ID: 1161225941

View in Genome Browser
Species Human (GRCh38)
Location 19:3146028-3146050
Sequence CGGAGCACGGAGAAGGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161225941_1161225952 10 Left 1161225941 19:3146028-3146050 CCCCGCCCCTTCTCCGTGCTCCG 0: 1
1: 0
2: 2
3: 28
4: 282
Right 1161225952 19:3146061-3146083 CTGCTCCCATTTCCTCTTTCTGG 0: 1
1: 0
2: 3
3: 53
4: 380
1161225941_1161225953 11 Left 1161225941 19:3146028-3146050 CCCCGCCCCTTCTCCGTGCTCCG 0: 1
1: 0
2: 2
3: 28
4: 282
Right 1161225953 19:3146062-3146084 TGCTCCCATTTCCTCTTTCTGGG 0: 1
1: 1
2: 6
3: 41
4: 446

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161225941 Original CRISPR CGGAGCACGGAGAAGGGGCG GGG (reversed) Intronic
900175214 1:1288506-1288528 CGGAGCAGGGACACGGGACGGGG - Intronic
900175362 1:1289142-1289164 CGGAGCAGGGACACGGGACGGGG - Intronic
900175407 1:1289312-1289334 CGGAGCAGGGACACGGGACGGGG - Intronic
900188651 1:1344243-1344265 AGGAGCCCGGAGACGGGGCTTGG + Intronic
900344683 1:2205144-2205166 GGGAGCCCGGGGGAGGGGCGGGG - Intronic
900584390 1:3425476-3425498 CGGGGCACGGGGCAGGGGCGCGG + Intronic
900858550 1:5206225-5206247 TGGGGCATGGGGAAGGGGCGGGG - Intergenic
901506618 1:9689538-9689560 CGGGGCTCGGCGGAGGGGCGCGG - Intronic
903070817 1:20726246-20726268 GGGAGCACAGAGAATGGGAGTGG + Intronic
903142540 1:21347588-21347610 GGGAGCATGGTGAAGGGGGGAGG + Intergenic
903773378 1:25778064-25778086 TTGGGCAGGGAGAAGGGGCGTGG - Intronic
904402717 1:30267251-30267273 CGGGGCAGGGAGTGGGGGCGGGG + Intergenic
905440024 1:37989745-37989767 CGGAGCTCGGAGAGGGAGCCCGG + Intronic
912641065 1:111346556-111346578 CGGAGCGCGGGGAGGGGGAGAGG - Exonic
915038396 1:152947445-152947467 CTGAGCAGGGAGAAGGAGGGGGG + Intergenic
915275224 1:154783862-154783884 TGGAGCAAGGGGAAGGGGTGAGG - Intronic
915723709 1:158002738-158002760 TGGAGCAGGGAGCAGGGGCAGGG + Intronic
915738035 1:158096864-158096886 GTGACCACGGAGAAAGGGCGAGG - Intronic
915960515 1:160262593-160262615 CGAAGGACGCACAAGGGGCGGGG + Intergenic
916548339 1:165827668-165827690 CGGAGCCCGGTGACGGGGCTGGG - Exonic
917660247 1:177170985-177171007 CGGAGCGCGGAGTCGGAGCGGGG + Intergenic
921472616 1:215567403-215567425 CGGAGCACGGAGAAGAGGCCCGG + Exonic
922730210 1:227945632-227945654 GGAAGCAGGGAGAAGGGGCTGGG - Intronic
923113451 1:230912067-230912089 CAGAACACAGAGAAGGGGCGTGG + Intronic
924465355 1:244294503-244294525 CTGAGCACAGAGAAGGGCTGGGG - Intergenic
1063225743 10:4013334-4013356 GGGAGGACGGTGAAGGGGAGGGG - Intergenic
1064701095 10:18023018-18023040 CTTAGCACTGAGAAGGGGCATGG - Intronic
1065343324 10:24724970-24724992 AGGAGCACCGAGAAGGGGAGGGG - Intergenic
1066478699 10:35773816-35773838 TGGAACACGGAGAAGGAGGGGGG + Intergenic
1070111875 10:73495224-73495246 TGGATCACGGTGAAGGGTCGGGG - Intronic
1070634806 10:78116718-78116740 AGGAGCAGGCAGAAGGGGAGGGG + Intergenic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1072661647 10:97367016-97367038 CTGTGCACTGAGCAGGGGCGGGG - Intronic
1074190208 10:111128904-111128926 CGGAGCAGGGGGCAGGGGGGAGG - Intergenic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1076618220 10:131770837-131770859 GGGAGCACAGAGGTGGGGCGGGG + Intergenic
1076923142 10:133465940-133465962 CAGAGCACAGAGAATGGGAGTGG - Intergenic
1081709915 11:45209936-45209958 TGGGGCGCGGAGAAGGGGAGGGG + Intronic
1083227701 11:61295108-61295130 CGGCGCCAGGAGGAGGGGCGAGG - Exonic
1083614512 11:64019591-64019613 TGGAGCATGGAGGAGGGGCCGGG - Intronic
1083885158 11:65569921-65569943 CCGAGCATGCAGAAGGGGAGTGG + Intergenic
1084868828 11:72081746-72081768 CGGACCACGGAGAAGGTGTGGGG - Intronic
1085273399 11:75283496-75283518 AGGAGCACTGAGGAGGGGCCTGG + Intronic
1085454348 11:76657231-76657253 CTGAGCACAGAGAAGGGGAGGGG + Intergenic
1085515906 11:77111923-77111945 TGGAGCAGGGAGCAGGGGTGGGG + Intronic
1089216142 11:116835774-116835796 CTGAGCACCGGGAAGGGGGGCGG + Exonic
1089563296 11:119356803-119356825 CGGGGAAGGGAGAAGGGACGTGG + Exonic
1091678985 12:2512742-2512764 GGGAGCACCGAGAAGGGTCGAGG - Intronic
1091818899 12:3459695-3459717 AGGAGCAGGGAGAAGGGCAGGGG + Intronic
1091829495 12:3539675-3539697 CGGAGCAGGGAGAAGGAGATGGG - Intronic
1092861828 12:12725252-12725274 CGGAGCGCGGGGCAGGCGCGCGG - Intergenic
1095982862 12:47982774-47982796 CTGAGCAGGGAGAAGAGGAGCGG - Intronic
1096091483 12:48904637-48904659 CGAAGCACGGAGGGGGTGCGTGG + Intronic
1096121527 12:49092145-49092167 CGGAGCAGGGATTGGGGGCGCGG - Intronic
1096586599 12:52626654-52626676 AGGAGAAAGGATAAGGGGCGGGG + Intergenic
1096626224 12:52897674-52897696 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1097195271 12:57239426-57239448 CGGAGGGCGGAGAGGGGACGCGG + Intronic
1098762898 12:74447207-74447229 CGGAGAACGGATAAGGCTCGAGG - Intergenic
1102001549 12:109560942-109560964 AGGAGGACGGAGATGGGGAGAGG - Intronic
1102278292 12:111599192-111599214 AGGAGGACGACGAAGGGGCGGGG + Exonic
1102997422 12:117361082-117361104 CTGGGGACGGAGAAGGGGCGCGG + Intronic
1103261612 12:119593704-119593726 CAGAGGACGCAGAAGGGGTGAGG + Exonic
1103698660 12:122835970-122835992 CGGGGGACGGAGATGGGGCCGGG + Intronic
1104682927 12:130763680-130763702 CGAGGTACGGGGAAGGGGCGTGG - Intergenic
1105050771 12:133048789-133048811 TGGAGCAAGGAGAAGAGCCGTGG + Exonic
1105886861 13:24649838-24649860 AGGAGGAGGGAGAAGGGGGGAGG - Intergenic
1108804031 13:54132210-54132232 AGGGACACGGAGAAGGGGGGTGG + Intergenic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1112504869 13:99969644-99969666 CGGAGCGCGGAGACTGCGCGGGG + Intronic
1113060086 13:106313706-106313728 AGCTGCACGGAGAAGGGGTGGGG - Intergenic
1113201056 13:107867576-107867598 GGGAGGAGGGAGAAGGCGCGCGG + Intergenic
1113755379 13:112807829-112807851 GGGAGCAGAGAGAAGGGGCGCGG + Intronic
1113777139 13:112954300-112954322 TGGAGCAGGGAGGAGGGGTGTGG - Intronic
1113947845 13:114054510-114054532 CGCTGCAGGGAGAAGGGGTGGGG - Intronic
1117920847 14:60723964-60723986 AGGCGCACCGAGAAGTGGCGGGG - Exonic
1118882343 14:69840449-69840471 CGGAGCACAGGGCAGGGGCGGGG - Intergenic
1119004069 14:70908132-70908154 GGGAGCACGCAGTGGGGGCGGGG - Intronic
1119407045 14:74405479-74405501 AGGAGCAGGCAGCAGGGGCGTGG + Intergenic
1119520237 14:75279486-75279508 TGGAGCACGGAGGAGGGATGAGG + Intronic
1119655457 14:76413969-76413991 CGGCGGACGGTGCAGGGGCGGGG - Intronic
1119655490 14:76414057-76414079 CGGCGGACGGTGCAGGGGCGGGG - Intronic
1120920800 14:89753880-89753902 CTGAGCACGGGGTGGGGGCGGGG - Intergenic
1122227785 14:100289982-100290004 AGGAGCAAGGTGAAGGGGCGGGG - Intergenic
1122344404 14:101049708-101049730 CGCAGCACGGAGCCGGGGCAGGG - Intergenic
1122634206 14:103122717-103122739 CGGAGCAGGCAGAAGGGGAGGGG - Intergenic
1122911090 14:104827842-104827864 CGGGGCAGGGAGGAGGGGCTGGG + Intergenic
1123048103 14:105528130-105528152 CCGTGCAGGGAGGAGGGGCGTGG + Intronic
1123830416 15:24130306-24130328 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123850671 15:24352912-24352934 CAGGGCACGCAGAAGGGGTGTGG + Intergenic
1123935388 15:25191609-25191631 AGGAGCACGGAGAAGGGGTTGGG - Intergenic
1124636510 15:31368058-31368080 TGGAGCATGGAGAAGAGGGGAGG - Intronic
1128095307 15:64949691-64949713 TGGAGCATGGAGAAGGGCCTTGG + Intronic
1128326941 15:66729900-66729922 CTGGGCCCGCAGAAGGGGCGGGG + Intronic
1128349062 15:66877010-66877032 CGGGGCTAGGAGCAGGGGCGTGG + Intergenic
1129810676 15:78507545-78507567 CGGGGCTTGGAGGAGGGGCGCGG + Intronic
1130613348 15:85380896-85380918 CGGGCCCCGGAGGAGGGGCGGGG + Intronic
1130997755 15:88913198-88913220 CGGCGCGGGGAGGAGGGGCGAGG + Intronic
1132791554 16:1692265-1692287 CGGGGCGCGGAGAAGCGGTGGGG + Intronic
1133322888 16:4925170-4925192 CAGAGCCCAGAGAAGGGGCTGGG + Intronic
1134056594 16:11174040-11174062 CTGAGCACTGACGAGGGGCGAGG - Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1135382694 16:22007998-22008020 GGGAGGACGGAGCTGGGGCGCGG + Intronic
1136287910 16:29254857-29254879 CGAGGGAGGGAGAAGGGGCGGGG - Intergenic
1136454220 16:30371230-30371252 GACAGCACGGAGAAGGGGCGGGG + Intronic
1138660718 16:58515603-58515625 CTGCGAACGGAGAAGGGGTGAGG - Intronic
1139435494 16:66934425-66934447 CGGAGAACGGGAAGGGGGCGTGG + Intronic
1141693304 16:85608329-85608351 CGGTGCAGGGGCAAGGGGCGGGG - Intergenic
1143140269 17:4738659-4738681 CGGAACCCGGAGATGGGGCTCGG + Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1145988908 17:29066296-29066318 GGGAGCAAGGAGTAGGGGTGGGG + Intergenic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1147000531 17:37359120-37359142 CGGCACACGGAGAAGGGGCGGGG + Intronic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147752553 17:42745061-42745083 CGGGGCACGGCGCAGGGGTGGGG - Intergenic
1150250113 17:63700300-63700322 GGGAGCGCGGAGCCGGGGCGGGG - Intronic
1152277586 17:79367229-79367251 GGGAGGAGGGAGAAGGGGAGGGG - Intronic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152322964 17:79618655-79618677 CGGAGGATGGAGAAGAGACGGGG + Intergenic
1152329706 17:79665393-79665415 CGGAGCAGAGAGGAGGGGCCTGG + Intergenic
1152329714 17:79665423-79665445 CGGAGCAGAGAGGAGGGGCCTGG + Intergenic
1152515348 17:80820389-80820411 AACAGCACGGAGAAGGGGCACGG - Intronic
1152913067 17:83016579-83016601 TGGAGGAGGGAGAAGGGGAGAGG + Intronic
1152917701 17:83050710-83050732 CGGAGCACGGGGAAGGTGTTCGG + Intronic
1153939793 18:9968079-9968101 GGGAGCAGGGAAGAGGGGCGAGG - Intergenic
1158610488 18:58935436-58935458 GGGAGGAGGGAGAAGGGGAGAGG - Intronic
1160777439 19:862503-862525 CGGGGCATGGGGACGGGGCGGGG + Intronic
1160996647 19:1885200-1885222 AGGAGCCCAGAGCAGGGGCGCGG - Intronic
1161203573 19:3029013-3029035 GGGAGGAGGGAGAAGCGGCGCGG + Exonic
1161225941 19:3146028-3146050 CGGAGCACGGAGAAGGGGCGGGG - Intronic
1161284574 19:3462784-3462806 GGGACGATGGAGAAGGGGCGAGG - Exonic
1161330981 19:3687763-3687785 GGGAGAAGGGAGAAGGGGCAAGG - Intronic
1161447648 19:4327449-4327471 CGGAGCCTGGAGTTGGGGCGGGG - Intronic
1161735600 19:5990528-5990550 AGGAGCAGGGCCAAGGGGCGGGG + Intergenic
1162129064 19:8514194-8514216 GGGCGCTCGGAGAGGGGGCGGGG + Intergenic
1162393406 19:10403167-10403189 CGGAGCAGGGAGTGGGGGAGCGG + Intronic
1162523879 19:11196815-11196837 GGGAGCGCAGGGAAGGGGCGCGG + Intronic
1162612428 19:11767060-11767082 CGGAGCCCAGTGCAGGGGCGTGG - Intronic
1162980451 19:14235801-14235823 CGGAGGACAGAGGAGGGGGGAGG - Intergenic
1163012175 19:14433271-14433293 CGGCGCCCGGGGAGGGGGCGGGG - Intronic
1163492144 19:17623365-17623387 CGGGGCATGGGGAGGGGGCGGGG - Intronic
1164152815 19:22569444-22569466 AGAGACACGGAGAAGGGGCGGGG - Intergenic
1164524571 19:29003928-29003950 GGGAGCACAGAGAAAGGGGGTGG - Intergenic
1165313395 19:35041371-35041393 TGGAGGACGCAGAAAGGGCGGGG + Intronic
1165476273 19:36032684-36032706 CGGCCCGCGGAGAAGGGGAGGGG - Intronic
1165497159 19:36159896-36159918 AGAGACACGGAGAAGGGGCGGGG + Intergenic
1165751878 19:38265065-38265087 CTGAGCAGGGAGAACTGGCGGGG + Intronic
1165937436 19:39397873-39397895 GGGAGCAGGAAGAAGGGGCAGGG - Exonic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166214270 19:41325392-41325414 AGAAGCAGGGAGAAGGGACGGGG - Intronic
1166601071 19:44094927-44094949 GGGATCAGGGAGAAGGGCCGAGG - Intronic
1167072160 19:47227689-47227711 CGGAGGAAGGAGAGGGGGAGGGG - Intronic
1167148286 19:47695140-47695162 CTGAGCAGGGAGAATGGGCTGGG + Intronic
1167414142 19:49361604-49361626 CGGCGCACGGGGGAGGGGAGGGG - Intronic
1167557540 19:50205518-50205540 CGGAGCGGGGAGATGGGGTGAGG - Intronic
1167578604 19:50329328-50329350 GAGAGCAGGGAGGAGGGGCGGGG + Exonic
1168634842 19:57988244-57988266 TGGAGCAAGGAGAAGAGCCGTGG - Exonic
925090756 2:1154140-1154162 GGGAGCACAGGGAAAGGGCGCGG + Intronic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
927699648 2:25259723-25259745 TGGAGCCTGGAGAAGGGGTGGGG - Intronic
927904960 2:26849129-26849151 AGGAGGAAAGAGAAGGGGCGGGG + Intronic
928904577 2:36356107-36356129 CGCGGCCCGCAGAAGGGGCGGGG + Exonic
929440347 2:41961285-41961307 TGTAGCACTGAGAAGGGGAGGGG - Intergenic
930136159 2:47905820-47905842 GGGAGGAAGGAGAGGGGGCGAGG + Intergenic
930651752 2:53970833-53970855 CGGAGCCCGGAGAGGGGTGGGGG - Exonic
931671613 2:64653497-64653519 CGGAGGGCGGAGGAGGGGCCGGG - Intronic
935820212 2:106886648-106886670 CGGAGCTCGGGGGCGGGGCGCGG - Intronic
937197228 2:120169615-120169637 CGGAGGAAGGAGAAGGGAAGGGG - Intronic
937198035 2:120177392-120177414 CGGAGCACGGTGGGGTGGCGGGG + Exonic
942946618 2:181680735-181680757 GGGAGGAAGGAGGAGGGGCGGGG - Exonic
946120769 2:217512114-217512136 AGGAGCATGGAGAAGAGGGGAGG - Intronic
947858118 2:233338258-233338280 CAGAGCTCAGAGAAGGGGCCTGG + Intronic
948086958 2:235258714-235258736 CAGTGCCTGGAGAAGGGGCGTGG - Intergenic
948453380 2:238092619-238092641 AGGAGCACGGAGAAGGTCAGGGG - Intronic
1171013920 20:21523065-21523087 CTGGGGACGGAGGAGGGGCGAGG - Intergenic
1172149446 20:32779921-32779943 CTGAGCAGGGAGAGGGGGCCAGG + Intronic
1172761715 20:37328014-37328036 CGGAGCCAGGAGCAGGGCCGAGG + Intergenic
1172781339 20:37438519-37438541 CAGAGCAGGGAGGAGGAGCGGGG + Intergenic
1173246429 20:41340773-41340795 CGGGGATCGGAGCAGGGGCGGGG + Intergenic
1173589083 20:44210435-44210457 CGGAGGAGCGAGACGGGGCGGGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1175626135 20:60489559-60489581 GGGAGCACGGGGCAGGGGCGGGG + Intergenic
1175722568 20:61296009-61296031 AGGAGGACGGAGAAGGGGTGGGG + Intronic
1175907202 20:62386785-62386807 AGCAGCTGGGAGAAGGGGCGAGG - Intergenic
1176515457 21:7780471-7780493 GGGAGCAGGGAGGAGGGGCCAGG - Intergenic
1178649485 21:34410483-34410505 GGGAGCAGGGAGGAGGGGCCAGG - Intergenic
1179022891 21:37656175-37656197 CTCAGCAGGGAGAAGGGGTGTGG - Intronic
1179786831 21:43734950-43734972 TGGAGCAGGGAGGAGGGGCCTGG + Intronic
1180664541 22:17499382-17499404 CAGAGCACGGAAAAGGGGTTTGG - Intronic
1180731173 22:17983669-17983691 CTGGGGACGGAGAAGAGGCGTGG - Intronic
1181603595 22:23966832-23966854 CGGACCAGGGAGGAGGGGCGAGG - Intergenic
1181604918 22:23974475-23974497 CGGACCAGGGAGGAGGGGCGAGG + Exonic
1182433207 22:30312969-30312991 AGGAGCATGTAGAAGGGGCTAGG + Intronic
1183342017 22:37286739-37286761 CAGAGCACGGAGCTGGGACGGGG + Intronic
1183618519 22:38959428-38959450 CGGAGCAGGGGGAAGGAGGGTGG + Intronic
1183742266 22:39675373-39675395 CAGAGCATGGGGAAGGGGAGAGG - Intronic
1184677974 22:46053848-46053870 CGGAGCACGGAGGACGGGGCCGG + Exonic
1184776355 22:46625473-46625495 AGGAGCAAGGAGATGGGGCGGGG - Intronic
1185346947 22:50314566-50314588 CGGAGCAAGGGCAAGAGGCGGGG + Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950518162 3:13480529-13480551 CGGGCCACCGAGCAGGGGCGCGG - Intronic
952918612 3:38268324-38268346 CTGAGGTTGGAGAAGGGGCGGGG - Intronic
953357294 3:42266000-42266022 CGGTGCACGGAGAGGGCGAGGGG - Exonic
955068725 3:55554728-55554750 TGCAGCACGGGGAAGGGGGGAGG - Intronic
955291036 3:57692748-57692770 AGGAGCGCCGAGAAAGGGCGGGG + Intronic
956049755 3:65235360-65235382 TGGAGGATGGAGAAGGGGAGGGG - Intergenic
956084764 3:65597602-65597624 TGGACCAGGGAGGAGGGGCGGGG - Intronic
956661870 3:71606864-71606886 CGGAGCAGGGAGCAGGGGCAGGG + Intergenic
961340333 3:126213136-126213158 CGGAGGCCCGAGAAGGCGCGGGG - Intergenic
967833844 3:193944328-193944350 GGGAGCTGGGAGAAGCGGCGTGG - Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968433679 4:574725-574747 CGGAGCCCGCAGAGGGGGCCAGG + Intergenic
968879763 4:3292967-3292989 CCGAGGCCGGAGGAGGGGCGGGG - Intergenic
969138809 4:5051707-5051729 CCGAGCACCGTGCAGGGGCGGGG - Exonic
973871683 4:55172780-55172802 CGCAGCAGGGAGAAGGAGCCAGG - Intergenic
974428552 4:61768786-61768808 AGAGGCACGGAGAAGGGGTGGGG + Intronic
982175919 4:152705482-152705504 AGGAGCAGGGAGAAGTGGAGGGG - Intronic
983158754 4:164384055-164384077 AGGGGGACGGAGAAGGGGAGGGG - Intergenic
985517263 5:353452-353474 CAGAGCACGGAGACAGGGCACGG - Intronic
986127401 5:4895699-4895721 GGGAGCAGGGATAAGGGGTGTGG - Intergenic
987050286 5:14143164-14143186 CGGAGCCTGGGGGAGGGGCGGGG - Intergenic
990420334 5:55625612-55625634 CGGCGAACAGAGAAGGGGCCAGG - Intergenic
990597900 5:57329633-57329655 GGGAAGAAGGAGAAGGGGCGAGG + Intergenic
994107016 5:95960391-95960413 GGAAGCACCGAGAAGGGACGCGG - Intronic
994185079 5:96807710-96807732 GGGAGGAGGGAGACGGGGCGCGG - Intronic
995395080 5:111678738-111678760 TGGAGCACAGAGAAGGGGCTAGG - Intronic
997251421 5:132391605-132391627 AGGAGGAGGGAGAAGGGGAGGGG + Intronic
997526420 5:134555921-134555943 GGGGGCACGGAGAAGGGGAAGGG - Intronic
997599962 5:135132343-135132365 TGGAGCCCGGAGGAGGGGTGTGG + Intronic
997673734 5:135696869-135696891 AGGAGCAGGGAGATGGGGCTGGG + Intergenic
999310540 5:150548951-150548973 GGGAGCAAGGAGACTGGGCGTGG + Intronic
1000056198 5:157608742-157608764 CGGAGCATGGAGAGAGGGCCTGG + Intergenic
1001022075 5:168191490-168191512 AGGACCACAGAGATGGGGCGGGG - Intronic
1001370596 5:171196626-171196648 CTGAGCAGGGGGATGGGGCGAGG + Intronic
1002449761 5:179311980-179312002 GGGAGGAGGGAGAAGGGGCATGG + Intronic
1002910468 6:1487427-1487449 CCCAGCACTGAGAAGGGGCCAGG + Intergenic
1006167095 6:32071396-32071418 GGGTGCTGGGAGAAGGGGCGAGG - Intronic
1006454336 6:34123342-34123364 CGGAGCATGGTGATGGGGAGGGG - Intronic
1006814150 6:36839503-36839525 AGGAGCGCGAAGAGGGGGCGTGG + Exonic
1007074066 6:39055709-39055731 GGGAGCACGGGGAGGGGGTGGGG + Intronic
1011607276 6:89117777-89117799 GGGGGCGCGGAGGAGGGGCGGGG - Intronic
1011698878 6:89937060-89937082 CTTATCAAGGAGAAGGGGCGGGG + Intronic
1015880576 6:137867057-137867079 CGGGGCAGGGAAAGGGGGCGGGG + Intergenic
1017282201 6:152637086-152637108 CGGGGCACGGAGCCGGGGAGGGG - Intronic
1017470389 6:154733207-154733229 CGGGGCGCGGGGAGGGGGCGAGG + Intergenic
1018911981 6:168106485-168106507 TGGAGGACGGAGGAGGGACGAGG + Intergenic
1019835748 7:3381477-3381499 CGCAGGACAGAGAGGGGGCGGGG + Intronic
1021380464 7:19959764-19959786 CTGAGCAGGAAGAAGAGGCGAGG - Intergenic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023012526 7:35936867-35936889 CGGGGTTCTGAGAAGGGGCGAGG + Intergenic
1025007465 7:55365698-55365720 CGGGCCACGGGGAAGGTGCGAGG + Exonic
1025258910 7:57404224-57404246 CGGGGCGAGGAGAAGGGGCGGGG + Intergenic
1028077311 7:86532996-86533018 CAGAGCACTGAGAGGGGGCATGG - Intergenic
1028593991 7:92528548-92528570 CGCAGCGGGGAGAGGGGGCGGGG - Intergenic
1031586350 7:123535154-123535176 AGCGGCAGGGAGAAGGGGCGGGG + Intergenic
1032062348 7:128735632-128735654 TGGAGCAGGAGGAAGGGGCGGGG + Intergenic
1032096065 7:128939023-128939045 CGGAGCACGCGGGAGGGGTGGGG + Intronic
1032686131 7:134235517-134235539 CAGAGCAGGGAAAAGGGGCTAGG - Intronic
1033449122 7:141447370-141447392 AGCAGCAAGGAGAAGGGGCCTGG + Intronic
1034349279 7:150405782-150405804 GGGGGCGGGGAGAAGGGGCGCGG + Intronic
1034621955 7:152463693-152463715 CGGGGCCCGCGGAAGGGGCGGGG + Intergenic
1035004447 7:155644769-155644791 CGGAGGACAGAGAAGGGAGGGGG - Exonic
1035319160 7:158017386-158017408 AGGAGCAGGGAGAAGGGTCTAGG + Intronic
1035476882 7:159149995-159150017 GGGAGCATGGAGAAGGGGAGAGG + Intergenic
1035598438 8:880163-880185 CAGTGGAGGGAGAAGGGGCGGGG - Intergenic
1035704058 8:1661337-1661359 AGGAGCACTGAGAAGAGGCAGGG + Intronic
1037928462 8:22863609-22863631 CAGAGCAGTGAGAAGGGGTGGGG - Intronic
1038349428 8:26762770-26762792 CAGAGCTCTGAGATGGGGCGTGG - Intronic
1038486519 8:27939237-27939259 ATGAGCAGGGAGAAGGGGCATGG - Intronic
1039048573 8:33472738-33472760 TGGAGCCCGGAGAAGGAGCGCGG - Intronic
1039546335 8:38413835-38413857 CTGAGCAGGGAGGAGGGGCCCGG - Intronic
1039900039 8:41745153-41745175 GGGAGAAAGAAGAAGGGGCGGGG + Intronic
1040007314 8:42631369-42631391 TGGTGCAGGGAGAAGGGGAGTGG - Intergenic
1042079941 8:65040633-65040655 CGGAGCCCGGAGCATGGGTGGGG - Intergenic
1042926968 8:73976457-73976479 CGGACGCCGGAGAAGGCGCGCGG - Exonic
1044632534 8:94293189-94293211 GGGAGCAGGGAGCAGGGGCAAGG + Intergenic
1048490157 8:134884904-134884926 AGCAGCACAGAGCAGGGGCGAGG - Intergenic
1049002959 8:139837770-139837792 GGGAGCACAGAGGAGGGCCGAGG - Intronic
1049016527 8:139924017-139924039 CCGAGCACGGGGAGGGGGCATGG + Intronic
1049343721 8:142127446-142127468 CGGGGCCCGGAGAATGGGAGTGG + Intergenic
1051894749 9:21975283-21975305 CGGAGGAAGGAAACGGGGCGGGG - Intronic
1053011829 9:34637887-34637909 GGGAGCACGGAGGAGTGGGGCGG + Intergenic
1053303022 9:36965059-36965081 TGGAGCAAGGAGAAGGGGTGTGG - Intronic
1057480353 9:95440502-95440524 GGGAGGAGGGAGAAGGGGGGAGG + Intergenic
1057995657 9:99820081-99820103 CGTTGAATGGAGAAGGGGCGGGG + Intergenic
1060675898 9:125514246-125514268 GGGAGCACAGAGAAGGGGACAGG - Intronic
1061057459 9:128232171-128232193 AGGAGCAGGGAGAAGGAGGGAGG - Intronic
1062115153 9:134804761-134804783 CGGAGCAAGGCCAAGGGTCGGGG - Intronic
1062564524 9:137158263-137158285 AGGAGCAGGGAGAAGGAGCAGGG + Intronic
1203761027 EBV:13063-13085 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203761956 EBV:16135-16157 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203762885 EBV:19207-19229 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203763814 EBV:22279-22301 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203764743 EBV:25351-25373 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203765672 EBV:28423-28445 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203766601 EBV:31495-31517 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1203767530 EBV:34567-34589 TGAAGCCCGGGGAAGGGGCGAGG - Intergenic
1187067627 X:15855494-15855516 CGCAGCACCGAGGATGGGCGAGG - Intergenic
1187298251 X:18023658-18023680 CGGAGAAGGGAGAAGGGGTGTGG - Intergenic
1187412260 X:19061834-19061856 GGCAGCAGGGAGAAGGGGCCTGG + Intronic
1189110574 X:38286029-38286051 AGGAGGAAGGAGAAGGGGAGGGG - Exonic
1189110584 X:38286056-38286078 GGGAGGAAGGAGAAGGGGAGGGG - Exonic
1189110601 X:38286101-38286123 AGGAGGAAGGAGAAGGGGAGGGG - Exonic
1189110620 X:38286155-38286177 GGGAGGATGGAGAAGGGGAGGGG - Exonic
1189110688 X:38286365-38286387 GGGAGGAAGGAGAAGGGGAGGGG - Exonic
1189310629 X:40014936-40014958 CGGAGCGCGGGGCGGGGGCGGGG - Intergenic
1195159441 X:102156351-102156373 TGGAACCCGGAGAAGGGGTGGGG + Intergenic
1195278779 X:103310233-103310255 TGGAGGACGAAGAAGGGGTGGGG + Intronic
1195343479 X:103926550-103926572 TGGAGCAGGGAGAAGGGGCTAGG + Intronic
1195363489 X:104106769-104106791 TGGAGCAGGGAGAAGGGGCTAGG - Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1196400575 X:115312005-115312027 CGGAGCACAGGGAGGGAGCGAGG - Intergenic
1200052829 X:153443986-153444008 CGGTGCACGGAGCAGAGGTGGGG - Intergenic
1200218576 X:154379593-154379615 CGGAGCACGAGGAGGGGGCCCGG - Intronic