ID: 1161233979

View in Genome Browser
Species Human (GRCh38)
Location 19:3189000-3189022
Sequence CCTCCGGGTAGTGGGCCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161233979_1161233989 0 Left 1161233979 19:3189000-3189022 CCCCCGGGCCCACTACCCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1161233989 19:3189023-3189045 AGCTGCAACCCTTACTCGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 80
1161233979_1161233988 -1 Left 1161233979 19:3189000-3189022 CCCCCGGGCCCACTACCCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1161233988 19:3189022-3189044 GAGCTGCAACCCTTACTCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1161233979_1161233990 1 Left 1161233979 19:3189000-3189022 CCCCCGGGCCCACTACCCGGAGG 0: 1
1: 0
2: 0
3: 2
4: 100
Right 1161233990 19:3189024-3189046 GCTGCAACCCTTACTCGCTGGGG 0: 1
1: 0
2: 1
3: 10
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161233979 Original CRISPR CCTCCGGGTAGTGGGCCCGG GGG (reversed) Intronic
900526798 1:3133329-3133351 CCTCGGGGCTGTGGGCCTGGGGG + Intronic
901878703 1:12181524-12181546 GGTCAGGGTAGTGGGTCCGGGGG - Intronic
902067557 1:13700487-13700509 CCTCCGGGTCGGTGGCCCCGCGG + Intronic
903214588 1:21836785-21836807 GCTCCGGTGAGTGGGGCCGGGGG - Exonic
904346952 1:29879017-29879039 CCTCTGGGCAGGGGGCCCAGGGG - Intergenic
904447843 1:30588918-30588940 CCTCTGGGCGGTGGGCCCAGGGG + Intergenic
908128309 1:61051008-61051030 GCTCCGGAGAGTGGCCCCGGCGG + Intronic
915467817 1:156107504-156107526 CCTCCTGGAAGTGGGCTGGGGGG + Intronic
924064271 1:240207642-240207664 GCTCCGGGTAGAGGGGGCGGAGG - Exonic
924064337 1:240207807-240207829 GCTCCGGGAAGTGGGGGCGGAGG - Exonic
924064377 1:240207906-240207928 GCTCCGGGAAGTGGGGGCGGAGG - Exonic
924064391 1:240207939-240207961 GCTCCGGGAAGTGGGGGCGGAGG - Exonic
924064431 1:240208038-240208060 GCTCCGGGAAGTGGGGGCGGAGG - Exonic
924064459 1:240208104-240208126 ACTCCGGGTAGAGGGGGCGGAGG - Exonic
924064471 1:240208137-240208159 GCTCCGGGTAGAGGGGGCGGAGG - Exonic
924064524 1:240208269-240208291 GCTCCGGGAAGTGGGGGCGGAGG - Exonic
1066697821 10:38094468-38094490 CGTCCGGGTAGAGGACGCGGAGG + Exonic
1069833274 10:71293891-71293913 CCTCCAGGCAGTAGACCCGGAGG - Exonic
1070319265 10:75342652-75342674 CCTCCCGGTGGTGGGGCGGGGGG + Intergenic
1076550994 10:131278088-131278110 CCTGAGGCCAGTGGGCCCGGGGG - Intronic
1089705761 11:120276404-120276426 CCTCAGGGTAGTGGGTCCAATGG + Intronic
1093662565 12:21774548-21774570 ACTCCGGGTAGCGGGCGCGGCGG + Exonic
1099688229 12:85916785-85916807 CCTCAGAGCAGTGGGCCCAGAGG - Intergenic
1102056493 12:109900373-109900395 CCTGCGGGAAGTCGGGCCGGGGG + Intronic
1102124486 12:110469075-110469097 CCCCCGGGTCGTGAGCCCCGTGG + Intronic
1103718761 12:122962197-122962219 CACCCGGGAAGTGGGCCTGGAGG + Intronic
1103800195 12:123533128-123533150 CGTCCGGGCAGTGGGACCGCGGG - Intronic
1105512325 13:21061218-21061240 GCTCCGGGAAGGGCGCCCGGCGG - Intronic
1106236184 13:27862476-27862498 CCCCTGGGTTGTGGGCCCAGAGG + Intergenic
1108727634 13:53200406-53200428 CCACCGGGATCTGGGCCCGGGGG - Intergenic
1113369084 13:109706181-109706203 CCTCAGGGTAGGGGGGCCTGTGG + Intergenic
1117957914 14:61136892-61136914 CCTGCGGGAGGTGGGCCTGGAGG + Intergenic
1118724587 14:68620010-68620032 CCCCGGGGTAGTGGCCCTGGAGG - Intronic
1119385971 14:74258389-74258411 CCGCGGGGGAGGGGGCCCGGAGG + Intronic
1120800813 14:88686443-88686465 CCTCCGGGCTGTGGGCCCAGAGG - Intronic
1122688994 14:103522749-103522771 CGCCCGGTGAGTGGGCCCGGGGG - Exonic
1123948937 15:25252218-25252240 CCACCAGGTGGTGAGCCCGGAGG + Intergenic
1129803882 15:78438296-78438318 CCTCCGGGGAGGGGGCCAGCGGG - Exonic
1140113240 16:72021212-72021234 CCACCAGGTAGTCGGCCAGGGGG - Exonic
1141677459 16:85525128-85525150 CCTGAGGGCAGTGGGCCAGGGGG + Intergenic
1142713173 17:1734270-1734292 CCTCCAGGAAGGGGGCCCGAGGG + Intronic
1142810637 17:2394027-2394049 CATCCAGGTATGGGGCCCGGAGG - Exonic
1147547235 17:41411478-41411500 TCTCCAGGTAGTTGGCCAGGCGG + Intergenic
1147548878 17:41424163-41424185 TCTCCAGGTAGTTGGCCAGGCGG + Exonic
1147550861 17:41440561-41440583 TCTCCAGGTAGTTGGCCAGGCGG + Exonic
1147557645 17:41489537-41489559 TCTCCAGGTAGTTGGCCAGGCGG + Exonic
1148317665 17:46717735-46717757 CGTTCGGGGAGTGGGCCTGGTGG + Intronic
1148774600 17:50088376-50088398 GCTCGGGGAAGGGGGCCCGGAGG - Intronic
1152562000 17:81083255-81083277 CCTCTGGGGCGTGGGACCGGCGG + Intronic
1153365603 18:4252115-4252137 CCTTCAGGGAGTTGGCCCGGTGG + Intronic
1154303886 18:13217447-13217469 CCTGCGGGGGGCGGGCCCGGAGG - Intergenic
1161103148 19:2431308-2431330 CCTCAGGGTAGCTGGCCAGGGGG - Intronic
1161233979 19:3189000-3189022 CCTCCGGGTAGTGGGCCCGGGGG - Intronic
1161493338 19:4574803-4574825 CCTCCGGGGAGGGGGCCCCCAGG + Intergenic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1164685132 19:30161493-30161515 CCTGCAGCTAGTGGTCCCGGGGG - Intergenic
1166373189 19:42313610-42313632 CCTCGGGGGAGTGGGGCCGAGGG + Intronic
1167270397 19:48502625-48502647 TCTCCAGCTAGTCGGCCCGGAGG + Intronic
926060471 2:9801692-9801714 GCTCCGGGAGGTGGGCCCCGGGG - Intergenic
926718572 2:15942533-15942555 CCTGCGGGTCGCGGGCACGGCGG + Exonic
926730195 2:16030687-16030709 CCTCTGGGTGGTGGGTCCGCAGG - Intergenic
931748864 2:65313773-65313795 CGTCCTGGCAGTGGCCCCGGCGG + Exonic
938937031 2:136136195-136136217 GCTCCTGGTAGTGGGCACAGAGG - Intergenic
1168883601 20:1226735-1226757 CCTCCGGGACGTGGGGCGGGAGG + Intronic
1176096595 20:63347191-63347213 GCTCCGGGAAGGGGGCACGGGGG + Intronic
1179186316 21:39087617-39087639 CCTCCGGATGGCCGGCCCGGTGG - Intergenic
1179715182 21:43282656-43282678 CCTCCTGGTCCTGGGCCCCGTGG + Intergenic
1180185761 21:46138492-46138514 CCTCCAGGTAGGGGGGCCCGGGG - Exonic
1181175188 22:21031302-21031324 AGTCCGGGTAGTGGCCCAGGAGG + Exonic
1181279825 22:21711423-21711445 CGCCCGGTGAGTGGGCCCGGTGG + Intronic
1181469506 22:23129109-23129131 CCTCTGGGTGGGGGGCCTGGGGG - Intronic
1181512668 22:23395829-23395851 CCTCCGTGGAGTGGGCTGGGTGG - Intergenic
1184504603 22:44893318-44893340 CCTCCTGGGAGTGGGGCTGGGGG - Intronic
1184523246 22:45007890-45007912 CCTCCCCGGAGGGGGCCCGGAGG + Intronic
1185069643 22:48649052-48649074 GGTCCAGGTAGTGGGCCCTGGGG - Intronic
950407843 3:12815795-12815817 CCTCCTGGTAGTGGGCAGGTGGG + Intronic
961821535 3:129577935-129577957 CCACGGGGCAGTGGGCTCGGCGG + Intronic
964674104 3:159258349-159258371 CCTCTGGCTAGTCAGCCCGGGGG + Intronic
967098049 3:186193713-186193735 CCGCCGGGGAGCGGGCCCCGGGG - Intronic
967887342 3:194342144-194342166 CCTCCGGGAGCTGGGCCAGGAGG + Exonic
968124127 3:196145929-196145951 CCTCTGGGTAGTGGCCACAGAGG + Intergenic
968742976 4:2340673-2340695 CCTCCGTGGAGTGGGTCCTGGGG - Intronic
969529962 4:7725158-7725180 CCTCCAGGTAGAGGGCCTGCAGG - Exonic
971009871 4:22422059-22422081 CCTCCAGCGAGTGGGCCTGGTGG - Intronic
985538929 5:478890-478912 CCTCCTGGCAGAGGGCACGGGGG - Intronic
1019486336 7:1291087-1291109 CCTGCAGGTCCTGGGCCCGGGGG - Intergenic
1019508070 7:1403478-1403500 CCTCCGGGTAGTGAAGCTGGGGG - Intergenic
1019525890 7:1480343-1480365 GCTCCGGGTGCTGGGCCCTGAGG - Exonic
1019537577 7:1537265-1537287 ACGGCGGGCAGTGGGCCCGGGGG + Intronic
1020125530 7:5530828-5530850 CCTTGGGGTGCTGGGCCCGGGGG + Intronic
1024054009 7:45648147-45648169 CCTCCTGGGAGTGTGCCCTGTGG + Intronic
1029528285 7:101108787-101108809 ACTCCGGGAACTGGGCCCAGGGG - Intergenic
1038446714 8:27609682-27609704 CCTCTGCGAAGTGGGCACGGCGG - Intronic
1039921208 8:41895905-41895927 GCTCCGGGGAGCGGGCCGGGGGG - Intronic
1049761327 8:144333095-144333117 CGTCCGGGTGGAGGGGCCGGAGG - Exonic
1050115621 9:2260528-2260550 CCTCTGTGTAGTGTCCCCGGGGG + Intergenic
1055347724 9:75355251-75355273 CCTGGGGGTGGTGGGCCTGGAGG + Intergenic
1060280620 9:122213552-122213574 CCTGCGGGGAGGGGGCGCGGAGG - Intronic
1062400419 9:136370278-136370300 CCTCCGGGTAGGAGGGCAGGCGG - Exonic
1186575308 X:10759327-10759349 CCTCTTGGTAGTGGGCCAAGTGG + Intronic
1187241681 X:17519752-17519774 CCTCAGGATGGTGGTCCCGGTGG - Intronic
1189234115 X:39474627-39474649 CCTCCTGCCAGTGGGGCCGGTGG - Intergenic
1192125494 X:68497774-68497796 CCTCAGGGAAGTGGGACGGGAGG + Intergenic