ID: 1161224317

View in Genome Browser
Species Human (GRCh38)
Location 19:3136143-3136165
Sequence GCCCGACAGGTTGACGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 34}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161224317_1161224328 6 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224328 19:3136172-3136194 TGAGCAGGTCTGGAGGTGGGCGG 0: 2
1: 1
2: 5
3: 76
4: 563
1161224317_1161224330 8 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224330 19:3136174-3136196 AGCAGGTCTGGAGGTGGGCGGGG 0: 1
1: 1
2: 2
3: 55
4: 539
1161224317_1161224326 2 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224326 19:3136168-3136190 GGTCTGAGCAGGTCTGGAGGTGG 0: 1
1: 0
2: 4
3: 43
4: 400
1161224317_1161224327 3 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224327 19:3136169-3136191 GTCTGAGCAGGTCTGGAGGTGGG 0: 1
1: 0
2: 1
3: 31
4: 287
1161224317_1161224325 -1 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224325 19:3136165-3136187 CCGGGTCTGAGCAGGTCTGGAGG 0: 1
1: 0
2: 1
3: 10
4: 176
1161224317_1161224329 7 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224329 19:3136173-3136195 GAGCAGGTCTGGAGGTGGGCGGG 0: 1
1: 1
2: 8
3: 99
4: 617
1161224317_1161224331 16 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224331 19:3136182-3136204 TGGAGGTGGGCGGGGAGCCCTGG 0: 1
1: 0
2: 7
3: 87
4: 776
1161224317_1161224322 -9 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224322 19:3136157-3136179 CTGTCGGGCCGGGTCTGAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 78
1161224317_1161224323 -4 Left 1161224317 19:3136143-3136165 CCTTCACCGTCAACCTGTCGGGC 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1161224323 19:3136162-3136184 GGGCCGGGTCTGAGCAGGTCTGG 0: 1
1: 0
2: 2
3: 35
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161224317 Original CRISPR GCCCGACAGGTTGACGGTGA AGG (reversed) Intergenic
915034126 1:152908475-152908497 TCCCTCCAGGTTGAAGGTGATGG - Intergenic
1066219553 10:33321880-33321902 GCCAGCCAGGTTGGAGGTGATGG - Intronic
1067044373 10:42976072-42976094 TCCCGACAGCTTGATGGTCAGGG + Intergenic
1070781927 10:79142693-79142715 GCCGGCCAGGGTGACGGGGAGGG - Intronic
1075096872 10:119477747-119477769 GCTGGGCAGGTTGACGGTGCTGG + Intergenic
1076190915 10:128482811-128482833 GCCAGGCAGGGTGAGGGTGAGGG + Intergenic
1088863683 11:113825891-113825913 GCCCTACATATTGACTGTGATGG + Intronic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1097038834 12:56142276-56142298 GCCCCACAGGTTCGGGGTGAGGG + Exonic
1100651138 12:96590215-96590237 GTCTGACAGGTTGACTGTTAGGG + Intronic
1102982189 12:117250696-117250718 GCCTGACAGGTAGACAGAGATGG + Intronic
1107516089 13:41131382-41131404 GCCAGACAGGTCAAAGGTGACGG + Exonic
1125603833 15:40929164-40929186 GCCCGACTGGCTGACGGGGAGGG + Intergenic
1132579739 16:679506-679528 GCCTGGCAGCTTGACTGTGAAGG - Intronic
1140247624 16:73265572-73265594 GCCCGACAGGTAGATGGGAACGG - Intergenic
1147594169 17:41706039-41706061 GCCCAACAGGTAGGAGGTGAGGG - Intergenic
1149870733 17:60179216-60179238 GCTAGACAGCTTGGCGGTGAGGG - Exonic
1149992597 17:61391248-61391270 GCCCTTCAGGTTGATGCTGAGGG + Intronic
1161224317 19:3136143-3136165 GCCCGACAGGTTGACGGTGAAGG - Intergenic
1167118661 19:47503331-47503353 GCCCGAGAGGTTGGCCTTGAGGG - Intronic
1167350998 19:48974613-48974635 TGCCGACAGGGTGAAGGTGAGGG - Exonic
926613510 2:14971595-14971617 GGCCAACAGGTTGATGGTGGTGG - Intergenic
927422359 2:22947005-22947027 GCCTGACATTTTGAAGGTGATGG + Intergenic
1168963749 20:1886466-1886488 GCCCCACAGGGTGACTGAGATGG - Intergenic
1175633406 20:60560684-60560706 GCTCGACAGGATGAGGGAGAGGG + Intergenic
1181638263 22:24184268-24184290 GCCCCACAGTTCGATGGTGATGG - Exonic
1183743276 22:39679783-39679805 GCCCGACAGGTTGTCGATGATGG - Exonic
954408375 3:50358242-50358264 GCCTGGCAGGCTGATGGTGATGG + Exonic
967035718 3:185647175-185647197 GCCCACCACGTTGACGGGGAGGG - Intronic
992906897 5:81355974-81355996 GCAGGACATGTGGACGGTGAGGG - Intronic
1003112235 6:3259780-3259802 GCGCGGCAGGGTGAAGGTGAGGG - Intronic
1022461569 7:30613214-30613236 GCCCTACAGGTTTACGGTTTAGG + Intronic
1052947215 9:34178241-34178263 GCCCGACAGGTGGAGGTTGCAGG + Intergenic
1061905495 9:133694592-133694614 TCCCGCAAGGGTGACGGTGATGG - Intronic
1062289769 9:135789292-135789314 GCCCGGGAGGGTGACGGTGCCGG + Intronic
1062565592 9:137162663-137162685 GGCCGCCAGGTTGGCGGTGTAGG - Exonic
1190781787 X:53603466-53603488 GCCCCACTGGTTTACGGAGATGG + Exonic