ID: 1161217758

View in Genome Browser
Species Human (GRCh38)
Location 19:3102976-3102998
Sequence CAGTGCACACACCGGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 149}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161217758_1161217768 5 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217768 19:3103004-3103026 GCCTCCCCGCAGCCTGGTGGGGG 0: 1
1: 0
2: 4
3: 24
4: 310
1161217758_1161217763 -1 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217763 19:3102998-3103020 GGCCTGGCCTCCCCGCAGCCTGG 0: 1
1: 1
2: 10
3: 72
4: 470
1161217758_1161217767 4 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217767 19:3103003-3103025 GGCCTCCCCGCAGCCTGGTGGGG 0: 1
1: 0
2: 5
3: 24
4: 272
1161217758_1161217766 3 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217766 19:3103002-3103024 TGGCCTCCCCGCAGCCTGGTGGG 0: 1
1: 1
2: 2
3: 17
4: 196
1161217758_1161217775 21 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217775 19:3103020-3103042 GTGGGGGCTTCCTGGCTTCTCGG 0: 1
1: 1
2: 2
3: 25
4: 285
1161217758_1161217773 13 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217773 19:3103012-3103034 GCAGCCTGGTGGGGGCTTCCTGG 0: 1
1: 2
2: 1
3: 67
4: 497
1161217758_1161217765 2 Left 1161217758 19:3102976-3102998 CCTTGCTCCCGGTGTGTGCACTG 0: 1
1: 0
2: 0
3: 17
4: 149
Right 1161217765 19:3103001-3103023 CTGGCCTCCCCGCAGCCTGGTGG 0: 1
1: 1
2: 5
3: 65
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161217758 Original CRISPR CAGTGCACACACCGGGAGCA AGG (reversed) Intronic
900439240 1:2645118-2645140 CAGGCCTCACACAGGGAGCAGGG + Intronic
901878321 1:12179611-12179633 CTGTGAACACACTGTGAGCAGGG - Intronic
902359422 1:15934222-15934244 CAGGGCATTCACCGGGACCAGGG - Exonic
903840213 1:26233783-26233805 CAGTTCTCACACCTGAAGCAGGG - Intergenic
907119736 1:51998009-51998031 CAGGGCACACACTGTCAGCAGGG + Intergenic
908783561 1:67713513-67713535 CAGAGCACACTCTGGGAGGAAGG + Intronic
911884019 1:103274638-103274660 CTGAGCACACACCTTGAGCAGGG + Intergenic
914717226 1:150263137-150263159 CAGAGCACACTCTGGTAGCAAGG - Exonic
915347062 1:155202903-155202925 CAGTCCACACCTCGGAAGCAGGG + Exonic
916460959 1:165023771-165023793 CAGTGCACACACACGAAGTAGGG + Intergenic
917592820 1:176494732-176494754 CTCTGCACACACTGGGAGCTGGG + Intronic
918983791 1:191596674-191596696 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
920069513 1:203292153-203292175 CAGTTTACCCACTGGGAGCATGG - Intergenic
924780287 1:247141296-247141318 CACTGCAGACAGCGGTAGCAAGG + Intronic
1067348808 10:45457134-45457156 CAGTGCACACACCCCGGCCAGGG + Exonic
1071882809 10:89917983-89918005 CAGTGCCCACACCGAGGGGATGG + Intergenic
1073642917 10:105271096-105271118 CATTGCACACGCAGTGAGCATGG - Intergenic
1075645924 10:124096117-124096139 GAGTGCACACACGGGAAGCGGGG - Intergenic
1075929995 10:126287924-126287946 CAGTCCCCACACCCGGAGCAGGG + Intronic
1076259745 10:129055886-129055908 CAGTGAACACAGCGGCAGGAGGG + Intergenic
1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG + Intronic
1077799202 11:5521609-5521631 CTGTGCACTCACCGGGGGGAGGG + Intronic
1078068454 11:8093262-8093284 CAGTGCAGGCAGCAGGAGCAAGG + Intronic
1080124909 11:28721539-28721561 CTGTGCACACACGGGAGGCAGGG + Intergenic
1083170801 11:60923106-60923128 CAGTGCCCACCCCGGCAGCCCGG + Exonic
1084403713 11:68959414-68959436 CCCTGCACACAGCGGGAGCAGGG + Intergenic
1090418211 11:126555568-126555590 CAGGGTAGACACAGGGAGCAGGG + Intronic
1091347962 11:134867959-134867981 CAGAGCCCACACAGGGAGCATGG + Intergenic
1096102045 12:48975711-48975733 CATTCCACACACCAGGAGTAGGG - Intergenic
1097248622 12:57620366-57620388 GAGTCCAAACACCGGGGGCACGG - Exonic
1099322102 12:81162910-81162932 CAGAGCAGGCACCAGGAGCAGGG + Intronic
1099738455 12:86600903-86600925 CAGAGCAGGCACTGGGAGCAGGG - Intronic
1101434694 12:104654672-104654694 CTGTCCACTCACCAGGAGCAAGG + Intronic
1103331353 12:120156449-120156471 CTGAGCACACACCCGGAGCACGG + Exonic
1103428697 12:120862643-120862665 CAGTGCACCCACCGAAGGCATGG - Intronic
1103850211 12:123928188-123928210 CAGTGCACCCACGGGGCCCATGG + Exonic
1105210117 13:18252648-18252670 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1106860538 13:33902811-33902833 CACTGGACACCCCTGGAGCAAGG - Intronic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1113090176 13:106609846-106609868 CAGTTCACACACAGGGAGCTTGG - Intergenic
1118947096 14:70398584-70398606 CAGAGCAGGCACTGGGAGCAGGG + Intronic
1119385233 14:74254038-74254060 CAGTCCACTCACAGGGAGTATGG + Intronic
1119851189 14:77867742-77867764 CAGGACACAGGCCGGGAGCAGGG - Intronic
1121711436 14:96041650-96041672 CACAGGACACACCAGGAGCAGGG - Intronic
1122550745 14:102548104-102548126 CGGTGCAAACACCGAGGGCAGGG + Intergenic
1123983167 15:25621987-25622009 GAGTGGAAACACCGGGGGCATGG - Intergenic
1128240933 15:66100440-66100462 CAGAGAACAGACCGGGAGCCAGG + Intronic
1130379641 15:83360377-83360399 CAATGCCCACCCCGGGAGCTGGG - Intergenic
1131522483 15:93126900-93126922 CAGTGGACACAGCTGGAGCAGGG + Intergenic
1132977550 16:2718141-2718163 CAGTGCTCAGGCAGGGAGCATGG - Intronic
1135112289 16:19699627-19699649 CTGTGCAGACACCAGGACCATGG + Exonic
1137272579 16:46912016-46912038 CAGTGAAGACCCCGGGAGCAAGG - Intronic
1140174908 16:72648711-72648733 CAGTGCACACTTAGGGAGAAGGG - Intergenic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1140815160 16:78614491-78614513 CAGGACACACACCGTGAACAGGG - Intronic
1140880585 16:79194627-79194649 CAGTTCACACAAGGGGAGCCTGG - Intronic
1141805906 16:86341343-86341365 CTGTGGACACACAGGGAGCGCGG + Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1149994198 17:61398398-61398420 CACTGCGCACACCGGTCGCAGGG - Intergenic
1156244502 18:35284612-35284634 CAGAGCAGTCACCAGGAGCAGGG + Intronic
1158427815 18:57354123-57354145 CAGGGCGCACGCCGGGCGCAGGG - Intronic
1160946631 19:1646892-1646914 CAGTGCACACACAGGAAACGAGG - Intronic
1161217758 19:3102976-3102998 CAGTGCACACACCGGGAGCAAGG - Intronic
1161325553 19:3662049-3662071 CGGTGCACACAGGGGGTGCAGGG - Intronic
1163395888 19:17061090-17061112 CAGGGCACAGACTGGGAGCCTGG + Intronic
1165312769 19:35038995-35039017 CAGTGCATACACCAGGCCCAGGG + Intronic
1166139411 19:40798137-40798159 CAGGGCACACACAGGGTTCATGG - Intronic
1166628763 19:44386524-44386546 CAGTACACACACTGTGAGCGTGG - Exonic
925193951 2:1908382-1908404 CAGTGCAGCCCCCGGGAGCAGGG + Intronic
925193967 2:1908434-1908456 CAGAGCAGTCCCCGGGAGCAGGG + Intronic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
933977865 2:87526394-87526416 AAGTGCTCACACACGGAGCAGGG - Intergenic
934085273 2:88504144-88504166 CCGTGAACCCACCGGGAGAAAGG + Intergenic
934696613 2:96404845-96404867 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
935795277 2:106634917-106634939 CAGACCACACACAGGGAGGAAGG + Intergenic
936315964 2:111424413-111424435 AAGTGCTCACACACGGAGCAGGG + Intergenic
937254612 2:120546368-120546390 CAGTGCAGACATCTGGAGCCAGG - Intergenic
938544856 2:132318662-132318684 CAGTACACACATTGTGAGCATGG + Intergenic
941440842 2:165533505-165533527 CAGGGCACACAATGTGAGCATGG - Intronic
942326255 2:174779294-174779316 CATGGCACACACCTGGAGGAAGG - Intergenic
943345736 2:186734920-186734942 CAGGGCTGGCACCGGGAGCAGGG + Intronic
945186231 2:207142702-207142724 AAGTGCACACAGTGTGAGCAAGG + Intronic
945444302 2:209917780-209917802 CACTGCACACAGCAGGAACATGG - Exonic
948425760 2:237885840-237885862 CAGAGCACACCCCAGGGGCACGG + Intronic
948708296 2:239809471-239809493 CAGCGCCCACACAGGGAGGAGGG - Intergenic
1170298577 20:14856736-14856758 CAGTCCTCACACCAGCAGCATGG - Intronic
1171873714 20:30551396-30551418 CAGTACACACATTGTGAGCATGG + Intergenic
1172361050 20:34312662-34312684 CAGTCCACAGAAAGGGAGCACGG + Intergenic
1173248525 20:41352352-41352374 CAGTCCACACTCCGCCAGCAGGG + Intronic
1173648637 20:44649500-44649522 CAGTGTCCACACCTGGAGGATGG - Intronic
1175726565 20:61322539-61322561 CACTGCACACACCAGGACCCAGG - Intronic
1176104495 20:63379545-63379567 CAGAGCAGGCACTGGGAGCAGGG - Intergenic
1176164970 20:63668049-63668071 CTGGGCACACACTGGGAGGAGGG - Intronic
1176165004 20:63668151-63668173 CCGGGCACACACTGGGAGGAGGG - Intronic
1178000338 21:28154967-28154989 TCGTGGACACACAGGGAGCAGGG - Intergenic
1178438257 21:32578312-32578334 CAGTGCAGAAGCAGGGAGCACGG + Intronic
1178876257 21:36416395-36416417 CCCTGCACACACCGGGAGCCTGG - Exonic
1179546762 21:42117719-42117741 GAATGCACAAACCAGGAGCAGGG - Intronic
1179712830 21:43272974-43272996 CAGTGAACATCCAGGGAGCAGGG - Intergenic
1179984014 21:44911368-44911390 GAGTGCACACACCGGGTGTGTGG - Intronic
1180766140 22:18346756-18346778 CAGTTCCAACACCTGGAGCAGGG + Intergenic
1180780173 22:18515622-18515644 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1180812889 22:18772943-18772965 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181056379 22:20262315-20262337 CAGTGCACAGGCCGGGCACACGG + Intronic
1181199067 22:21207259-21207281 CAGTTCCAACACCTGGAGCAGGG - Intergenic
1181235607 22:21446119-21446141 CAGTGCGCAGAGCGGGAGCGAGG + Exonic
1182318341 22:29462690-29462712 CACTGCAGACAGTGGGAGCATGG - Intergenic
1183086976 22:35492339-35492361 CAGAGAATACACCTGGAGCAGGG - Intergenic
1184864695 22:47195659-47195681 GGGTGCACACACCAGGAGGACGG - Intergenic
1203227758 22_KI270731v1_random:87647-87669 CAGTTCCAACACCTGGAGCAGGG + Intergenic
954438013 3:50506109-50506131 CTGTGCAAACCCCGGGAGCTGGG - Intergenic
961107174 3:124251891-124251913 CATTGCAAACACCTGGAACAGGG - Intronic
961156267 3:124682425-124682447 GAGTGAACACACAGGGTGCATGG - Intronic
968065139 3:195754278-195754300 CAGTGGACACTCGGGAAGCACGG + Exonic
968143043 3:196274143-196274165 CAGAGCAGGCACCAGGAGCAAGG + Intronic
969594853 4:8143129-8143151 CAGTGCCCATACTGGGAGCGGGG + Intronic
970672661 4:18414463-18414485 CAGTGCACTCACGGGAAGTAGGG - Intergenic
974818174 4:67032980-67033002 CAGTGCACACACCAGGGGCTCGG + Intergenic
981927233 4:150153373-150153395 CAGTGCACAAATAGGGATCAAGG - Intronic
983630884 4:169848213-169848235 CAGAGCAAACAACGGGAACAGGG - Intergenic
985034854 4:185828381-185828403 CAATGCACACTCTGGGAGCTGGG + Intronic
986150864 5:5129527-5129549 CAGTGCATTCAAGGGGAGCAGGG + Intergenic
986269318 5:6217492-6217514 CAGTGCATACAGCGGGTGCATGG - Intergenic
990025571 5:51183486-51183508 CAATCCACACACTGGGGGCAGGG + Intergenic
992582737 5:78198445-78198467 CTGTCCACACACCAGGAGGAGGG - Intronic
992772537 5:80061707-80061729 CAGTGCACGCCCGGGTAGCAGGG - Exonic
994672012 5:102773593-102773615 CAGTGCAGAAACAGTGAGCAGGG + Intronic
994726669 5:103444358-103444380 CAGTGGACATACCAGGAACAGGG - Intergenic
997590669 5:135070224-135070246 CAGTCCAAAGACCAGGAGCAGGG - Intronic
1000351822 5:160358322-160358344 CAGGGCACAAGCTGGGAGCAGGG - Intronic
1002104521 5:176873526-176873548 CAGTGCCTAGACCAGGAGCAGGG - Intronic
1002569365 5:180131298-180131320 CAGAGCACAGAAGGGGAGCAAGG - Intronic
1003644645 6:7904712-7904734 CAGTGTCCACACCTGGAACAAGG + Exonic
1004678355 6:17866497-17866519 CAGTGCTCTCATAGGGAGCAGGG + Intronic
1004902149 6:20204786-20204808 CAGTGCAGCAACCAGGAGCACGG + Intronic
1005781855 6:29201247-29201269 CAGAGCACGCACCAGGAGCAGGG - Intergenic
1006294508 6:33164168-33164190 CAGGGCACCCAGGGGGAGCAGGG - Intronic
1006397870 6:33798752-33798774 CTGTGCAAACAGCTGGAGCAAGG - Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009973004 6:70644764-70644786 TAGGGCACACCCCTGGAGCAGGG + Intergenic
1015601643 6:134916362-134916384 CTGTCCAGGCACCGGGAGCAAGG + Intergenic
1016417298 6:143846176-143846198 CAGTGCACACAACAGGAGAGAGG + Exonic
1022423533 7:30246336-30246358 CAGAGCAGGCACTGGGAGCAGGG + Intergenic
1022589865 7:31651303-31651325 CAGCCCACACACCTGGAGCAAGG + Intronic
1023996461 7:45161826-45161848 CAGTGCCCACACCTGCAGCCTGG - Intronic
1025813275 7:64888782-64888804 CAGTGCACTTCCCGGCAGCATGG - Intronic
1028035214 7:85972842-85972864 CAGAGCAGGCACCAGGAGCAAGG + Intergenic
1028946660 7:96587548-96587570 CTGTGCACCAACCGGAAGCAAGG - Intronic
1031887314 7:127255066-127255088 CATTGCTCAGACCGGGATCATGG - Intergenic
1038417188 8:27405596-27405618 CAGAGCACACACAGGAAACAGGG - Intronic
1040547094 8:48407204-48407226 CAGTGTCCACACTGGGAGTAGGG - Intergenic
1041604202 8:59761336-59761358 CCGTGAACCCACCGGGAGGAAGG - Intergenic
1049612546 8:143562197-143562219 CCGTGCCCACAGCTGGAGCAGGG + Exonic
1049699731 8:144004826-144004848 CAAGGCACAGACTGGGAGCAGGG + Intronic
1049714233 8:144082414-144082436 CAGTGCACCCCCCGGGAGGGAGG - Intergenic
1056126155 9:83538037-83538059 CGGGGCACACGCCGGGAGCAGGG - Intronic
1056655367 9:88504289-88504311 CACACCACACACCAGGAGCAGGG - Intergenic
1056667090 9:88589641-88589663 CTGTGCACACACAGGGTACAGGG + Intergenic
1056755947 9:89382207-89382229 CAGTGCACCCACCTGAAGCTCGG + Intronic
1057037795 9:91824438-91824460 ATGTGCACACGCCGGGGGCAGGG + Intronic
1057044005 9:91870363-91870385 CAGGGTACACACCGGGATCAGGG + Intronic
1057613495 9:96567379-96567401 CAGTGCGCCCTCCCGGAGCAGGG + Intronic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1062369629 9:136231205-136231227 CATAGCACACACCTCGAGCATGG + Intronic
1062567245 9:137168709-137168731 CACTGCATACACCGGGAGGTGGG - Exonic
1062672981 9:137722756-137722778 CAGAGCACACTCCGGGTGCAGGG - Intronic
1192066427 X:67890031-67890053 CATTGCTCACACTGGGAGCTGGG + Intergenic