intergenic
1126152927 15:45539372-45539394 TCTGTGCCAGGCACAGTGCCAGG - Intergenic
1130843738 15:87725265-87725287 GCAGTGCCAGGCAGAGCTCCTGG + Intergenic
1131025828 15:89140857-89140879 TCAGTGCCACGAAGATGGCTGGG - Intronic
1131851062 15:96543736-96543758 TCACTGCCCACCAGAGAGCCAGG - Intergenic
1132242258 15:100266779-100266801 TAAGTGCCCTGCAGAGAACCAGG - Intronic
1132685177 16:1159165-1159187 CCAGTTCCCCGCAGAGTGCCCGG + Intronic
1132832537 16:1935832-1935854 CCTCTGCCACGCAGAGAGGCAGG + Intergenic
1133316796 16:4889955-4889977 TCAGTGCCCCGCACAGGGCCTGG - Intronic
1136056788 16:27695660-27695682 CCAGTGCCAAGAACAGAGCCTGG + Intronic
1136103541 16:28012487-28012509 TCAGTGCCTAGCAGACTGCCTGG - Intronic
1137627289 16:49917289-49917311 ACAGTGCCAAGCACAGACCCCGG - Intergenic
1139636605 16:68261910-68261932 TCAGGGCCAAGCAGGGAGTCAGG - Intergenic
1139645283 16:68324939-68324961 TCTGTGCCAAGCACAGAGCCAGG + Intronic
1140508115 16:75487319-75487341 TGAGTGCTGCCCAGAGAGCCAGG - Intronic
1141626314 16:85263337-85263359 TCAGAGGCCCCCAGAGAGCCGGG + Intergenic
1141921895 16:87141016-87141038 TCTGTGTCGCGCAGGGAGCCGGG - Intronic
1142666076 17:1464573-1464595 TCACTGCCACTCCCAGAGCCAGG - Exonic
1144656303 17:17039367-17039389 TCAGTGCCTGGCATAGAGCAGGG - Intergenic
1145014678 17:19388394-19388416 TCAGTGCCCATCACAGAGCCTGG + Intergenic
1145103577 17:20096815-20096837 ACAGGGCCAGGCAGAGCGCCTGG + Intronic
1145272197 17:21410690-21410712 GCAGTGCCACGCACACAGTCAGG + Intronic
1145310405 17:21698155-21698177 GCAGTGCCACGCACACAGTCAGG + Intronic
1146087220 17:29840740-29840762 TCTGTGCCAAGTAGAGAGCAGGG - Intronic
1146983906 17:37194266-37194288 TCAGTACAAGGCAGAGAGACCGG + Intronic
1147041422 17:37722317-37722339 CCAGTGCCAAGCACAGTGCCTGG - Intronic
1147454308 17:40526748-40526770 TCAGTCCCAGAGAGAGAGCCAGG - Intergenic
1148424557 17:47582599-47582621 TCAGTGCCAGGCAACAAGCCAGG - Intronic
1148849199 17:50546624-50546646 TCAGTGCCTTGCAGAGTGGCAGG + Intronic
1149014360 17:51890900-51890922 TCAGTGCACAGCAGACAGCCCGG + Intronic
1149295302 17:55256716-55256738 TCAGTGCCCAGCACAGTGCCTGG + Intergenic
1149494218 17:57106844-57106866 TCAGTGCCAGGCAGGAGGCCAGG - Exonic
1149595095 17:57860722-57860744 TGAATACCACGCAGAGAACCAGG + Intergenic
1151519387 17:74617423-74617445 GCAGTGCCAGTCACAGAGCCGGG + Exonic
1151671499 17:75573896-75573918 TCAGAGCCGGGCAGGGAGCCCGG + Intronic
1152134857 17:78497809-78497831 TCACTGCCAAGCCGAGAGTCAGG + Intronic
1152242339 17:79167230-79167252 ACAGTGCCAGGCACAGTGCCAGG + Intronic
1152760533 17:82105067-82105089 CCAGGGGCACCCAGAGAGCCCGG - Intronic
1152946479 17:83200393-83200415 TGGGTGCCACCCAGAGAGCTTGG + Intergenic
1155151124 18:23123764-23123786 TTAGTGCCTAGCAGAGAGCATGG + Intergenic
1155221558 18:23689979-23690001 TGAGGGCCTCGGAGAGAGCCGGG + Intronic
1155847505 18:30727959-30727981 TAAGTGTCAGGCAGAGAGCTAGG + Intergenic
1156807136 18:41198193-41198215 TCAGGGCAAAGGAGAGAGCCTGG + Intergenic
1157683988 18:49628366-49628388 TCAGTGCCTCCCAGGAAGCCAGG - Intergenic
1158422446 18:57307174-57307196 CCAGGGCCACTCAGATAGCCTGG + Intergenic
1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG + Intronic
1161594344 19:5143656-5143678 TCAGTGACACGCAGGGGGACGGG + Intronic
1162402346 19:10453872-10453894 CCGGTGCCACCCAGAGACCCTGG - Intronic
1163630263 19:18414852-18414874 TCAAGGCCACACAGTGAGCCAGG + Intergenic
1164145717 19:22511304-22511326 CCAGTGCCCAGCACAGAGCCTGG + Intronic
1166558082 19:43714897-43714919 TCAGAGCCACCCTGAGAGCTGGG - Intergenic
1167110273 19:47456722-47456744 TCTGGGCCAGGCAGAGAGCATGG - Intronic
1167467385 19:49657551-49657573 TCAGTGACATGCAGAGGCCCAGG + Intronic
1167650929 19:50728239-50728261 CCAGCGCTCCGCAGAGAGCCAGG - Intergenic
1202696252 1_KI270712v1_random:128881-128903 TCAGTACCACGCAGATGGACAGG - Intergenic
926205444 2:10831908-10831930 TCAGCGCCCAGCAGAGAGCCTGG - Intronic
926368019 2:12151310-12151332 CCACTGCCATGCAGAGACCCAGG + Intergenic
927308898 2:21605783-21605805 TCAGTGCCTGGCAGAGAGGATGG + Intergenic
928375418 2:30769583-30769605 CCAGTGCCAAGCACAGTGCCTGG + Intronic
929429377 2:41874109-41874131 TTAGGGCCTAGCAGAGAGCCGGG - Intergenic
929956006 2:46459253-46459275 TCAGAGCTCAGCAGAGAGCCAGG + Intronic
931692337 2:64845876-64845898 TCAATGCCAAGCACAGAGCCTGG + Intergenic
933385397 2:81604364-81604386 GCAGTGCCTGGAAGAGAGCCAGG - Intergenic
934277415 2:91585906-91585928 TCAGTACCACGCAGATGGACAGG - Intergenic
934562174 2:95319046-95319068 TGAGTGCCTTGCACAGAGCCTGG + Intronic
934910095 2:98244793-98244815 TCAGTGCCTGGCAGAGAGTAAGG + Intronic
934923771 2:98367073-98367095 TCAGTCCCACTGAGAGAACCTGG + Intronic
935653303 2:105399699-105399721 TCAGCGTCACGCAGAGGGCCCGG - Intronic
937870545 2:126782978-126783000 TCAGTGCCAGGCAGTGAACAAGG + Intergenic
938812845 2:134869610-134869632 TCAGTGCCTCGGACAGGGCCTGG - Intronic
938917942 2:135963038-135963060 TCAGTGCTACACAAAGACCCTGG + Intronic
939390696 2:141565918-141565940 AAAGTGCCAGGCAGAGTGCCTGG - Intronic
940754221 2:157663337-157663359 TCAGTGCTAAGCATAGTGCCTGG - Intergenic
941006653 2:160254522-160254544 TAAGTGCCAAGCAGGGGGCCTGG - Intronic
943236432 2:185326759-185326781 TCAGTGCTTAGCACAGAGCCTGG - Intergenic
943673101 2:190686229-190686251 TCAGTGCCTAGGAGAGTGCCTGG - Intronic
944877953 2:203982035-203982057 TCAGTGTGAAGCAGAGATCCTGG + Intergenic
945009714 2:205448027-205448049 CCAGTGCTAAGCACAGAGCCTGG - Intronic
946072586 2:217047326-217047348 TCAGTACCAAGAAGAGTGCCTGG + Intergenic
948335062 2:237201248-237201270 GCAGTGGGATGCAGAGAGCCAGG - Intergenic
948719971 2:239893326-239893348 TCTGAGCCAATCAGAGAGCCTGG + Intronic
948799466 2:240425183-240425205 TCAGCGCCAGGGAGAGTGCCAGG + Intergenic
948873879 2:240817462-240817484 TCACAGCCACCCAGAGACCCAGG + Intronic
1170361673 20:15553183-15553205 TCAGTCCCTAGCAGAAAGCCTGG - Intronic
1170507164 20:17039112-17039134 CCAGTGCCTCCCAGAGAGCTTGG - Intergenic
1170972700 20:21131128-21131150 TCAGTCCCAAGAAGAGTGCCTGG - Intronic
1172131853 20:32661236-32661258 TCAATGCCCGGCAAAGAGCCTGG - Intergenic
1172832199 20:37845524-37845546 TCAGTGTTACGCAGAGAGCCAGG + Intronic
1172872630 20:38145125-38145147 GCAGTCCCAGGCAGAGAGGCAGG + Intronic
1174145783 20:48451610-48451632 TCAGTGCCAGGCACAGTTCCAGG + Intergenic
1175183764 20:57166269-57166291 TCAAAGCCACACAGAGGGCCGGG + Intergenic
1175447730 20:59035819-59035841 TCTGTGCCATGCAGAGTGCTAGG - Intronic
1175593118 20:60209200-60209222 TCAGTGACCTCCAGAGAGCCAGG + Intergenic
1177117555 21:17104676-17104698 TCAGTCACACACAGAGACCCAGG + Intergenic
1179786958 21:43735567-43735589 GCAGAGCCAGGCAGACAGCCTGG + Intronic
1180721692 22:17914035-17914057 TCAGTGCCAGGAACAGAGCAAGG + Intronic
1180832163 22:18911889-18911911 TCAGGGCCAGGCAGAGAGTGAGG + Exonic
1182041232 22:27240232-27240254 TCAGTGCCTAGCATAGGGCCTGG + Intergenic
1182188877 22:28438011-28438033 TCAGTGCAACCAAGAGACCCAGG - Intronic
1183075866 22:35426391-35426413 TCAGTGACACCTAGAGAGGCAGG + Intergenic
1183100800 22:35582993-35583015 TAACTGCTAAGCAGAGAGCCAGG + Intergenic
1183326451 22:37197220-37197242 GCAGGGCCACGTAGAGAGCAGGG - Intronic
1183703770 22:39464396-39464418 TACGTGCCAGGCACAGAGCCAGG - Intronic
1183851995 22:40597698-40597720 GCAGTGCCAGGCACAGAGTCAGG - Intronic
1184015381 22:41782074-41782096 TCTGTGCCAAGAATAGAGCCTGG - Intronic
1184273589 22:43398273-43398295 TCAGGGCCAGGAAGAGAGGCTGG + Intergenic
1184444750 22:44540544-44540566 ACAGTGCCCCGCACAGGGCCTGG + Intergenic
1184659796 22:45960504-45960526 TCCCTGCCACCCAGAGAGCTGGG - Intronic
1184784501 22:46665189-46665211 TCTGTGCCCAGCACAGAGCCCGG - Intronic
1184892357 22:47387789-47387811 TCAGGGCCCCGCAGAGAACAGGG - Intergenic
1185228912 22:49669036-49669058 TCAGGGCCAGGCCGGGAGCCAGG - Intergenic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
1203282248 22_KI270734v1_random:137194-137216 TCAGGGCCAGGCAGAGAGTGAGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954799464 3:53178811-53178833 TCAGTGCCCCGCACAGGCCCTGG - Intronic
955065109 3:55527060-55527082 TCAGTGCCTAGCACAGTGCCTGG + Intronic
955876618 3:63496887-63496909 TCATTGCCAAGCATAGTGCCTGG - Intronic
956420489 3:69081684-69081706 TCAATGCCAGGCAGTGAGCGTGG + Intergenic
959087025 3:101862395-101862417 TCAGTGCCTAGCACAGTGCCTGG + Intergenic
960176315 3:114521977-114521999 TCAGTGCCTAGTACAGAGCCTGG - Intronic
961972583 3:130986101-130986123 TCACTGCCACCCAGAGAGCTGGG + Intronic
962055735 3:131869833-131869855 ACAGTGCCAAACAGACAGCCTGG - Intronic
962462259 3:135625341-135625363 ACAGTGCCAGGCAGTGTGCCAGG - Intergenic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
965629095 3:170712312-170712334 CCAGTGCCCAGCACAGAGCCTGG - Intronic
965666265 3:171096769-171096791 TCAGTGCCAAGCATGGTGCCTGG + Intronic
967023628 3:185544787-185544809 TCAGTGCCAAGAACAGGGCCTGG + Intronic
967405110 3:189106586-189106608 CCAGTGCCTGGCAGAGAGGCTGG + Intronic
968597880 4:1494755-1494777 TCAGAGCCACGCAGGGTGTCTGG + Intergenic
969532934 4:7739761-7739783 TCAGTGCCAAGGGGTGAGCCGGG - Intronic
969666235 4:8558935-8558957 TCATTGACCGGCAGAGAGCCAGG + Intronic
969881965 4:10182056-10182078 TCAGTGACAGGGAAAGAGCCAGG - Intergenic
970331289 4:14987006-14987028 CCAGTGCCTTGCAGAGTGCCAGG + Intergenic
970443470 4:16105029-16105051 TAAGTGTCAAGGAGAGAGCCTGG - Intergenic
974010771 4:56605276-56605298 CCAGTGCCAAGCACAGGGCCTGG - Intergenic
977610820 4:99028350-99028372 TCAGAGCCAAGCAGAGTGCCTGG - Intronic
977874860 4:102137312-102137334 ACAGTGCCTGGCACAGAGCCTGG + Intergenic
977914699 4:102578440-102578462 ACAGTGCCAAGCAGACAGCCTGG - Intronic
978211163 4:106136816-106136838 CCATTGCCCAGCAGAGAGCCTGG + Intronic
978238920 4:106492439-106492461 TCAGGCACACGCAGAGACCCAGG - Intergenic
984598259 4:181696647-181696669 TCAGTGCCTAGCACAGGGCCTGG + Intergenic
984679514 4:182591063-182591085 TCAGTGCCTAGAACAGAGCCTGG + Intronic
984756966 4:183333393-183333415 TTAATGCCACGCAGAGAGGAGGG + Intergenic
986012000 5:3724966-3724988 TCAGTCCCAATGAGAGAGCCTGG + Intergenic
986601308 5:9475764-9475786 TCAGTGCCAAGCAAAGAACCTGG + Intronic
988342824 5:29997088-29997110 TTAGTGCCTAGCAAAGAGCCTGG - Intergenic
989982931 5:50665707-50665729 TCAGTGCCATGTACAGTGCCTGG - Intergenic
992618384 5:78568410-78568432 TTAGTGCCACACAGAGAACACGG + Intronic
994284953 5:97953714-97953736 TCAGGGCCTGGCAGAAAGCCTGG - Intergenic
994350603 5:98742187-98742209 TCAGTTCCACTGAGAGAACCTGG - Intergenic
994680929 5:102887019-102887041 TCAGTGCCTTGCAGAGTGCCAGG + Intronic
997170546 5:131714908-131714930 TCAGGGCCAAGCAGAGTGCTTGG + Intronic
997304423 5:132827288-132827310 TCAGTGCCCAGCAGAGTCCCTGG + Intronic
997716113 5:136044265-136044287 TCAGCCCCTCGCATAGAGCCTGG - Intronic
997718171 5:136057524-136057546 ACAGGGCCAGGCAGACAGCCTGG + Intronic
998430152 5:142063672-142063694 TCAGTGCCAGGCACTGAGCCTGG + Intergenic
998562153 5:143181596-143181618 TCAGTGCCAAGCACAGTGGCTGG + Intronic
998593566 5:143503397-143503419 TCAGTGCCAAGCACAGAGCTGGG + Intergenic
999265221 5:150262562-150262584 TCAGTGCCTAGCAGAGACCTTGG + Intronic
1000154485 5:158537060-158537082 TCAGTGCTAGGCACAGAGTCTGG + Intergenic
1001599364 5:172919046-172919068 CCAGCGCCAAGCACAGAGCCAGG - Intronic
1001950093 5:175810288-175810310 CCAGTGTCACACAGAGAGTCGGG + Intronic
1001955474 5:175845689-175845711 TCTGTGCCAGGCAGTGTGCCAGG - Intronic
1002087380 5:176784719-176784741 TGAGTGCCAAGCAGAGAGGAAGG + Intergenic
1002632649 5:180591423-180591445 ACAGGGCCACGCAGAGCCCCAGG + Exonic
1004063535 6:12221182-12221204 TCAGTGCCCGGCAGAGGGCCTGG + Intergenic
1004161257 6:13215184-13215206 CCAGTGCCAAGCACGGAGCCTGG - Intronic
1004194823 6:13493975-13493997 TCAGTGCAGCGCAGGGAGCAGGG - Intergenic
1010524473 6:76883901-76883923 GCAGTGCCTGGCAGAGCGCCTGG - Intergenic
1016640937 6:146348645-146348667 TCAGTGTCATATAGAGAGCCGGG - Intronic
1017095719 6:150803420-150803442 TCAGTGCCCAGCAGAGAGCTGGG - Intronic
1017740215 6:157399775-157399797 TCAGAGCCACCCAGCCAGCCTGG - Intronic
1017906576 6:158760884-158760906 TCTGAGCCATGCAGCGAGCCCGG + Intronic
1018287709 6:162258291-162258313 TCTGTGCCAAGCACAGTGCCAGG - Intronic
1018757821 6:166864755-166864777 TCACAGGCAAGCAGAGAGCCTGG + Intronic
1019038358 6:169082329-169082351 TCAGTGCCCTGTAGGGAGCCCGG - Intergenic
1019335206 7:479477-479499 TCAGAGCCTGGCACAGAGCCTGG - Intergenic
1019659582 7:2216604-2216626 TCAGTGTCACGCAGAGTCCACGG - Intronic
1019726338 7:2604956-2604978 TCAGAGCCACCCAGCGTGCCAGG + Exonic
1022036403 7:26538487-26538509 TCAGTGCCAGGCAGAGGGCAGGG + Exonic
1022385331 7:29893520-29893542 TCAGTCCCTCCCAGACAGCCAGG + Intronic
1022966783 7:35481557-35481579 TCAGTGCCGAGCACAGTGCCTGG + Intergenic
1024119769 7:46225130-46225152 ACAGTGCTTAGCAGAGAGCCTGG - Intergenic
1024697163 7:51869532-51869554 TCTGGGCCAGGCAGAGAGCAGGG + Intergenic
1024710345 7:52008589-52008611 TCATTGTCACACAGACAGCCTGG + Intergenic
1025017058 7:55448565-55448587 TCAGCTCCACGCAGTCAGCCAGG + Intronic
1026033907 7:66817399-66817421 ACAGTGCCAGGCACAGAGCTGGG + Intergenic
1026985684 7:74553957-74553979 ACAGTGCCAGGCACAGAGCTGGG - Intronic
1027192067 7:76002494-76002516 TCAGTGCTACCCAGGGAGGCAGG + Intronic
1029034329 7:97503110-97503132 TCAATGCCAAGCACAGTGCCTGG + Intergenic
1029620835 7:101688847-101688869 TGAGTGCCAGGCAGAAGGCCTGG + Intergenic
1030346729 7:108442213-108442235 TCAGTGCAGGGCAGAGAGCCCGG + Intronic
1031051650 7:116951408-116951430 TCAGTGACTCGCAGAGAATCTGG + Intergenic
1031594717 7:123636570-123636592 TCTGTGCCAGGAAGAGAGTCTGG - Intronic
1034306625 7:150048932-150048954 GCTGCGCCCCGCAGAGAGCCCGG + Intergenic
1034468892 7:151245497-151245519 GCAGAGCCAGGCACAGAGCCAGG - Exonic
1035099699 7:156386367-156386389 TCAGAGGCACGCAGAAGGCCAGG + Intergenic
1035260554 7:157659157-157659179 TGAGTCCGAAGCAGAGAGCCCGG - Intronic
1035626698 8:1076341-1076363 TCACTGCCACGTAGTGAGCTGGG - Intergenic
1039828709 8:41195704-41195726 ACAGTGCCCAGCAGAGTGCCTGG - Intergenic
1039935887 8:42044748-42044770 TCTGTTCCAAGCAGAGTGCCTGG + Intronic
1039976508 8:42371049-42371071 TCAGTGCCACAAAGGGAACCTGG - Intronic
1041310436 8:56510918-56510940 TTAGGACCACACAGAGAGCCTGG + Intergenic
1042793034 8:72629757-72629779 TCAGTGCCTAGCACAGAGCCTGG - Intronic
1043473244 8:80581683-80581705 TCAGTCCCACTCAGAGCCCCAGG - Intergenic
1045977522 8:108146569-108146591 TCAGAACCATGCAGAGTGCCAGG + Intergenic
1047447324 8:124930977-124930999 CTAGTGCTACGCAGAGTGCCTGG + Intergenic
1047494479 8:125399751-125399773 TCAGTGCCTAGCACAGTGCCTGG + Intergenic
1048002186 8:130387849-130387871 CCAGTGCCAGGCACAGAGTCTGG - Intronic
1048049710 8:130805763-130805785 TCAGTGGCTGGCAGGGAGCCTGG + Intronic
1048130046 8:131685891-131685913 TCAGTGCCTAGCACAGAGCCTGG - Intergenic
1048203428 8:132396056-132396078 GCAGTGCTAGGCAGAGAGACTGG - Intronic
1048564784 8:135584153-135584175 TCAGTGCCTGGAAGAGTGCCAGG - Intronic
1048791145 8:138104913-138104935 ACAGAGCCAAGCAGAGAGCCTGG + Intergenic
1049185653 8:141251293-141251315 TCAGTTCCACGAACACAGCCAGG + Intronic
1049192683 8:141297280-141297302 GCATTGCCAGGCAGAGTGCCCGG - Intronic
1049264067 8:141657462-141657484 TCAGGGCCACACATACAGCCTGG + Intergenic
1049284441 8:141767029-141767051 TCAGTGCCACCCTGGCAGCCTGG + Intergenic
1049433514 8:142575965-142575987 TGAGTGCCGCTCAGAGAGGCAGG - Intergenic
1052914670 9:33915692-33915714 TCAGTGCCTAGCACATAGCCTGG - Intronic
1053306014 9:36985493-36985515 TCAGTGCCCAGCATAGGGCCTGG - Intronic
1053479749 9:38407353-38407375 TCAGGGTCACACAGCGAGCCGGG + Intergenic
1055989576 9:82091270-82091292 TATGTGCCAGGCAGTGAGCCAGG + Intergenic
1057514563 9:95710574-95710596 TCAGTGACACTCAGAGCTCCAGG + Intergenic
1057534535 9:95886633-95886655 TCAGTGCCAATCACAGTGCCTGG - Intronic
1057892381 9:98879251-98879273 ACAGTGCCTGGCAGAAAGCCTGG - Intergenic
1058428863 9:104900345-104900367 TCAGAGCCCAGCACAGAGCCTGG - Intronic
1059076258 9:111196936-111196958 TCAGTCACACACAGAGACCCAGG + Intergenic
1059263711 9:113005831-113005853 TCAGTGCCACCCACAGAACCTGG + Intergenic
1060230717 9:121823160-121823182 TCAGAGACACGGAGAGAGCTGGG + Intronic
1060250165 9:121979994-121980016 TCAGTGCCAAGAACAGTGCCTGG - Intronic
1060600285 9:124872729-124872751 TCAGAGCCAAGCAGGGAGCTGGG + Intronic
1062014005 9:134282275-134282297 TCAGGAGCACGCAGGGAGCCAGG - Intergenic
1062640383 9:137515585-137515607 TCGGGGCCACGCAGGGAGCAGGG + Intronic
1185659913 X:1719546-1719568 TCAGGGCCACGCAGGGTACCAGG + Intergenic
1187494717 X:19785063-19785085 CCAGTGCCAAGCACAGTGCCAGG + Intronic
1189163227 X:38832605-38832627 TAAGTGCCAAGCATAGTGCCTGG + Intergenic
1197424125 X:126273551-126273573 TCAGTCCCACTGAGAGAACCTGG + Intergenic
1197521406 X:127502287-127502309 TCAGTGACAGGCAGAGATCAAGG - Intergenic