ID: 1161232226

View in Genome Browser
Species Human (GRCh38)
Location 19:3180068-3180090
Sequence GGCCACCGGGAAGACCATGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161232226_1161232237 3 Left 1161232226 19:3180068-3180090 CCCCCATGGTCTTCCCGGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1161232237 19:3180094-3180116 CGGGGCTTCTGACGCCAAATGGG 0: 1
1: 0
2: 0
3: 5
4: 26
1161232226_1161232238 13 Left 1161232226 19:3180068-3180090 CCCCCATGGTCTTCCCGGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1161232238 19:3180104-3180126 GACGCCAAATGGGCTTCCCATGG 0: 1
1: 0
2: 0
3: 8
4: 79
1161232226_1161232236 2 Left 1161232226 19:3180068-3180090 CCCCCATGGTCTTCCCGGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1161232236 19:3180093-3180115 TCGGGGCTTCTGACGCCAAATGG 0: 1
1: 0
2: 0
3: 2
4: 63
1161232226_1161232241 28 Left 1161232226 19:3180068-3180090 CCCCCATGGTCTTCCCGGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1161232241 19:3180119-3180141 TCCCATGGTCACCCTGGACAAGG 0: 1
1: 0
2: 1
3: 17
4: 163
1161232226_1161232240 22 Left 1161232226 19:3180068-3180090 CCCCCATGGTCTTCCCGGTGGCC 0: 1
1: 0
2: 0
3: 12
4: 173
Right 1161232240 19:3180113-3180135 TGGGCTTCCCATGGTCACCCTGG 0: 1
1: 0
2: 4
3: 30
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161232226 Original CRISPR GGCCACCGGGAAGACCATGG GGG (reversed) Exonic
900374674 1:2348024-2348046 GGCCACGGGGAAGCCCAGGCTGG - Intronic
900534953 1:3172191-3172213 TCCAACCGGGAAGACCGTGGGGG - Intronic
900658991 1:3773511-3773533 TCCCACCGGGAGGCCCATGGTGG + Intronic
902148797 1:14425729-14425751 GGCCACTGGGAGGACCAAGTGGG - Intergenic
903340715 1:22652719-22652741 GGCCACTGGGAGGATAATGGAGG - Intergenic
903575319 1:24336303-24336325 GGCCACAGGGATGAGCAGGGAGG - Intronic
904079610 1:27863703-27863725 AGCCACCAGGGTGACCATGGGGG - Intergenic
904329791 1:29751123-29751145 GGCCTTTGGGAAGGCCATGGGGG - Intergenic
904803752 1:33116808-33116830 GGCCTCAGGGAATAGCATGGGGG + Intronic
907483163 1:54758558-54758580 GGCCACGGAGAAGACCAAAGCGG + Exonic
910216974 1:84852853-84852875 GGCAACTAGGAAGACAATGGTGG + Intronic
912031434 1:105249644-105249666 GGCCAAAGGGAAGGGCATGGTGG - Intergenic
912546979 1:110457940-110457962 AGCCTCCAGGAAGACTATGGTGG + Intergenic
912831404 1:112956675-112956697 GGCACCCGGGAAGACGCTGGGGG + Intronic
915211396 1:154312457-154312479 GGCCTGAGTGAAGACCATGGTGG - Intergenic
915212514 1:154321151-154321173 GGCCTGAGTGAAGACCATGGTGG - Exonic
922558229 1:226549044-226549066 GGCCACGGGGAAGGGCATGTAGG - Exonic
1062848483 10:725908-725930 GCCCACAGGGAGGACCAGGGAGG - Intergenic
1063094937 10:2900737-2900759 GCGCCCCGGGAAGACCATGCTGG + Intergenic
1064246079 10:13668684-13668706 GGACTCTGGGAAGACCAAGGAGG + Intronic
1065434841 10:25695336-25695358 GGACACAGGGCAGAGCATGGTGG - Intergenic
1065952206 10:30662546-30662568 GGCCACATCAAAGACCATGGAGG + Intergenic
1067728906 10:48794799-48794821 GGCCACCTGGAAGTCCCTGGTGG + Intronic
1069535298 10:69248516-69248538 GGCCACCGCGGTCACCATGGCGG - Exonic
1069686545 10:70322653-70322675 GGCCTCTGGGAAGCCCCTGGGGG - Intronic
1069841772 10:71344249-71344271 GGCCACCAGGCACAGCATGGAGG - Exonic
1069929709 10:71874229-71874251 GGCCACCTGGGAGATGATGGTGG - Intergenic
1070800599 10:79242686-79242708 GGCCGCCGGGAAGGCGCTGGCGG - Intronic
1072566437 10:96620535-96620557 GGCCGCCCGTCAGACCATGGAGG - Exonic
1075719517 10:124576601-124576623 GGCCTGGGGGCAGACCATGGAGG - Intronic
1076992017 11:280346-280368 GGGCATCGGCAAGACCATGGCGG + Exonic
1078637496 11:13065689-13065711 GGCCACTCTGAAAACCATGGGGG + Intergenic
1079428182 11:20363727-20363749 GGCCACCCGGAAGACCAAGCCGG + Exonic
1081422111 11:42881668-42881690 GGCCACATGGGAGCCCATGGAGG - Intergenic
1082014601 11:47475453-47475475 TGGCACCGGGAGCACCATGGAGG - Exonic
1083970399 11:66070707-66070729 GGCCACCGCCACGGCCATGGAGG - Exonic
1084410582 11:69004042-69004064 GGACACAGGCAGGACCATGGTGG + Intergenic
1084731102 11:71074174-71074196 GGGCACCGGGAAGGCCTTGCAGG - Intronic
1088568227 11:111195830-111195852 GGACACAGGGAAGAGAATGGAGG + Intergenic
1091587420 12:1824174-1824196 GGCCACCGAGGAGACCATGCTGG - Intronic
1098454071 12:70652674-70652696 GACCTCTGGGAAGACCTTGGTGG + Intronic
1099984329 12:89645755-89645777 GGCCAAAGGTAAGAACATGGGGG + Intronic
1104806148 12:131590741-131590763 GGTCACAGGGAGGACCCTGGAGG + Intergenic
1105816495 13:24040922-24040944 GCCCACTGGGAAGCCCCTGGGGG + Intronic
1116968074 14:51035617-51035639 TACCACCCGGAAGAACATGGTGG + Intronic
1121937807 14:98036665-98036687 GGCCACTGGGAAGAACACGTGGG - Intergenic
1122482312 14:102055097-102055119 GGCCTTCGGGAGGACCCTGGAGG + Intergenic
1122932930 14:104942991-104943013 GGCCCCAGGCAAGTCCATGGAGG - Exonic
1122933272 14:104944476-104944498 GGCCCCAGGGAAGTCCATGGAGG - Exonic
1122935256 14:104952891-104952913 GGCCCCAGGCAAGTCCATGGAGG - Exonic
1122977635 14:105177462-105177484 GGCCACCGGGACCATGATGGTGG - Intronic
1125735222 15:41920055-41920077 GGCCACCTGGCATCCCATGGGGG + Intronic
1129780780 15:78269268-78269290 GGGCACATGGAAGACCACGGAGG + Intronic
1131912634 15:97224532-97224554 GGCCACGCGGAAGCCCATGCGGG - Intergenic
1132436221 15:101805889-101805911 GGCCAGCAGGAAGTACATGGGGG - Exonic
1133455675 16:5940458-5940480 ACCCACCTGGAAAACCATGGGGG + Intergenic
1135651813 16:24212933-24212955 GGCCAGCGGGAAGACAAGGATGG - Intronic
1136936773 16:34475642-34475664 GACCACTGGTAAGACCAAGGGGG - Intergenic
1136963046 16:34872928-34872950 GACCACTGGTAAGACCAAGGGGG + Intergenic
1137058830 16:35765367-35765389 GGCCACTGTGAAGCCCATTGAGG - Intergenic
1141989498 16:87602287-87602309 GGCCCCGGGGAAGCCCAGGGCGG + Intronic
1144832623 17:18140030-18140052 GGCCCCGGGGAAGAGCTTGGGGG + Intronic
1152597697 17:81245974-81245996 GGCCACCGGCTGGACCATGGCGG - Exonic
1152684412 17:81687053-81687075 GGCCAACAAGCAGACCATGGAGG + Exonic
1152750629 17:82060906-82060928 GGCCAAGGTGAAGACCCTGGAGG - Exonic
1155175687 18:23299357-23299379 GCCCACCGGGAGGACCACTGAGG - Intronic
1155841138 18:30643896-30643918 GGTCACCAGAAAGACCAAGGCGG - Intergenic
1156377943 18:36531486-36531508 GGCCAGCAGGCAGAACATGGAGG - Intronic
1157342511 18:46791843-46791865 GGCAACTGGGAAGGCCAGGGTGG + Intergenic
1157563246 18:48663364-48663386 GCCCACTGGGGAGCCCATGGAGG - Intronic
1160020018 18:75173062-75173084 TGCCAGTGGGGAGACCATGGAGG + Intergenic
1160173350 18:76572621-76572643 GGCCACCGGGAACTTCATGATGG + Intergenic
1160523900 18:79524456-79524478 GGGCAGCGGGAAGGCCCTGGAGG + Intronic
1160710531 19:549136-549158 GGCCGCCAGGCAGACCATGCTGG - Exonic
1161232036 19:3179226-3179248 GGCCACCGGCCGCACCATGGTGG - Exonic
1161232226 19:3180068-3180090 GGCCACCGGGAAGACCATGGGGG - Exonic
1161571412 19:5032746-5032768 GGCCACCAGGAGGACAAAGGCGG - Intronic
1161614412 19:5261941-5261963 GGACACTGGGATGACGATGGTGG + Intronic
1163635673 19:18436206-18436228 GGCCACGGCGAAGAGCGTGGAGG + Exonic
1164720586 19:30429043-30429065 GGCTACCTGGATGACCATGCAGG + Intronic
1166909661 19:46143759-46143781 AGCCACAGGGAAGCCCTTGGAGG - Intronic
1167269476 19:48499202-48499224 GGGCGCCGGGGAGACCCTGGCGG - Exonic
1168412253 19:56147261-56147283 AGCCACCAGGAAGCCCAGGGAGG + Intronic
1168726084 19:58582872-58582894 AGGCTCCAGGAAGACCATGGAGG - Intergenic
925057141 2:864287-864309 GGCCATCGGCAAGGCCATGTGGG + Intergenic
925813460 2:7724110-7724132 CGCCAGGGGGAAGACCATGTAGG + Intergenic
925894847 2:8463262-8463284 GGCCACAGAGAAGACCCAGGTGG + Intergenic
928289449 2:30024746-30024768 GGCCCCTGGGAAGCCCCTGGAGG + Intergenic
932733348 2:74235911-74235933 GGCCACAGGGTAGACGTTGGGGG - Intronic
934048581 2:88191349-88191371 GGCCACCAGGGAGGCCATGGAGG + Intergenic
935536008 2:104295272-104295294 GGTCACCAGAAAGACCATAGTGG - Intergenic
936777198 2:115988013-115988035 GGCCACCAGGTAGAACATGAAGG + Intergenic
936923721 2:117715374-117715396 GGCTCCCAGGAAGACCAGGGAGG - Intergenic
938115730 2:128602011-128602033 GGCCAAGGGGAGGAACATGGAGG - Intergenic
942004042 2:171679799-171679821 GGCCAACGGGAAGCCCCAGGAGG + Intergenic
948880213 2:240852948-240852970 GGGCACGGGGCAGAGCATGGAGG + Intergenic
1169553600 20:6726660-6726682 AGACACTGGGCAGACCATGGGGG + Intergenic
1171180213 20:23085991-23086013 GGCCACTGTGAAGAGCAAGGAGG - Exonic
1175578683 20:60081878-60081900 GCCCACTGGAAAGACGATGGAGG + Intergenic
1177549141 21:22598079-22598101 GGCCACGTGGGAGCCCATGGTGG - Intergenic
1178343008 21:31801830-31801852 GGTCACCAGAAAGACCAAGGCGG - Intergenic
1181026915 22:20131979-20132001 GGCCACCGGGATGTACTTGGCGG - Exonic
1181271405 22:21660953-21660975 GGTCACCACGGAGACCATGGTGG - Intronic
1181944883 22:26508899-26508921 GGCCACAGGTGAGGCCATGGAGG + Intronic
1182745229 22:32600594-32600616 GCCCCACGGGAAGACCGTGGTGG - Intronic
1183460186 22:37945111-37945133 TGCCACAGGGAAGGACATGGAGG - Exonic
1183474481 22:38028358-38028380 GACCCCAGGGAAGACCATGTGGG - Intronic
1183579585 22:38715953-38715975 CGCCACAGTGAAGAGCATGGCGG + Exonic
1184231177 22:43159258-43159280 CGCCAGCGTGAAGCCCATGGCGG - Exonic
1185094633 22:48799644-48799666 GGCCTCCGGGAAGAACAGGCTGG + Intronic
1185222184 22:49634644-49634666 GGCCACCGTGGAGACCCAGGAGG + Intronic
1185272968 22:49937079-49937101 GGCCTCCGGGGAGAGCAGGGTGG + Intergenic
1185311076 22:50154644-50154666 GTCCACCTGGTAGGCCATGGCGG + Intronic
953607075 3:44419199-44419221 GGCCACAGGGCAGAGCACGGTGG + Intergenic
953881955 3:46695237-46695259 CCCCACAGGGAAGACCTTGGAGG - Intergenic
958095785 3:88942706-88942728 GGCCACCAGAAAAACCAAGGTGG + Intergenic
960875077 3:122287796-122287818 GGCCTCAGGGATGAGCATGGAGG - Intergenic
961478132 3:127161315-127161337 GGCCAGCGGGGAGACTACGGTGG - Intergenic
962326767 3:134440871-134440893 GGTCACTGGAAAGACCAAGGCGG - Intergenic
968914842 4:3492901-3492923 GGCCGCCGGGGAAGCCATGGTGG + Exonic
971308696 4:25505778-25505800 GGCCACGGCGAAGAGCGTGGAGG - Intergenic
975188477 4:71431474-71431496 GGGCATGGAGAAGACCATGGAGG + Intronic
978809133 4:112831092-112831114 GGCCACGCGGGAGCCCATGGAGG - Intronic
986661578 5:10064719-10064741 GGCCACCAGGAGGACCCTGAAGG - Intergenic
989823674 5:45827576-45827598 GGCCAATGGGGAGACCATGCAGG + Intergenic
991044089 5:62204935-62204957 GGCCACCGGGAACCCACTGGTGG - Intergenic
997084208 5:130777485-130777507 GTCTACCGGGAAGAGCATGAGGG - Intergenic
999233561 5:150077277-150077299 TACCACCCGGAAGAACATGGAGG + Exonic
999319062 5:150602034-150602056 GGCCATCGGGGAGACAGTGGTGG + Intronic
1006075333 6:31529010-31529032 GGGCAGAGGGAGGACCATGGCGG - Exonic
1007179102 6:39915621-39915643 GGGCACAGGGATAACCATGGGGG + Intronic
1007577389 6:42934515-42934537 GGAAACCGGCAAGACCAAGGAGG + Exonic
1013957283 6:115855486-115855508 GGCCACGCGGAAGCCCACGGTGG - Intergenic
1016322162 6:142857956-142857978 GGCCATCAGGAAGCCAATGGTGG - Intronic
1016329947 6:142945357-142945379 GGCCACCGGGAAGGGGCTGGGGG + Intergenic
1017325129 6:153133909-153133931 GGCCGCAGGGGAGCCCATGGAGG - Intergenic
1018223663 6:161606938-161606960 GGCCACCTGGCACAGCATGGGGG + Intronic
1020013181 7:4817295-4817317 GGCCAGCGAGGAGGCCATGGCGG - Exonic
1020121608 7:5507223-5507245 GGCAACCGTGAAGGCCATGGAGG + Intronic
1022315527 7:29241560-29241582 GCCTACCAGGCAGACCATGGGGG + Intronic
1025999427 7:66549622-66549644 GGCCTCAGGGAGGATCATGGGGG + Intergenic
1026294846 7:69042240-69042262 GGCCAATGGGAAGACCAGGAGGG - Intergenic
1031177602 7:118372333-118372355 GGCCACCTGGGAGACTATGGTGG - Intergenic
1032051746 7:128654313-128654335 GGCCACCGGGAGGCCCAAGCTGG - Intergenic
1034419045 7:150979413-150979435 GGGCCCCGGGAAGGCCAGGGCGG + Intergenic
1034509735 7:151523954-151523976 GGTCAACGTGAAGACCAAGGTGG + Intergenic
1035926999 8:3738906-3738928 GGACAGAGGGAAGACCATGGAGG - Intronic
1036594587 8:10200476-10200498 GTCCCCCAGGAAGGCCATGGTGG - Intronic
1040980139 8:53238536-53238558 GAGCACCGGGAAGGCTATGGTGG + Intronic
1042814543 8:72864275-72864297 GTCCACCCAGAAGACAATGGTGG + Intronic
1043844945 8:85152900-85152922 GGCCACGCGGGAGCCCATGGGGG - Intergenic
1049180323 8:141218905-141218927 GGACACCGTGAAGATGATGGCGG + Exonic
1049371121 8:142267883-142267905 GGCACCCGGGAAGACCTTGAGGG - Intronic
1049905839 9:215312-215334 GGCCACCTGTAAGAACCTGGAGG - Exonic
1053011383 9:34635743-34635765 GGCCAGCGCGAAGGCCAGGGTGG + Exonic
1059339177 9:113587823-113587845 GGCCAGCTGGAGAACCATGGCGG - Intronic
1059415866 9:114162224-114162246 GGTCAGCGGGAAGACCAGGCTGG - Intronic
1060389627 9:123267700-123267722 GGCCACCGGGACGCCCGTGAAGG - Intronic
1060547004 9:124467800-124467822 GGCCACCAGGAAGAGCAAGAAGG - Exonic
1060941499 9:127545480-127545502 GGTCACCAGGGAGGCCATGGTGG + Intronic
1062280700 9:135750481-135750503 GGCCACAGGGGAGACCTTGCTGG - Intronic
1189509924 X:41652534-41652556 GGTCACAGGAAAGACCAAGGAGG + Intronic
1189536142 X:41937127-41937149 GGCCAACGGGAAGCCCCTGTAGG + Intergenic
1195349977 X:103986447-103986469 GGCCAACGGGAAGAGCATTCAGG + Intergenic
1195357466 X:104052392-104052414 GGCCAACGGGAAGAGCATTCAGG - Intergenic
1196441948 X:115726559-115726581 TGCCAGCGGAAAGTCCATGGGGG - Intergenic
1196442609 X:115729529-115729551 TGCCAGCGGAAAGTCCATGGGGG - Intergenic
1196445940 X:115846271-115846293 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196446611 X:115849252-115849274 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196447279 X:115852235-115852257 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196447950 X:115855214-115855236 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196448619 X:115858205-115858227 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196449290 X:115861196-115861218 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196449959 X:115864179-115864201 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196450629 X:115867164-115867186 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196451300 X:115870143-115870165 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196451971 X:115873130-115873152 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196452641 X:115876099-115876121 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196453311 X:115879092-115879114 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196453981 X:115882101-115882123 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196454647 X:115885090-115885112 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1196455061 X:115887172-115887194 TGCCAGCGGAAAGTCCATGGGGG + Intergenic
1199746053 X:150772476-150772498 GGCCTCTGGGAAGCCTATGGAGG + Intronic
1200209470 X:154340771-154340793 GGCCACCCTGAAGACCTTGGTGG + Intergenic
1200216658 X:154371137-154371159 GGCCACCGAGAAGGACCTGGCGG - Exonic
1200221406 X:154391357-154391379 GGCCACCCTGAAGACCTTGGTGG - Intronic