ID: 1161218348

View in Genome Browser
Species Human (GRCh38)
Location 19:3105933-3105955
Sequence CTGTGGACGAGTCCAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 175}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161218342_1161218348 2 Left 1161218342 19:3105908-3105930 CCGGGAGATGAGGGCCGGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1161218348 19:3105933-3105955 CTGTGGACGAGTCCAGAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 175
1161218337_1161218348 19 Left 1161218337 19:3105891-3105913 CCTGCAGTGGCCTGAGACCGGGA 0: 1
1: 1
2: 0
3: 27
4: 151
Right 1161218348 19:3105933-3105955 CTGTGGACGAGTCCAGAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 175
1161218335_1161218348 20 Left 1161218335 19:3105890-3105912 CCCTGCAGTGGCCTGAGACCGGG 0: 1
1: 1
2: 0
3: 16
4: 163
Right 1161218348 19:3105933-3105955 CTGTGGACGAGTCCAGAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 175
1161218340_1161218348 9 Left 1161218340 19:3105901-3105923 CCTGAGACCGGGAGATGAGGGCC 0: 1
1: 0
2: 2
3: 16
4: 204
Right 1161218348 19:3105933-3105955 CTGTGGACGAGTCCAGAGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161218348 Original CRISPR CTGTGGACGAGTCCAGAGTG AGG Intronic
900352992 1:2245831-2245853 CTGTTGCCCAGGCCAGAGTGCGG + Intronic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
902513901 1:16979975-16979997 CTGTGGAAGAGGCCAGAGGTGGG - Intronic
903630139 1:24762448-24762470 GTGTGGATGAGTAAAGAGTGAGG + Intronic
904956789 1:34291322-34291344 CTGTGGAAGATACCAAAGTGTGG - Intergenic
905520723 1:38597512-38597534 CTGTTGCCCAGTCTAGAGTGCGG + Intergenic
905738310 1:40347078-40347100 CTGTTGCCCAGGCCAGAGTGCGG + Intronic
906104642 1:43284585-43284607 CTGTGGAAGAGACCAGAGGTGGG - Intronic
909969716 1:81967296-81967318 CTGTTGCCCAGTCTAGAGTGCGG + Intronic
912871844 1:113313914-113313936 CTGTTGCCCAGTCTAGAGTGTGG - Intergenic
915267655 1:154730596-154730618 CTGTGGCTGACCCCAGAGTGAGG + Intronic
916437619 1:164791521-164791543 CTGTGGACTAGCAGAGAGTGAGG - Intronic
921310752 1:213840830-213840852 CTGTGGAAGAGTTCAGGGAGAGG + Intergenic
1068329730 10:55547268-55547290 CTATGCACAAGTTCAGAGTGTGG + Intronic
1070640668 10:78166570-78166592 CTGGGGTTTAGTCCAGAGTGTGG + Intergenic
1070656942 10:78278170-78278192 CTGTGGAGCAGGCCAGAGAGTGG - Intergenic
1071510543 10:86259799-86259821 CTATGGAAGAGGTCAGAGTGTGG - Intronic
1072351358 10:94560658-94560680 CTGTGGCCCAGACTAGAGTGCGG - Intronic
1073809846 10:107141002-107141024 CTGTGAAGGACTTCAGAGTGTGG - Intronic
1076866056 10:133166967-133166989 CTCTGCACGAGTCCACAGTTGGG + Intronic
1076993265 11:286625-286647 CTGTGGCCCAGGCCAGAGTGTGG - Intergenic
1077412346 11:2409513-2409535 CTCGGCACGAGTGCAGAGTGGGG + Intronic
1077767391 11:5175086-5175108 CTGTGGTCCAGGCTAGAGTGAGG + Intronic
1079401199 11:20107694-20107716 ATGTGGACGGCTCGAGAGTGTGG + Exonic
1080593095 11:33740508-33740530 CTGTGGCCCAGGCTAGAGTGCGG - Intergenic
1080822951 11:35824511-35824533 CTGTCCACTTGTCCAGAGTGGGG + Intergenic
1081914114 11:46719906-46719928 CTGTGGAAGTGTCTAGAGTTGGG - Intronic
1084218139 11:67662680-67662702 CTGTGGGTGAGTGCAGGGTGCGG + Exonic
1084883715 11:72189887-72189909 CTGAGGCCCAGACCAGAGTGTGG + Intronic
1088480285 11:110290473-110290495 CTGTTGCCCAGGCCAGAGTGCGG - Intronic
1089576667 11:119449203-119449225 CTGTTGCCCAGGCCAGAGTGCGG + Intergenic
1090804410 11:130194026-130194048 CTGTGGATGGGACCAGAGTTAGG + Intronic
1091430221 12:427509-427531 CTGTCGCCCAGGCCAGAGTGCGG + Intronic
1092038672 12:5363904-5363926 CTGTGGGAGAGGCCAGAGTTTGG + Intergenic
1093013312 12:14130871-14130893 CTGTGAACCAGGCCAGGGTGAGG - Intergenic
1093378262 12:18457812-18457834 CTGTGCATGAATCTAGAGTGGGG + Intronic
1095466980 12:42497890-42497912 CTGCGGTCGTGTCCAGGGTGGGG - Intronic
1097081518 12:56434698-56434720 CTGTTGCCCAGGCCAGAGTGTGG - Intronic
1099227206 12:79983563-79983585 GTGTGGACCAGACCTGAGTGTGG - Intergenic
1099789408 12:87312539-87312561 GTGTGGAAGAGTGAAGAGTGGGG - Intergenic
1100458076 12:94772155-94772177 CTGTGGAGTGGTCCAGTGTGGGG - Intergenic
1100479826 12:94967248-94967270 CTGTGGCCCAGGCCAGAGTGCGG + Intronic
1102648805 12:114421741-114421763 GTGTGGATGAGGCCAGAGTCGGG + Intergenic
1103588628 12:121974521-121974543 GTGGGGAAGTGTCCAGAGTGTGG - Intronic
1103598002 12:122035875-122035897 CTGTTGACCAGGCCAGAGTGCGG + Intronic
1107867893 13:44721248-44721270 CTGTGGCCCAGGCTAGAGTGCGG + Intergenic
1109652875 13:65352891-65352913 CTGGGGACCAGTCCAGAGCCTGG - Intergenic
1110570754 13:77000346-77000368 CTGTTGCCGAGGCTAGAGTGCGG - Intronic
1111420389 13:88003528-88003550 CTGTCGCCGAGGCTAGAGTGCGG + Intergenic
1113093081 13:106635444-106635466 GTGTGGACCAGGCCACAGTGTGG + Intergenic
1113591819 13:111506747-111506769 CTGAGGAGGACTCCAGTGTGTGG + Intergenic
1114596645 14:23917901-23917923 TTCTGGGAGAGTCCAGAGTGTGG - Intergenic
1114602478 14:23967818-23967840 GTCTGGACGAGTACAGAGTTAGG - Intronic
1114606847 14:24004944-24004966 GTCTGGACGAGTACAGAGTTAGG - Intronic
1115512165 14:34148295-34148317 CAGTGTAAGAGTCCAGTGTGGGG - Intronic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1120215696 14:81679266-81679288 CTGTGCAGGAGCCCACAGTGGGG + Intergenic
1120715203 14:87834088-87834110 CTGTGGACCAGTTCTAAGTGGGG + Intergenic
1120966246 14:90170248-90170270 CTGTTGCCCAGGCCAGAGTGCGG + Intronic
1121011988 14:90525147-90525169 ATGTGGACTAATCTAGAGTGAGG - Exonic
1121351753 14:93179022-93179044 CTGTCGCCTAGGCCAGAGTGCGG + Intergenic
1123201235 14:106666376-106666398 CTCTGGAGGTGTCCAGTGTGAGG - Intergenic
1125523277 15:40359707-40359729 CTCTGGAGAAGTCCAGAGAGGGG - Intronic
1126040147 15:44582509-44582531 CTGTCGCCCAGGCCAGAGTGTGG - Intronic
1126114041 15:45192829-45192851 CTATGGAAAAGTCCAGAATGTGG - Intronic
1126796396 15:52263542-52263564 GTGTGGATGAGGCCAGAGAGGGG - Intronic
1129247244 15:74286989-74287011 CTGGAGACCAGCCCAGAGTGAGG + Intronic
1130239368 15:82171704-82171726 CTGTGGACTACTAGAGAGTGGGG + Intronic
1131051921 15:89354041-89354063 CTGTGGAGGGCTTCAGAGTGTGG + Intergenic
1132041336 15:98526791-98526813 CTGTTGTCCAGGCCAGAGTGCGG + Intergenic
1132857625 16:2053951-2053973 CTGAGGACAAGGCCTGAGTGGGG - Intronic
1133443169 16:5837480-5837502 CTGTGGAGGAGGGCAGAGGGTGG - Intergenic
1134076607 16:11296347-11296369 CTGTGGAGGAGTCCAGGGTGGGG + Intronic
1134128137 16:11630320-11630342 CTGTGGCCAAGGCCAGACTGCGG - Intronic
1134659448 16:15972833-15972855 CTGTTGCCGAGGCTAGAGTGTGG + Intronic
1135625404 16:23990579-23990601 CTGTTGCCCAGGCCAGAGTGTGG + Intronic
1137584011 16:49653165-49653187 CAGGGGACGCCTCCAGAGTGGGG - Intronic
1139949616 16:70662719-70662741 CTGTGGACGAGGACTAAGTGTGG - Exonic
1143307349 17:5958044-5958066 CTGTGGAGGAGCTCAGGGTGGGG - Intronic
1144534222 17:16071240-16071262 CTGTGGACCAGGCTGGAGTGCGG - Intronic
1145879166 17:28341381-28341403 CTGTGAAGGAGTTCAGAGTGAGG - Intronic
1147028199 17:37607917-37607939 CTGTTGCCCAGGCCAGAGTGCGG - Intronic
1147870118 17:43581352-43581374 CTGTGGAGGAGGCCAAAGAGTGG - Intergenic
1148701795 17:49591866-49591888 CTGAGGAGGAGTGTAGAGTGAGG - Intergenic
1148779417 17:50113049-50113071 CTGGGGAGGAGTCCGGGGTGAGG + Intronic
1149641925 17:58208400-58208422 CTGGGGAGGATTCCAGAGTTGGG - Intronic
1151799301 17:76368329-76368351 GTATGGTCGAGTCCAGAGTATGG + Intronic
1152201197 17:78947389-78947411 CTGCGGCCGAGGGCAGAGTGGGG + Intergenic
1157415981 18:47503452-47503474 CTGTGGCCAAGCACAGAGTGAGG + Intergenic
1161218348 19:3105933-3105955 CTGTGGACGAGTCCAGAGTGAGG + Intronic
1161406822 19:4095450-4095472 CTGTGGAGGAGAACAGAGGGTGG + Intronic
1161838712 19:6665443-6665465 CTGTGGACCAGGCTGGAGTGTGG + Intronic
1163861299 19:19744305-19744327 CTGTGGACGACTGCCGTGTGGGG + Intergenic
1167047834 19:47061472-47061494 CTGTTGTCCAGGCCAGAGTGTGG + Intergenic
1167508211 19:49882219-49882241 CTGGGGACGAGGCCAAAGGGAGG - Intronic
925007726 2:457266-457288 CTGTGGAGCAGTCCAGAGGAGGG + Intergenic
925845246 2:8028291-8028313 CGGGGGACCAGCCCAGAGTGGGG - Intergenic
925845259 2:8028323-8028345 CGGGGGACCAGCCCAGAGTGGGG - Intergenic
926147230 2:10404249-10404271 CTGGGGAGGAGGCCAGAGTCTGG - Intronic
928430768 2:31216739-31216761 CTCTGGAGGACTCCAGAGCGAGG - Intronic
928733801 2:34262078-34262100 CTGAGTACCAGTCCAGAGTTGGG + Intergenic
930335856 2:50044456-50044478 ATGTGGATAATTCCAGAGTGAGG + Intronic
933252491 2:80044627-80044649 CTGAAGGAGAGTCCAGAGTGGGG - Intronic
934056853 2:88258446-88258468 CTGTGAACAAGTCCAGAGCCTGG - Intergenic
936500452 2:113062268-113062290 CTGTGGCTGAGTCCCCAGTGAGG - Intronic
938686752 2:133745641-133745663 ATGAGGAGGACTCCAGAGTGTGG + Intergenic
939708360 2:145483282-145483304 CTGTCGCCCAGGCCAGAGTGCGG + Intergenic
943655104 2:190500149-190500171 CTGTGCACGGGTCCACACTGGGG - Exonic
943736454 2:191361173-191361195 CTTTGGCCAAGTCCAGACTGAGG - Intronic
945439187 2:209858655-209858677 CTGTGGCCGAGACCAGGGTGCGG - Intronic
947930947 2:233964752-233964774 CTGTTGGTGAGTCCACAGTGTGG + Exonic
1169172007 20:3472299-3472321 CTGTGGACAAGGCCAAAGTCTGG - Intronic
1173548669 20:43917033-43917055 CTGAGGATGTGTCCAGAGTGGGG + Intronic
1174557613 20:51407004-51407026 CTGTGGACTAGGGGAGAGTGAGG - Intronic
1175959182 20:62626419-62626441 CAGTGGATGAGGCAAGAGTGTGG - Intergenic
1177858388 21:26424900-26424922 CTGTGGAAGAGTTCTGTGTGAGG + Intergenic
1178560441 21:33634454-33634476 CTGGGGATGATTCCAGAGAGGGG - Intronic
1180227170 21:46401306-46401328 CTGTGCCCGAGTCCACTGTGAGG - Intronic
1181414854 22:22751838-22751860 CTGTGGACAAGGCCATACTGGGG + Intronic
1183395212 22:37567555-37567577 CTGTGGACCAGTCCTCAGTGCGG - Intronic
1184994252 22:48193241-48193263 GGGTGCAGGAGTCCAGAGTGGGG + Intergenic
949328648 3:2895994-2896016 CTGTCGCCCAGACCAGAGTGCGG - Intronic
950273074 3:11634712-11634734 CTGTTGCCCAGGCCAGAGTGCGG + Intronic
950846133 3:16017719-16017741 CTGTGGACCACTGAAGAGTGAGG - Intergenic
954135737 3:48581341-48581363 CTGTGGAGGAGGCAAGAGGGAGG + Intronic
957512541 3:81208058-81208080 CTGTGGAGGAGTCCAATGAGGGG + Intergenic
961234346 3:125351340-125351362 CTGTGGCCCAGGCCGGAGTGCGG - Intronic
968566670 4:1316976-1316998 CTGGGGGTGAGTCTAGAGTGTGG - Intronic
968566789 4:1317329-1317351 CTGCAGATGAGTCCAGAGTGTGG - Intronic
968566794 4:1317355-1317377 CTGCAGATGAGTCCGGAGTGTGG - Intronic
968566800 4:1317381-1317403 CTGCGGGTGAGTCCGGAGTGTGG - Intronic
968706021 4:2078113-2078135 CTGTGGACTCATCCTGAGTGTGG + Intronic
969578853 4:8052244-8052266 CTGTGGAAGGGACCTGAGTGAGG - Intronic
969583804 4:8080592-8080614 CTGGGGACACGTGCAGAGTGTGG + Intronic
972786390 4:42330334-42330356 CTGTGGACAGGTCCAGAGATGGG - Intergenic
973197356 4:47461734-47461756 GTGAGGATCAGTCCAGAGTGTGG - Intronic
976776809 4:88715776-88715798 CTGTTGACCAGGCTAGAGTGCGG - Intergenic
976907947 4:90263302-90263324 CCCAGTACGAGTCCAGAGTGTGG - Intronic
977089997 4:92660172-92660194 ATGTGGAAGAGGCCAGAGTTGGG + Intronic
977769782 4:100844683-100844705 CTGTGGACTACTAGAGAGTGGGG + Intronic
980562124 4:134491032-134491054 CTGTGGTGGTGTGCAGAGTGGGG - Intergenic
980894799 4:138851765-138851787 CTGTGGAGGAGTGCTGAATGTGG + Intergenic
984745245 4:183209171-183209193 ATGTGAACAAGTTCAGAGTGTGG + Intronic
985554249 5:548500-548522 CTGGGGGCGAGTCCTGAGGGCGG + Intergenic
985934387 5:3084087-3084109 CTGACTACGTGTCCAGAGTGGGG - Intergenic
986019623 5:3789218-3789240 CTGGGTTCGAGTCCAGCGTGGGG + Intergenic
986828413 5:11547229-11547251 CTGTCGCCCAGGCCAGAGTGCGG - Intronic
989521270 5:42403468-42403490 CTGTAGAGGAGTCCAGTGTCAGG + Intergenic
997314893 5:132924215-132924237 CTGTTGCCCAGGCCAGAGTGCGG - Intronic
998070047 5:139190737-139190759 CTGTGGATGAGTGAAGAGTCAGG - Intronic
1002067329 5:176658408-176658430 CTCTGGACGAGCCCAGGGAGGGG - Exonic
1005692392 6:28320141-28320163 CTGTTGCCCAGGCCAGAGTGCGG - Intergenic
1007612845 6:43161384-43161406 GTGTGCACAAGCCCAGAGTGGGG - Intronic
1009664294 6:66655486-66655508 CTGTGCAGGAGCCCACAGTGAGG + Intergenic
1011402119 6:86974965-86974987 CTATGGATGAGTCCAGGTTGGGG - Intronic
1011425121 6:87219862-87219884 CTGTGGCCCAGGCTAGAGTGCGG + Intronic
1017093959 6:150787652-150787674 CTGTGGAACAGTCCAGAGCCAGG - Intronic
1017381880 6:153840696-153840718 CAGTGGAAGATTCCAGAGTGTGG + Intergenic
1017657007 6:156639484-156639506 CTGGTGACGAATCCAGAGCGTGG + Intergenic
1017820783 6:158047738-158047760 CTGTTGACCAGGCTAGAGTGTGG - Intronic
1019578521 7:1749062-1749084 CTGTGCCAGAGTTCAGAGTGGGG - Intergenic
1020234040 7:6341651-6341673 CTGTGGCCCAGGCTAGAGTGCGG - Intronic
1021063515 7:16143963-16143985 CTGTAGACGAATTCAGCGTGAGG - Intronic
1023829313 7:44029632-44029654 CTGTGGGGGAGGTCAGAGTGAGG + Intergenic
1024551818 7:50568382-50568404 CTGTGGGCTTGGCCAGAGTGTGG - Intergenic
1026776812 7:73235608-73235630 CTGTGGGCGGGGCCAGTGTGCGG + Intergenic
1027017661 7:74788978-74789000 CTGTGGGCGGGGCCAGTGTGCGG + Intronic
1027070361 7:75156954-75156976 CTGTGGGCGGGGCCAGTGTGCGG - Intergenic
1029739619 7:102483890-102483912 CTGTGGGGGAGGTCAGAGTGAGG + Intronic
1029757620 7:102583069-102583091 CTGTGGGGGAGGTCAGAGTGAGG + Intronic
1029775557 7:102682130-102682152 CTGTGGGGGAGGTCAGAGTGAGG + Intergenic
1030184931 7:106752239-106752261 CTCTGAACAGGTCCAGAGTGGGG - Intergenic
1034488467 7:151380750-151380772 CTGTGCACGAGCCCGGGGTGGGG + Intronic
1034991408 7:155550082-155550104 CTGTGGGCATGTGCAGAGTGTGG - Intergenic
1040030314 8:42817996-42818018 CTGTGGCCAAGGCTAGAGTGCGG + Intergenic
1040533767 8:48288118-48288140 CTGTGGGGGACTCCCGAGTGCGG + Intergenic
1040554651 8:48468103-48468125 CTGTGCACAAGGCCAGAGAGTGG + Intergenic
1049641184 8:143716709-143716731 CTGTGGACGCGTGGGGAGTGGGG - Intronic
1050849905 9:10271577-10271599 CTGTCGCCCAGACCAGAGTGCGG + Intronic
1051871035 9:21738002-21738024 CTGTTGACGAGGCTAGAGTGCGG + Intergenic
1056608470 9:88107526-88107548 CTGAGGACTTTTCCAGAGTGTGG - Intergenic
1057701894 9:97369494-97369516 CTGTGGCCCAGGCTAGAGTGTGG + Intronic
1059750343 9:117241707-117241729 CTGTGGACCAGTACAGTCTGTGG - Intronic
1061478532 9:130884896-130884918 CCGCCGAGGAGTCCAGAGTGAGG + Exonic
1185834661 X:3334016-3334038 CTGTTGTCCAGGCCAGAGTGTGG + Intronic
1200324418 X:155222877-155222899 CTGTTGCCCAGGCCAGAGTGCGG + Intronic
1201948766 Y:19540623-19540645 CTGTAGACGAGTACAAACTGAGG - Intergenic