ID: 1161224352

View in Genome Browser
Species Human (GRCh38)
Location 19:3136254-3136276
Sequence CAGGAAGCCCGGCTCGGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161224352_1161224367 25 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224367 19:3136302-3136324 TCCCTGGGGGGTGACCCCCAAGG 0: 1
1: 0
2: 0
3: 20
4: 221
1161224352_1161224365 12 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224365 19:3136289-3136311 AAGGAAGTCTAGGTCCCTGGGGG 0: 1
1: 0
2: 2
3: 12
4: 176
1161224352_1161224362 9 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224362 19:3136286-3136308 GGCAAGGAAGTCTAGGTCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
1161224352_1161224359 -7 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224359 19:3136270-3136292 CTTCCTGGGTGTTTCAGGCAAGG 0: 1
1: 0
2: 1
3: 21
4: 287
1161224352_1161224361 2 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224361 19:3136279-3136301 TGTTTCAGGCAAGGAAGTCTAGG 0: 1
1: 0
2: 1
3: 24
4: 326
1161224352_1161224366 13 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224366 19:3136290-3136312 AGGAAGTCTAGGTCCCTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 186
1161224352_1161224364 11 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224364 19:3136288-3136310 CAAGGAAGTCTAGGTCCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
1161224352_1161224363 10 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224363 19:3136287-3136309 GCAAGGAAGTCTAGGTCCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161224352 Original CRISPR CAGGAAGCCCGGCTCGGCGG TGG (reversed) Exonic
900501100 1:3005030-3005052 GAGGCAGCCCTGCTCGGTGGGGG - Intergenic
900621626 1:3590245-3590267 CGGGGAGCCCGGCTTGGAGGAGG + Intronic
900858244 1:5203624-5203646 CAGGAAGCATGGCTTGGCTGAGG + Intergenic
901828600 1:11878762-11878784 CAGGAAGCCCGGGTGGGCGAGGG - Intergenic
904886669 1:33743398-33743420 CAGGACGGGCGCCTCGGCGGTGG + Exonic
905361406 1:37423354-37423376 CAGGAAGCCAGGCCCGGAGATGG - Intergenic
907417894 1:54327025-54327047 CAGGAGGCCCGGCTCTGCCCTGG - Intronic
910450151 1:87335550-87335572 CAGTGAGCCCGGCGCGGCCGGGG + Intronic
912517094 1:110223301-110223323 CAGGAAGCCCAGCACGTCGCGGG - Exonic
918064405 1:181089550-181089572 CAGGAAGCGCTGCGCGGCGGGGG + Exonic
921260378 1:213380974-213380996 AAGGATGCCTGGCTTGGCGGAGG + Intergenic
922578404 1:226678927-226678949 CAGGGAGCACGCCTCTGCGGAGG + Intronic
923050364 1:230387491-230387513 CAGGAGGCCAGGCTGGGGGGAGG + Intronic
1064208802 10:13347312-13347334 CAGGACGCCCGCGTCGGAGGCGG + Intronic
1065483832 10:26217785-26217807 GAGGGAGCCGGGCCCGGCGGAGG + Intronic
1069992096 10:72322273-72322295 CATGAAGCCGGGCTGGGCGAGGG + Intergenic
1070790828 10:79188388-79188410 CAGCAAGACTGGCTCGGGGGCGG - Intronic
1074530794 10:114297463-114297485 CAGGGAGCCCTGCTGGGTGGAGG + Intronic
1075129403 10:119725792-119725814 CAGGAAGGCTGGCGCGCCGGGGG + Intergenic
1075584895 10:123650591-123650613 CAGGAAGCCCGTGCCGGCTGGGG - Intergenic
1075924131 10:126236548-126236570 AAGCAAGCACGGCTCTGCGGGGG + Intronic
1076718209 10:132378795-132378817 CAGGAAGCCTGACTCGGCCGAGG - Exonic
1076721872 10:132396612-132396634 CAGGAAGCCGGGGCAGGCGGAGG - Intergenic
1077213215 11:1383012-1383034 CAGGAAGCCCAGCTCTCAGGCGG + Intergenic
1077432760 11:2524176-2524198 ATGGAAGCCAGGCTCGGCGACGG + Intronic
1077517527 11:3010785-3010807 CAGGAAGCCTGGGTGGGTGGAGG - Intronic
1077533093 11:3106420-3106442 GAGGAAGCCGGGCTCTGGGGTGG - Intronic
1078345105 11:10541012-10541034 GCGGAAGCCTGGCTCGGCAGCGG + Intronic
1081812912 11:45923208-45923230 CAAGAGGCCGGGCTCGGGGGCGG - Intronic
1083765327 11:64838802-64838824 CAGGAAGAGCGGCTAGGCCGTGG - Exonic
1084358127 11:68652822-68652844 CAGGAGGCCCAGCACGGCAGAGG - Intergenic
1084458420 11:69282606-69282628 CAGGAAGCCAGGCTCAGTGCAGG - Intergenic
1084478530 11:69402574-69402596 GAGGAAGCCAGGCATGGCGGAGG + Intergenic
1085205853 11:74731474-74731496 CAGGCAGCCCGGCCTGGCGCTGG + Intergenic
1085217755 11:74847594-74847616 CAGGAAGCCCTCCTGGGCTGGGG + Intronic
1085470232 11:76752947-76752969 CAGGCAGCCCGGCCCAGCGGAGG - Intergenic
1087217105 11:95506006-95506028 CTGGAAGCCCGGCTAGTCTGTGG + Intergenic
1089497146 11:118913607-118913629 CAGGAAGCCCAGGCAGGCGGCGG + Intronic
1089559684 11:119337648-119337670 CAGGAAGACTGGCCCGGAGGAGG - Intergenic
1090989546 11:131803749-131803771 CAGGCAGCCAGGTTCGGGGGAGG - Intronic
1091219212 11:133920440-133920462 CAGGATGCCCGGGTAGGCCGCGG + Exonic
1091301451 11:134510602-134510624 CAGGATGCCAGGCTGGGTGGAGG - Intergenic
1095581613 12:43806405-43806427 CAGGAAGGGCGGCGGGGCGGCGG - Intergenic
1100330136 12:93573538-93573560 ATGGAAGCCGCGCTCGGCGGGGG - Intronic
1102218951 12:111181280-111181302 CAGGAGGCCCCTCTCGGCTGTGG + Intronic
1103362437 12:120361997-120362019 CAGCAGGCCCGGCTCGGCTGCGG - Intronic
1104379180 12:128291909-128291931 CAGGAACCCCGGCTGACCGGAGG + Intronic
1104964928 12:132504633-132504655 CAGGAACCCCTGCTAGGCTGAGG - Intronic
1106455712 13:29924849-29924871 CAGGAAGCCCTCCTTGGCAGAGG - Intergenic
1107468105 13:40666992-40667014 CGGGAAGCCCGGGTGGGAGGAGG + Intergenic
1107604026 13:42040806-42040828 CAGGAGCCCCGGCGCAGCGGCGG + Intronic
1108229141 13:48319097-48319119 CTGGAAGCCGGGCTCGCTGGAGG + Intronic
1112507513 13:99983814-99983836 CAGGCAGCGCGGCCCCGCGGGGG + Intronic
1112572809 13:100608951-100608973 GAGGAAGCCTGGGTGGGCGGAGG + Intronic
1113960256 13:114122199-114122221 CAGGAAGCCTTGCTGGCCGGGGG - Intronic
1114713739 14:24803945-24803967 CAGGAAGCCTGGCTGGGGCGGGG + Intergenic
1115658310 14:35465336-35465358 CAGGAAGCATGGCTAGGAGGAGG - Intergenic
1117405206 14:55395289-55395311 CAGGCAGCCCGGCTTTGCTGAGG - Intronic
1119382749 14:74239493-74239515 CGGGAAGCCCGGCGGGGGGGTGG + Exonic
1119456927 14:74763876-74763898 CAGGAGGCCCGTCTCGTTGGTGG - Exonic
1122602718 14:102929544-102929566 CAGCAAGCAGGGCCCGGCGGGGG - Intronic
1122893748 14:104745097-104745119 CAGGAGGCCTGGCTGGGCAGGGG + Intronic
1124077258 15:26457964-26457986 CGGGAAGCCAGGCTCAGCAGTGG - Intergenic
1124401132 15:29348492-29348514 CAGGAAGACCGGCTCGGGAGTGG + Intronic
1124453844 15:29822493-29822515 GAGCATGCCCGGCCCGGCGGGGG + Exonic
1126467703 15:48975961-48975983 CGAGAAGCCCGGCCGGGCGGCGG + Intergenic
1130543796 15:84840437-84840459 CAGGAAGCCAGCCTCTGCTGTGG + Exonic
1131171951 15:90185025-90185047 CAGGAAGAGCGGCCCCGCGGGGG + Intronic
1135023786 16:18983965-18983987 CTGGAATCCCGGCTCCGCGAGGG + Exonic
1135087511 16:19487115-19487137 CAGGAAGCCAGGCCTGGCTGGGG + Intronic
1136005680 16:27327230-27327252 CAGGAAACCTGGCTTGGAGGAGG - Intronic
1138562098 16:57807399-57807421 CAGGAAGCCAGGCTCCTCAGTGG + Intronic
1140707370 16:77643339-77643361 CAGGGAGCCCAGTTGGGCGGGGG + Intergenic
1141531318 16:84648690-84648712 CAGGAAGCCGCGCCCGGCCGGGG + Intronic
1142493292 17:292608-292630 CAGGCAGCCAGGCCCGGCTGGGG - Intronic
1143253079 17:5537058-5537080 CTGGAAGCCAGGCTCTGAGGAGG + Intronic
1147719809 17:42532134-42532156 CGCGACGCCCGGCCCGGCGGCGG - Intergenic
1147911400 17:43858322-43858344 CAGGAGGCCGGGCTTGGAGGTGG - Intronic
1150217116 17:63476991-63477013 GAGGAAGCGCGGCGGGGCGGGGG + Intergenic
1152456880 17:80421865-80421887 CAGGAAGCCCGACACGTAGGGGG - Exonic
1152641905 17:81452737-81452759 CACGGAGCCCTGCACGGCGGGGG + Exonic
1154085653 18:11303047-11303069 CAGGAAGCCAGGCTTGCAGGGGG - Intergenic
1154161478 18:11983685-11983707 CAGGAAGCCCGGGCCGCCCGGGG + Intronic
1154356029 18:13623827-13623849 CAGGAAGCCTGGCTGCGTGGGGG - Intronic
1157281202 18:46347398-46347420 CAGGCAGCTCGGCTGGGCAGAGG - Intronic
1160025541 18:75212149-75212171 CGGGAAGCCCGGATGGCCGGGGG + Intronic
1160691284 19:461566-461588 CAGGAGTGCCGGCTCGGGGGTGG + Intergenic
1160763564 19:797561-797583 CGGGGAGGCCGGCGCGGCGGCGG - Intronic
1161224352 19:3136254-3136276 CAGGAAGCCCGGCTCGGCGGTGG - Exonic
1161277851 19:3428803-3428825 CAGGAAACCCCGGTCGGGGGAGG + Intronic
1162013074 19:7829855-7829877 CAGAAAGCCCGGCTCTGGGCGGG + Intergenic
1162031174 19:7917870-7917892 CTGGGGGCCCGGCTTGGCGGAGG - Intronic
1162742942 19:12783500-12783522 CAGGAGGCCAGGCTCGAGGGGGG - Intronic
1163591074 19:18194458-18194480 CAGGAAGCCGGGCTGGGAGGTGG - Intronic
1164992198 19:32692438-32692460 CAGGAGGCCAGGCCCGGCGGTGG - Exonic
1166838390 19:45681590-45681612 CAGGAAGCCCTGCCCAGAGGAGG - Exonic
1166960405 19:46493336-46493358 GAGGAAGCCCGGATGGGAGGAGG - Exonic
1167233244 19:48298130-48298152 CAGGAGGCCGGTCTCGGGGGTGG - Intronic
926210061 2:10862858-10862880 CAGGGAGGCCGGCTGGGAGGTGG + Intergenic
927714175 2:25341779-25341801 CCGGAAGGCCGGCCCGGAGGCGG - Intronic
931769074 2:65481947-65481969 CAGGAATCCAGGCTGGGCAGAGG + Intergenic
932087473 2:68774952-68774974 CAGGCAGTCCGGCACCGCGGCGG - Intronic
933700795 2:85254077-85254099 CAGGAAGCCCAGCTGGGCACGGG + Intronic
933840705 2:86283870-86283892 CAAGAAGCCAGGCTTGGAGGAGG - Intronic
937336936 2:121067980-121068002 GAGGAACCGCGGCTCTGCGGTGG + Intergenic
939900461 2:147844447-147844469 CTGGAAGCCAGGCGCAGCGGAGG - Intergenic
948897048 2:240932485-240932507 CAGGAAGCCTGGTGCGGCAGTGG + Intronic
1171973281 20:31578014-31578036 CAGGCTGCCCGGCTCTGCAGTGG - Intergenic
1173656402 20:44703096-44703118 CTGGAAGCCCAGCCAGGCGGAGG - Intergenic
1175901037 20:62360023-62360045 CAGGAAGCCAGGCTGAGCGGCGG - Intronic
1175972234 20:62692334-62692356 CAGGCAGCCCTGCTCTGCAGTGG - Intergenic
1176053191 20:63131304-63131326 CAGAAAGCCCTGCTCGGCCGAGG - Intergenic
1176418924 21:6499024-6499046 CAGGCGGGCCGGCGCGGCGGTGG - Intergenic
1176427900 21:6560066-6560088 CAGGAAGACGGGCTGGGCTGTGG - Intergenic
1177011097 21:15730527-15730549 GAGGAAGCCCGGGAAGGCGGCGG - Intronic
1177312128 21:19411859-19411881 CAGGAAGCATGGCTGGGTGGTGG - Intergenic
1179506914 21:41847246-41847268 CATGAATCCCGGCGCAGCGGAGG + Intronic
1179694417 21:43107346-43107368 CAGGCGGGCCGGCGCGGCGGTGG - Intronic
1179703392 21:43168383-43168405 CAGGAAGACGGGCTGGGCTGTGG - Intergenic
1180706873 22:17815631-17815653 CAGGAAGCCTGGCTCTGTAGAGG + Intronic
1180762715 22:18221925-18221947 CTGGAAGCCGGGCTCGTTGGAGG - Intergenic
1180772952 22:18402683-18402705 CTGGAAGCCGGGCTCGTTGGAGG + Intergenic
1180804310 22:18652238-18652260 CTGGAAGCCGGGCTCGTTGGAGG + Intergenic
1180806443 22:18717178-18717200 CTGGAAGCCGGGCTCGTTGGAGG - Intergenic
1180891373 22:19291537-19291559 CTGGCAGTCCGGCCCGGCGGAGG + Intronic
1181217389 22:21342959-21342981 CTGGAAGCCGGGCTCGTTGGAGG - Intergenic
1183020784 22:35024267-35024289 CACGCAGCCCTGCGCGGCGGAGG + Intergenic
1203234787 22_KI270731v1_random:143671-143693 CTGGAAGCCGGGCTCGTTGGAGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950195639 3:11007295-11007317 CATGAGGCCCGGCTCCCCGGAGG + Intronic
950611417 3:14129455-14129477 CAGGAAGCCTGGCTGGGAGCTGG - Exonic
952866774 3:37860600-37860622 CAGGAGGGCGGGCTCGGGGGTGG - Intergenic
954847594 3:53573359-53573381 CAGCAAGCCTGGCACGGCTGAGG - Intronic
955769544 3:62373800-62373822 CACGATGCCCAGCTCGGCTGCGG - Intronic
956678251 3:71754588-71754610 CAGGAAGCCCAGCGCGCCGGGGG - Exonic
960333604 3:116391573-116391595 CAGGAAGCAGGGCGCGGGGGTGG + Intronic
961667075 3:128499144-128499166 CTGGAAGCCCAGCTGGGCTGCGG - Intergenic
961674400 3:128555836-128555858 CAGGAAGCCCGCAGCGGCTGCGG + Intergenic
963091371 3:141486872-141486894 AGGGTAGCCCGGCTCGGGGGTGG + Intergenic
965104659 3:164341297-164341319 AAGGACGGCCGGCTCGGAGGCGG - Intergenic
967859830 3:194142049-194142071 CAGGGAGCTCGGTGCGGCGGAGG - Intergenic
968514768 4:1011473-1011495 CCGGGAGCCCGGCGGGGCGGGGG + Intronic
968775448 4:2537011-2537033 CGGCAAGGCCGGCCCGGCGGCGG + Intronic
968818078 4:2832008-2832030 CAGGAAGCCGGGCATGGCGGAGG - Intronic
969285754 4:6200802-6200824 CAGGCTGCCCGGCGCGGCTGGGG - Intergenic
969600661 4:8174124-8174146 CAGGAAACCCAGCCCGGGGGAGG - Intergenic
972321648 4:37977625-37977647 CTGGAGGCCAGGCGCGGCGGGGG + Intronic
972794470 4:42401276-42401298 CAGGCAGCCCGGCTCAGCCCTGG - Exonic
977257725 4:94758514-94758536 GAGGGAGCCCGGCGGGGCGGGGG + Intronic
985654583 5:1123319-1123341 CAGGGACCCCGGCTCCGAGGAGG + Intergenic
990369383 5:55101951-55101973 CAGGAAGCAGGGGTCGGGGGGGG + Intergenic
1002702171 5:181131770-181131792 CAGGAAGCCATGGCCGGCGGAGG - Intergenic
1006298416 6:33180305-33180327 CAGGGAGCCCTGCTCGGCCAGGG + Exonic
1008673313 6:53794978-53795000 TAGGAAGCTCCGCGCGGCGGCGG + Exonic
1010414966 6:75602187-75602209 CAGGCAGCCTGGGTGGGCGGTGG + Exonic
1017807085 6:157955142-157955164 CAGAAAGCCCCTCCCGGCGGTGG - Intergenic
1018065833 6:160124695-160124717 AAGGAGGCCCAGCTTGGCGGAGG + Intronic
1019605741 7:1909326-1909348 CGGGAAGCCTGGCTCGGCATTGG - Intronic
1019745969 7:2700561-2700583 CAGGAAGAGCCGCTCGGCAGGGG - Exonic
1020435782 7:8160999-8161021 CAGGAAGGCCGCCTCAGCTGGGG + Intronic
1023873594 7:44275396-44275418 CAGGGAGCCGGGCTGCGCGGAGG - Intronic
1024520908 7:50303912-50303934 CGGGCAGCCCGGCTCGGCCGCGG - Intergenic
1034092644 7:148378289-148378311 GAGGAAGCCCCACTCAGCGGGGG + Intronic
1034282016 7:149861215-149861237 CCGGAAGCCTGGCTGGGTGGTGG + Exonic
1035034414 7:155885724-155885746 CAGGAGGCCCGGCCAGGCAGTGG - Intergenic
1035036647 7:155899819-155899841 CAGGGAGCCAGGCTTGGCAGTGG + Intergenic
1035264581 7:157684276-157684298 CTGGATGCGCGGCTCGGAGGAGG + Intronic
1039474041 8:37829993-37830015 CAGGAGGCCCAGCTCTGCTGCGG + Exonic
1045305204 8:100951893-100951915 CAGGAAGCGAGGCGCGGCGGCGG + Intronic
1049769301 8:144372505-144372527 CAGAAAGCCCGGCTCCGGGAGGG + Intergenic
1053313449 9:37034173-37034195 CAGCTACCCCAGCTCGGCGGGGG - Exonic
1059769769 9:117414579-117414601 CAGGAGGCGCGACTCGGCGGCGG + Exonic
1062619262 9:137412053-137412075 CAGTAAGGCCGGCTCTGTGGGGG - Intronic
1189021738 X:37349040-37349062 GAGAAAGCCTGGCTCGGCGCGGG - Intergenic
1191893713 X:65971319-65971341 CAGGAAGCGCTGCTGGGCGAGGG - Intergenic
1196684166 X:118496259-118496281 CCGGCCGCCCGGCACGGCGGAGG + Intronic