ID: 1161234451

View in Genome Browser
Species Human (GRCh38)
Location 19:3190921-3190943
Sequence TGTCCCCAGCTGAACGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161234447_1161234451 -10 Left 1161234447 19:3190908-3190930 CCACTGAGGTCCGTGTCCCCAGC 0: 1
1: 0
2: 0
3: 19
4: 187
Right 1161234451 19:3190921-3190943 TGTCCCCAGCTGAACGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 123
1161234445_1161234451 7 Left 1161234445 19:3190891-3190913 CCGGCTTCTGGGGTGGTCCACTG 0: 1
1: 0
2: 0
3: 14
4: 126
Right 1161234451 19:3190921-3190943 TGTCCCCAGCTGAACGTGGGTGG 0: 1
1: 0
2: 0
3: 7
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161234451 Original CRISPR TGTCCCCAGCTGAACGTGGG TGG Intronic
901021457 1:6258023-6258045 TATCTCCAGCTCAAGGTGGGGGG + Intronic
903671840 1:25040647-25040669 TGACCCCAGCTGAGCGGGGAGGG - Intergenic
904297775 1:29532906-29532928 TGTCTCCAGCTGTTGGTGGGAGG - Intergenic
906515483 1:46436573-46436595 TCTCCCCAGCTGTAAATGGGAGG - Intergenic
907452306 1:54553376-54553398 TGTGCCCAGTTGAACCTGGGAGG + Intronic
917498926 1:175568143-175568165 TGTCCACAGCTGGACCTGAGTGG - Intronic
920884166 1:209910424-209910446 TGTCCCCAGCTGGACATGCTAGG - Intergenic
923367084 1:233273342-233273364 TGGCCACAGCTCAAAGTGGGAGG + Intronic
924584162 1:245347060-245347082 TGTGCCCAGCTGAGCCTGGGTGG + Intronic
924941406 1:248814596-248814618 TGTCTCCTGCTGAGCCTGGGGGG + Exonic
1062958308 10:1554502-1554524 CGTCACCAGCAGAACTTGGGGGG - Intronic
1063975700 10:11413811-11413833 TGTGCCCAGCTGAAACTTGGTGG - Intergenic
1067318870 10:45198760-45198782 GGTCCCCAGCTGCAGGAGGGCGG - Intergenic
1067337180 10:45375000-45375022 TTTCCCCAGCTGAAAATGGAGGG + Intronic
1073106715 10:101036476-101036498 TGTCCCCAGCTGCCTGTGGGTGG - Exonic
1073115339 10:101088599-101088621 TGGCCACAGCTGAACGTGTTGGG - Intergenic
1078096045 11:8297984-8298006 GGTCCCCAGCTGAGGGTGGACGG + Intergenic
1084152910 11:67299540-67299562 TGTCACCAGCTCCACGTTGGTGG - Exonic
1085127133 11:74009354-74009376 TGTGCCCAGCCTATCGTGGGAGG - Exonic
1089175959 11:116549085-116549107 TCACCCCAGCTGGAGGTGGGAGG + Intergenic
1091626147 12:2122399-2122421 TGCTGCCAGCTGAAGGTGGGGGG + Intronic
1100197211 12:92260480-92260502 TGACCCCAGGTGAAGGAGGGAGG - Intergenic
1101037555 12:100720182-100720204 TGTCCCCACCTGAACCAGGAAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1107123649 13:36821088-36821110 TATACCCAGCTGTACTTGGGAGG + Intronic
1115152139 14:30297843-30297865 ATTCCCTAGCTGAAAGTGGGTGG - Intergenic
1118346387 14:64944235-64944257 TGTCCCCTGCTGAAGCTGGGTGG + Intronic
1118733034 14:68682699-68682721 TATGTCCAGCTGATCGTGGGGGG - Intronic
1121242318 14:92439747-92439769 TGTCACCAGCTGCAAGTGGCAGG + Intronic
1121553466 14:94819505-94819527 TGGCCCCAGCGGCACCTGGGAGG + Intergenic
1122422489 14:101586493-101586515 TGTCCCCAACTGCAGGTGAGTGG - Intergenic
1122694765 14:103547234-103547256 TGCCTCTAGCTGAACGTGCGAGG - Intergenic
1124527542 15:30471142-30471164 TCCCCGCAGCTGGACGTGGGCGG + Intergenic
1124771117 15:32536560-32536582 TCCCCGCAGCTGGACGTGGGCGG - Intergenic
1128711606 15:69876271-69876293 TGGCCCCAGGGGAGCGTGGGAGG - Intergenic
1141035389 16:80621549-80621571 TGTCCCCATCTATAAGTGGGTGG + Intronic
1141645544 16:85365435-85365457 TGTTCCCAGCTTGACCTGGGAGG - Intergenic
1142133572 16:88441760-88441782 AGACCCCAGCAGAACCTGGGCGG + Intergenic
1142230300 16:88897001-88897023 TGTCCCCAGCTGAGGATTGGGGG + Intronic
1145060980 17:19733526-19733548 TGCCCCCAGCCGAAGGTGGGAGG - Intergenic
1145878839 17:28339606-28339628 TATGTCCAGCTCAACGTGGGCGG + Exonic
1148664740 17:49365899-49365921 TGTCAGCAGCTGAACAAGGGAGG - Intergenic
1151600986 17:75105895-75105917 TGACGCCAGCTGGACGTGGCTGG - Exonic
1151959783 17:77399591-77399613 TTTCCCCATCTGTACGGGGGCGG + Intronic
1152544081 17:80992073-80992095 TTTCCCCATCCGAACGCGGGGGG - Intronic
1153304886 18:3622484-3622506 TGTCCCCTGGGGAATGTGGGAGG + Intronic
1154340498 18:13498591-13498613 TGTCCACAGCAGGACGTGTGTGG - Intronic
1154340511 18:13498671-13498693 TGTCCACAGCAGGACGTGTGTGG - Intronic
1154340687 18:13499745-13499767 TGTCCACGGCTGGACGTGTGTGG - Intronic
1154475097 18:14747890-14747912 GGTCCCCAGCTGCAGGAGGGCGG + Intronic
1160763192 19:796042-796064 TTTCCCCAGCTGTAGGCGGGTGG + Intergenic
1160763263 19:796337-796359 TTTCCCCAGCTGTAAGCGGGCGG + Intergenic
1160763275 19:796389-796411 TTTCCCCAGCTGTAGGTGAGAGG + Intergenic
1160763288 19:796441-796463 TTTCCCCAGCTGTAGGCGGGCGG + Intergenic
1160763313 19:796543-796565 TTTCCCCAGCTGTAGGTGAGAGG + Intergenic
1160763326 19:796595-796617 TTTCCCCAGCTGTAGGCGGGCGG + Intergenic
1160763339 19:796647-796669 TTTCCCCAGCTGTAGGCGGGCGG + Intergenic
1161234451 19:3190921-3190943 TGTCCCCAGCTGAACGTGGGTGG + Intronic
1162943525 19:14028502-14028524 TGTCCCTGGCTGAATGTGGCAGG - Intronic
1164555494 19:29248007-29248029 CGTGGCCAGCTGAATGTGGGCGG + Intergenic
1167357374 19:49012179-49012201 TGGGCCCAGCTGAAACTGGGCGG + Intronic
1168169016 19:54574165-54574187 CATCCCCAGCTGCACGGGGGTGG - Intronic
1168171791 19:54594530-54594552 CATCCCCAGCTGCACGGGGGTGG - Intronic
925296859 2:2783044-2783066 TGTCTCCCTCTGAACGTGAGTGG - Intergenic
929925534 2:46204049-46204071 TGTTATCAGCTGAACATGGGTGG - Intergenic
931749916 2:65321245-65321267 TGGCCCCAGCTGACACTGGGAGG + Intronic
932076588 2:68669955-68669977 GGTCCTCAACTGAAGGTGGGAGG - Intergenic
934517289 2:94996693-94996715 TCTCCCCAGCTGGAGGTCGGCGG - Intergenic
938528989 2:132163715-132163737 GGTCCCCAGCTGCAGGAGGGTGG + Intronic
940569816 2:155417049-155417071 AGTCCCCACCTGAAGTTGGGTGG + Intergenic
942320243 2:174730177-174730199 TGACCCCGGCTGGACGTGCGTGG + Intergenic
942651875 2:178177685-178177707 TGTGACCAGCTGAACATTGGTGG - Intergenic
948676650 2:239600865-239600887 TGTCCCCCTCTGAAGGTGAGCGG - Intergenic
1171354835 20:24536139-24536161 TGTCCCCAGCAGAACCAGAGGGG + Intronic
1175528128 20:59650617-59650639 TGTCCCCAGCTCAACGGGATAGG - Intronic
1175721982 20:61293173-61293195 TGTCCCCACATGAACGTAGTAGG + Intronic
1175749157 20:61483289-61483311 TGGGCCCAGCTGAACGTTGAAGG - Intronic
1176094182 20:63332419-63332441 TGTCCCCAGCTGAACTGAGAAGG + Intronic
1176237525 20:64060648-64060670 TGTCCCCAGCTCACTGTGAGGGG + Intronic
1176767519 21:13036201-13036223 GGTCCCCAGCTGCAGGAGGGTGG - Intergenic
1178955541 21:37018245-37018267 TGTCCCCAAGAGAACGTGAGGGG - Exonic
1180046807 21:45310350-45310372 TGTCCACAGGTGGAGGTGGGTGG + Intergenic
952865989 3:37855511-37855533 TGAGCCCAGCTGAATGTGGAAGG - Intergenic
956779338 3:72591886-72591908 AGTTCCCAGCTGCATGTGGGTGG + Intergenic
960873389 3:122273673-122273695 GGTCCCCAGCAGGAAGTGGGAGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
965521327 3:169670234-169670256 TGTCCACAGCTGAAAGGGGAAGG - Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
968284722 3:197501798-197501820 TGTGCTCAGCTGAACATTGGTGG + Intergenic
968548346 4:1210023-1210045 TGTCTCCAGCTGGAGCTGGGAGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
984161049 4:176252339-176252361 TGTCCCTAGCTGAATGTTGCGGG - Intronic
990567086 5:57040939-57040961 TTTCCCCAGCTGAAGGAGGGAGG - Intergenic
992876925 5:81065496-81065518 TGTCCCCAGCTGACAGTGCAAGG - Intronic
996798414 5:127376120-127376142 TGTCCCCAACTGAAAGTGAAGGG - Intronic
999316247 5:150585891-150585913 TGGCCCCAGAGGAACTTGGGAGG + Intergenic
999322710 5:150625074-150625096 TTTCCCCATCTGTAGGTGGGGGG + Intronic
1000179150 5:158790981-158791003 TGTCCCCTTCTGACTGTGGGAGG + Intronic
1004576524 6:16901062-16901084 TGTCCCCAGCAGACTGTGAGTGG + Intergenic
1005452975 6:25992053-25992075 TGTCCCCAGCTGGAGCAGGGCGG + Intergenic
1007074739 6:39059253-39059275 TTTCCCCATCTGAAAATGGGAGG - Intronic
1007151097 6:39692057-39692079 TTTCTTCACCTGAACGTGGGAGG + Intronic
1008362775 6:50641441-50641463 TGTCCACTGCTGTAGGTGGGTGG - Intergenic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1012611528 6:101225969-101225991 TCTCCCCAGGTGAACGGGTGTGG - Intergenic
1018639225 6:165891447-165891469 TCTCCCTGGCTGAACCTGGGAGG - Intronic
1018951729 6:168382772-168382794 TGTCCACAGCTGGATGGGGGTGG - Intergenic
1020016455 7:4834658-4834680 TGTGCCCGGCTGGAAGTGGGTGG + Exonic
1023861174 7:44218420-44218442 AGCCCCCAGCTGAAGCTGGGAGG - Exonic
1034117338 7:148594955-148594977 TGTCCCCATCTGAACATGCTTGG + Intronic
1037643968 8:20773492-20773514 TGTGCACAGCTGGACCTGGGCGG + Intergenic
1037894064 8:22640297-22640319 TAGTCCCAGCTGTACGTGGGAGG - Intronic
1039416201 8:37396391-37396413 TATCCTCAGCTGGATGTGGGAGG + Intergenic
1039615114 8:38949358-38949380 TCTCCCCAGCAGAACGGGAGAGG - Intronic
1043525693 8:81094283-81094305 TGCCCCCATCTGAATGTGTGAGG - Intronic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1046699836 8:117387918-117387940 TGTCCCCAGTGGAACATGGCTGG + Intergenic
1048080536 8:131121834-131121856 TTTCCCCAGAGGAAAGTGGGAGG - Intergenic
1048631425 8:136247136-136247158 TCTCCCCAGCTGAGTGTGAGGGG + Intergenic
1049657293 8:143804518-143804540 TGCCCACAGCTGAAGCTGGGTGG + Intronic
1049771242 8:144383026-144383048 AGAGCCCAGCTGAATGTGGGGGG + Intronic
1052904124 9:33818224-33818246 TTTCCCCCGCTGAGGGTGGGTGG + Intronic
1053610482 9:39708470-39708492 TGTACACAGCTGAAAGTGCGCGG + Intergenic
1054087770 9:60762686-60762708 TGTACACAGCTGAAAGTGCGTGG - Intergenic
1054243041 9:62633925-62633947 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1054557165 9:66668443-66668465 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1056008846 9:82303525-82303547 GGTCCCCAGCTGATCCTGGCTGG + Intergenic
1061632057 9:131878569-131878591 TGTCCCCTGCCTAACCTGGGTGG + Intronic
1062190611 9:135246061-135246083 TTTCCCCAGATGTACGTGGAGGG - Intergenic
1198493943 X:137171493-137171515 TTTTCTCAGCTGAATGTGGGGGG + Intergenic
1200110262 X:153737338-153737360 TGTCCCTAGATGTACGTGGCAGG + Intronic