ID: 1161224352

View in Genome Browser
Species Human (GRCh38)
Location 19:3136254-3136276
Sequence CAGGAAGCCCGGCTCGGCGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 160}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161224352_1161224362 9 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224362 19:3136286-3136308 GGCAAGGAAGTCTAGGTCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 146
1161224352_1161224364 11 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224364 19:3136288-3136310 CAAGGAAGTCTAGGTCCCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 169
1161224352_1161224366 13 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224366 19:3136290-3136312 AGGAAGTCTAGGTCCCTGGGGGG 0: 1
1: 0
2: 0
3: 10
4: 186
1161224352_1161224363 10 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224363 19:3136287-3136309 GCAAGGAAGTCTAGGTCCCTGGG 0: 1
1: 0
2: 1
3: 4
4: 132
1161224352_1161224365 12 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224365 19:3136289-3136311 AAGGAAGTCTAGGTCCCTGGGGG 0: 1
1: 0
2: 2
3: 12
4: 176
1161224352_1161224359 -7 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224359 19:3136270-3136292 CTTCCTGGGTGTTTCAGGCAAGG 0: 1
1: 0
2: 1
3: 21
4: 287
1161224352_1161224361 2 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224361 19:3136279-3136301 TGTTTCAGGCAAGGAAGTCTAGG 0: 1
1: 0
2: 1
3: 24
4: 326
1161224352_1161224367 25 Left 1161224352 19:3136254-3136276 CCACCGCCGAGCCGGGCTTCCTG 0: 1
1: 0
2: 0
3: 15
4: 160
Right 1161224367 19:3136302-3136324 TCCCTGGGGGGTGACCCCCAAGG 0: 1
1: 0
2: 0
3: 20
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161224352 Original CRISPR CAGGAAGCCCGGCTCGGCGG TGG (reversed) Exonic