ID: 1161234475

View in Genome Browser
Species Human (GRCh38)
Location 19:3191001-3191023
Sequence CGCGGTGTGTGGCGGGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 2, 1: 1, 2: 2, 3: 9, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161234466_1161234475 10 Left 1161234466 19:3190968-3190990 CCAGGGTCTTTCCAGGGCAACTC 0: 1
1: 0
2: 3
3: 17
4: 161
Right 1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG 0: 2
1: 1
2: 2
3: 9
4: 203
1161234469_1161234475 -1 Left 1161234469 19:3190979-3191001 CCAGGGCAACTCAGGTGGCCATC 0: 1
1: 0
2: 0
3: 15
4: 157
Right 1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG 0: 2
1: 1
2: 2
3: 9
4: 203
1161234463_1161234475 20 Left 1161234463 19:3190958-3190980 CCGGTGCTCTCCAGGGTCTTTCC 0: 1
1: 0
2: 1
3: 27
4: 238
Right 1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG 0: 2
1: 1
2: 2
3: 9
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161234475 Original CRISPR CGCGGTGTGTGGCGGGCAGC AGG Intronic
900427231 1:2586345-2586367 TGCGGCGGGAGGCGGGCAGCCGG - Intergenic
900632707 1:3645446-3645468 CGTGGTGTGCGCCGTGCAGCGGG + Intronic
900740581 1:4328529-4328551 CCGGGTGTGTGGAGGGCACCTGG + Intergenic
901762587 1:11480197-11480219 CGCAGTGAGTGGGGGACAGCGGG - Intronic
903759641 1:25689012-25689034 CGCAGTGGGTGGCTGGCACCTGG + Intronic
903833458 1:26188500-26188522 CTCGGTGAGTGGGGGGCTGCCGG + Exonic
904326359 1:29729124-29729146 TGCCGTGTGTGGTGGGCAGGAGG - Intergenic
904775381 1:32902794-32902816 CGCTGTGTGTGTTGGGCAGTTGG + Intergenic
905874613 1:41423968-41423990 TGGGGTGTGGGGCTGGCAGCTGG - Intergenic
906263085 1:44407652-44407674 CGCGGTGTGCGGCGGCCGGACGG + Intronic
908543708 1:65145648-65145670 AGCAGTGTTTTGCGGGCAGCGGG - Intergenic
910261053 1:85294286-85294308 CGTGGTGTGTGAGGGGCAGAGGG - Intergenic
910429021 1:87143031-87143053 CGCTGTGTGAGGAGGGCGGCAGG - Intronic
913274131 1:117121557-117121579 CGCGCAGTGGGGCGGGCGGCGGG - Exonic
919750503 1:201034779-201034801 GGCGGGGTGTGGCTGGCAGGAGG - Intergenic
920164458 1:204025926-204025948 CCTGGTGTGTGCCAGGCAGCAGG - Intergenic
920399667 1:205669134-205669156 CTCGGTGTGTGGCGAGCACGTGG - Intronic
921389656 1:214605758-214605780 CGCTGTGGGTGGAGGGCACCAGG - Intronic
922175079 1:223190394-223190416 CCAGGTGGGTGGCGGGCAGAAGG - Intergenic
923127052 1:231041170-231041192 CGCGGCGAGTGGGAGGCAGCAGG - Intergenic
1062863313 10:827603-827625 TGCGGTGTGTGCCAGACAGCTGG - Intronic
1063663608 10:8049561-8049583 CGCGGTGTGGCCCGCGCAGCCGG + Intergenic
1066220556 10:33334243-33334265 CCCGGTCCGGGGCGGGCAGCTGG + Intronic
1067481104 10:46598109-46598131 CGCGGCCTGTGGCCCGCAGCCGG + Intergenic
1067613648 10:47743713-47743735 CGCGGCCTGTGGCCCGCAGCCGG - Intergenic
1067814111 10:49459024-49459046 CGTGTTCTGTGGTGGGCAGCAGG + Exonic
1068351069 10:55845914-55845936 GGCAGTGTGTGGGGGGCAGCAGG - Intergenic
1069683448 10:70301213-70301235 CGTGGTGGGTGGGGTGCAGCTGG - Exonic
1069686194 10:70320611-70320633 CGTGGTGTGTGGCATACAGCAGG - Intronic
1070806693 10:79274956-79274978 CGAGGGGTGGGGCGGGCAGCAGG + Intronic
1071629058 10:87203685-87203707 CGCGGCCTGTGGCCCGCAGCCGG - Intergenic
1072511529 10:96130519-96130541 CGCGGTGTTTGGGGCGAAGCTGG + Intronic
1073476652 10:103758004-103758026 AGCGCTGTGTGGCGTGCAACGGG - Intronic
1073699375 10:105908239-105908261 TGGGGTGTGTGAGGGGCAGCAGG + Intergenic
1074923819 10:118046804-118046826 CGGGACGTGGGGCGGGCAGCGGG + Intergenic
1075223143 10:120601679-120601701 GGCTGTGTGTGGCGGGTGGCAGG + Intergenic
1076143149 10:128095711-128095733 CGCGCTGTGGGGGTGGCAGCGGG + Intergenic
1076572742 10:131443464-131443486 GGCGGTGGGCGGCGGGCAGTGGG - Intergenic
1077340896 11:2025879-2025901 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1077408709 11:2393734-2393756 GGCGGTGGGTGGCGGGTGGCAGG + Intronic
1080283965 11:30586719-30586741 GTCGGTGGGTGGCGGGGAGCTGG - Intronic
1080779111 11:35414524-35414546 CGGGGTGAGGGGCGGGCAGAGGG + Intronic
1083669437 11:64291912-64291934 CTCGGAGCGTGGCGGGCGGCGGG - Intronic
1083891804 11:65599375-65599397 CGCGGTGAGTGGCCTGAAGCCGG - Exonic
1084621111 11:70270787-70270809 CGCGGCGTGGGGCGGGCAGGCGG + Exonic
1090274428 11:125409642-125409664 GGAGGTGTGTGGAGAGCAGCCGG + Intronic
1090839013 11:130473490-130473512 CACGCTGGGTGGCTGGCAGCTGG + Exonic
1202823881 11_KI270721v1_random:81068-81090 CGCTGTGGGCGGCGGGCACCCGG - Intergenic
1091718569 12:2795964-2795986 CGGGGTGTGGGGCGGGGAGGAGG + Intronic
1092173260 12:6386141-6386163 CCTGGTGTGGGGCTGGCAGCGGG - Exonic
1094692074 12:32779442-32779464 TGTGGTGTGTGGGGGGCAGGGGG - Intergenic
1094840416 12:34340477-34340499 GGGGGTGCGTGGCGGGGAGCAGG - Intergenic
1102467366 12:113137799-113137821 GGCGGTGTGGGGCGGGGGGCAGG - Intergenic
1102644671 12:114396305-114396327 CGGGGACTGTGGCGGCCAGCGGG - Intronic
1102854158 12:116278116-116278138 CGCGATGTGGGCCAGGCAGCGGG + Intergenic
1103928654 12:124437556-124437578 TGGGCTGTGTGCCGGGCAGCAGG - Intronic
1104582017 12:130017710-130017732 CGCGGGGCGTGGCGGGGACCGGG + Intergenic
1104605740 12:130186043-130186065 CTCGCTGTGTGGAGGGCTGCGGG + Intergenic
1106858469 13:33878592-33878614 TGAGGTGTGTGGTAGGCAGCTGG + Intronic
1113126742 13:106987600-106987622 CCCGGGGTGTGCCGGCCAGCTGG + Intergenic
1113824339 13:113239497-113239519 CCGGGTGAGGGGCGGGCAGCAGG + Exonic
1113882678 13:113636431-113636453 AGCTGTGTGTGGCGGTCAGCGGG + Intronic
1114610373 14:24036326-24036348 CGCGGCGACTGGCGGGCGGCGGG + Intergenic
1117573575 14:57074174-57074196 CGCGCTGTGGGGCGGGGGGCAGG - Intergenic
1118110307 14:62711215-62711237 GGGGGTGGGTGGGGGGCAGCTGG - Intronic
1119429860 14:74559531-74559553 CTCGCTGTGTGGAGGGCTGCAGG + Intronic
1119539230 14:75428019-75428041 CGCAGGCTGTGGCGGGCGGCGGG - Intronic
1119668111 14:76499095-76499117 CGCGGTGGGTGACAGGCAGGGGG - Intronic
1120840009 14:89077459-89077481 CCAGGTGTGTGGCGGGCGCCTGG + Intergenic
1121733970 14:96205288-96205310 CGAGGTGTGTGTGGTGCAGCAGG + Intronic
1122075225 14:99231308-99231330 CGCGGTGGGGGGCGGGCCCCCGG - Intronic
1122273973 14:100581755-100581777 GGCAGTGTGTGCCAGGCAGCAGG - Intronic
1122319555 14:100845588-100845610 GGCGGTGTGCTCCGGGCAGCTGG - Intergenic
1122505021 14:102226804-102226826 CGGGGTTTGTGGCGCACAGCAGG - Intronic
1122692440 14:103537685-103537707 CTGGGTGGGTGGAGGGCAGCAGG + Intergenic
1122718674 14:103709988-103710010 CGCTGTCTGTGGCGAGAAGCCGG - Intronic
1122724623 14:103742087-103742109 TGCTGCCTGTGGCGGGCAGCAGG + Exonic
1123013857 14:105364275-105364297 CGCGGTGGGCGGCGGCCTGCGGG + Intronic
1124344781 15:28914859-28914881 CGCTGTGTGTCCCGGGCTGCCGG + Intronic
1127289000 15:57553944-57553966 CGCAGTGTGTGGTGGGCTGGAGG + Intergenic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1133198126 16:4184842-4184864 CGCTGTGTGTGGCGGGGATAAGG - Intergenic
1135668969 16:24359056-24359078 CACGGTGGGTGGCGGGGAGTGGG - Intronic
1139503933 16:67389720-67389742 AGCAGTGTGTGGCATGCAGCGGG + Intergenic
1139948961 16:70660117-70660139 CGTGGAGTGAGGCGGGGAGCTGG - Exonic
1140735657 16:77895782-77895804 CCCGGTGCTTGGCGCGCAGCAGG - Intronic
1141600702 16:85124381-85124403 CCCGAGGTGGGGCGGGCAGCGGG - Intergenic
1142077622 16:88129312-88129334 GGCGGGGTCTGGCGGGCAGGAGG + Intergenic
1142480342 17:215027-215049 CCCGGGGTGTGGAGGGCACCCGG - Intronic
1142836708 17:2593258-2593280 CACCGTGTGTGGCGGGCCCCGGG - Intronic
1144078127 17:11737315-11737337 AGGGGTGGGTGGGGGGCAGCTGG - Intronic
1150218679 17:63483968-63483990 TCCGGTGTGTGGTGGGAAGCCGG + Intergenic
1151318473 17:73338277-73338299 CACGGAGTGGGGCGGGCATCTGG - Exonic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1152464277 17:80457023-80457045 CTCGGGGTGGGGCGGGCAGGAGG - Intergenic
1153952513 18:10069181-10069203 CGCTGTGAGAGGCGGGGAGCTGG - Intergenic
1154189885 18:12221179-12221201 AGGGGTGTGTGGGGGGCAGGAGG + Intergenic
1154329989 18:13421689-13421711 GGCGGTGGGTGGGGGGCAGGGGG - Intronic
1156704405 18:39862178-39862200 AGCGATGTGTGGCTGGGAGCTGG + Intergenic
1157492776 18:48136072-48136094 CGGGGTGGGCGGCGGGCAGGGGG + Intronic
1160269720 18:77373122-77373144 CGGGGTGTGAGGTGGGGAGCAGG - Intergenic
1160506051 18:79427420-79427442 TGCGGTGGGTGGGGGGGAGCTGG + Intronic
1160620017 18:80164122-80164144 CTCTGTGTGTGGGGTGCAGCAGG - Intronic
1160800149 19:963909-963931 CGTGGTGTGTGGCGTGGAGAAGG + Intronic
1161064733 19:2232044-2232066 GGTGGTGTGTGGCGGGTGGCAGG + Exonic
1161114587 19:2489401-2489423 CGGGGCGTGGGGCGGGCGGCCGG - Intergenic
1161224464 19:3136614-3136636 GGCGGTGGGTGGTGGGCAGTGGG + Intronic
1161234475 19:3191001-3191023 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234481 19:3191032-3191054 CGTGGTGCGTGGCGGGCAGCAGG + Intronic
1161234487 19:3191063-3191085 CGCGGTGTGTGGCGGGCAGCAGG + Intronic
1161234493 19:3191094-3191116 CGCGGTGCGTGGCGGGCAGCAGG + Intronic
1161752863 19:6110336-6110358 CGGGGAGTGTGGGGGGCGGCGGG - Intronic
1162100470 19:8335630-8335652 CCCGGGGCGCGGCGGGCAGCGGG + Exonic
1162348716 19:10136217-10136239 CCCGGTGTGGGGCAGGCACCAGG + Exonic
1162435259 19:10654383-10654405 CGCGGTGCGCGCCGGGCTGCTGG - Exonic
1163475086 19:17521137-17521159 CCCGGAGAGTGGCGGCCAGCAGG - Exonic
1163500682 19:17674430-17674452 GGCGGAGGCTGGCGGGCAGCAGG + Intronic
1165213714 19:34254664-34254686 GGCGGTGGGCGGTGGGCAGCGGG + Intronic
1165903467 19:39179413-39179435 TGCGATGTGTGGGGGGCAGGGGG + Intronic
1167685297 19:50952389-50952411 CACGGTGTGTGTCGGGGAGGGGG - Intronic
1168616150 19:57838658-57838680 AGTGGTGTGTGGCAGTCAGCTGG + Intronic
926599345 2:14825103-14825125 GTCGGGGTGTGGCAGGCAGCTGG + Intergenic
928436240 2:31256471-31256493 CACGGTGTGTGGCACACAGCAGG - Intronic
930089543 2:47521614-47521636 GGCGGAAGGTGGCGGGCAGCAGG + Exonic
935590476 2:104842979-104843001 CGCGGAGCGGGGTGGGCAGCCGG - Intergenic
936657540 2:114505720-114505742 CAGGGTGTGGGGCAGGCAGCTGG - Intronic
936789433 2:116133740-116133762 CGTGGTGTGCGGTGAGCAGCCGG - Intergenic
941377363 2:164748023-164748045 AGCTGTGTGTGGTGGGGAGCAGG + Intronic
946308763 2:218871436-218871458 CGCGGGCTGGGGCGGTCAGCTGG - Intronic
1169081621 20:2800701-2800723 CGAGGTCCGAGGCGGGCAGCGGG - Intergenic
1172126253 20:32626936-32626958 CGGGGTGTGTGGGGGCCACCAGG + Intergenic
1172205319 20:33159170-33159192 CCCTGTGTGTGGCCAGCAGCGGG - Intergenic
1174082746 20:47982820-47982842 CGCAGTGGGTGGTGGGCAGGGGG - Intergenic
1176305960 21:5123293-5123315 CACCGTGTGTGGCGGGGCGCAGG - Intronic
1178526570 21:33334741-33334763 CCAGGTGTGTGAGGGGCAGCTGG + Intronic
1178938992 21:36889320-36889342 CGCAGTGTGTGGTGAGCAGATGG - Intronic
1179511937 21:41879149-41879171 CGCGGGGGGCGGGGGGCAGCGGG + Intronic
1179828158 21:43979847-43979869 CACAGTGTGTGGCTGGCAGGGGG + Intronic
1179851097 21:44138738-44138760 CACCGTGTGTGGCGGGGCGCAGG + Intronic
1180230926 21:46426442-46426464 GGAGGTGTGTGGGGGGCAGAAGG + Intronic
1180581940 22:16846089-16846111 CCTGGTGTGTGGAGGGCAGGGGG - Intergenic
1183961389 22:41413782-41413804 CGCGGGGTGTGGAGAGGAGCCGG - Intergenic
953867412 3:46596249-46596271 TGGGGTCTGTGGCGGGCAGGGGG + Intronic
953883102 3:46701553-46701575 CGCGGGGGTTGCCGGGCAGCTGG + Exonic
954376102 3:50195005-50195027 CGTGGTGTGGGGTGGGGAGCTGG - Intronic
955098979 3:55828444-55828466 GGCGGAGTGTAGCTGGCAGCAGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
960884786 3:122383244-122383266 CGCGGTGATTGGCCTGCAGCGGG - Intergenic
964438312 3:156675790-156675812 CGCGGTGTGTCGCCTGCCGCTGG + Intronic
965385237 3:168037960-168037982 CGCAGTGTGTGGGGCGCAGCAGG + Intronic
966915911 3:184583930-184583952 GGCGAGGTGTGGCGGGCGGCCGG + Intronic
967231281 3:187339531-187339553 ATCGGTGTGTGGGCGGCAGCAGG + Intergenic
968727998 4:2257089-2257111 CGCTGGCTGGGGCGGGCAGCTGG - Intronic
968965119 4:3765837-3765859 CGCGGGGCGGGGCGGGCCGCGGG - Intergenic
976751931 4:88457589-88457611 GGCTGTGAGGGGCGGGCAGCCGG + Intronic
977231074 4:94451992-94452014 CGAGGTGAGTGGCGGCCGGCCGG + Exonic
980929969 4:139176405-139176427 CGCTCTGGGTGGCGGGCAGGCGG - Intronic
990389855 5:55307757-55307779 CCTGGCGTGTGGCAGGCAGCTGG - Exonic
991013288 5:61906334-61906356 GGCGGTGCGGGGCGGGCAGAGGG - Intergenic
992106277 5:73451410-73451432 CGCGGAAAGTGGCGGGCGGCGGG + Intergenic
992638402 5:78747472-78747494 GGGGGTGTGTGGTGGGCACCTGG - Intronic
993545232 5:89203523-89203545 CGTGGGGTGGGGCGGGGAGCTGG + Intergenic
994184980 5:96807404-96807426 GGCGGGGTGGGGCGGGCAGCTGG - Intronic
999742721 5:154568825-154568847 CGGGCTGTGTGGAGGGCACCTGG - Intergenic
1000103444 5:158037241-158037263 CGGGGTGGCTGCCGGGCAGCGGG + Intergenic
1000410534 5:160932144-160932166 TGGGGTGAGTGGCGGGTAGCTGG + Intergenic
1001906607 5:175478636-175478658 AGCGGTGAGTCGCGGGCGGCAGG + Exonic
1003030814 6:2599051-2599073 CGCCGTGTGTGGCTGACTGCAGG + Intergenic
1004942637 6:20576797-20576819 CTCTGTGTGTGGCGTGGAGCAGG + Intronic
1005596240 6:27381387-27381409 CGCGGTGCTTGGGGGCCAGCTGG - Intronic
1006398308 6:33801403-33801425 CCTGGTGTGTGGCAGGGAGCTGG - Intronic
1006420497 6:33930986-33931008 GCCGGTGTGAGGAGGGCAGCAGG + Intergenic
1012410134 6:98947656-98947678 GGCGGGGAGGGGCGGGCAGCGGG + Intronic
1013219353 6:108063679-108063701 AGTGGTGTGTGGCAGGCGGCGGG - Intronic
1013836610 6:114342447-114342469 CGAGGTCTGAGGCGGGGAGCCGG + Exonic
1016010894 6:139135966-139135988 CGCCGTGTGTGCCGGGCCGAAGG + Intronic
1018827667 6:167421778-167421800 CGCCGTGTGTGGGGAGCCGCAGG - Intergenic
1019405841 7:883701-883723 CGGGGAGAGTGGGGGGCAGCTGG - Intronic
1019429338 7:991464-991486 AGGGGTGTGGGGCGGGCAGGAGG + Intergenic
1019538374 7:1540387-1540409 GGCGGGGGGTGGCGGGCGGCGGG + Exonic
1025850480 7:65239706-65239728 CGCGGTGTGTGGTGAGCAGCAGG - Intergenic
1026024270 7:66732366-66732388 CTTGGTGGGTGGTGGGCAGCAGG - Intronic
1026776605 7:73234873-73234895 CGCGGTGTGGGGCTGGCACGGGG + Intergenic
1027017456 7:74788243-74788265 CGCGGTGTGGGGCTGGCACGGGG + Intronic
1027070566 7:75157689-75157711 CGCGGTGTGGGGCTGGCACGGGG - Intergenic
1027260559 7:76461889-76461911 CGCGGGGTGGCGCGGGGAGCCGG + Intronic
1029737437 7:102472620-102472642 CGCGGGATGGGGCGGGCAGGGGG - Intronic
1030076731 7:105743333-105743355 GGCAGTGTGTGGCAGGAAGCTGG + Intronic
1032003601 7:128282670-128282692 AGCTGTGTGTGGCGGCCATCCGG - Intergenic
1032078975 7:128849250-128849272 GGCGGTAGGGGGCGGGCAGCGGG + Intronic
1033092989 7:138404038-138404060 CGCGGTGGGCGGTGGGCAGTGGG + Intergenic
1035972856 8:4270811-4270833 CACGGAGTGTGGTGGGCGGCAGG - Intronic
1036143253 8:6227527-6227549 GGGGGTGTGAGGGGGGCAGCAGG - Intergenic
1036398205 8:8386405-8386427 CGCGGTGCGTGCCCGGCCGCGGG + Exonic
1038395613 8:27243585-27243607 CGGGGTGTGTGGGGGGGTGCAGG - Intronic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1043171499 8:76972344-76972366 CGGTGTGGGTGGGGGGCAGCAGG + Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056309046 9:85321288-85321310 GGCATTGTGTGGTGGGCAGCAGG - Intergenic
1056899378 9:90583922-90583944 GGCATTGTGTGGTGGGCAGCAGG - Intergenic
1057250254 9:93495100-93495122 GGCATTGTGTGGTGGGCAGCAGG + Intronic
1058336359 9:103834421-103834443 TGTGGTGTGTGGGGGTCAGCAGG - Intergenic
1058439209 9:104991743-104991765 CGCGGCGGGCGGCGGGCAGCGGG + Intergenic
1060403230 9:123360440-123360462 GGCGGGGTGTGGAGGGCAGCAGG - Intronic
1061779730 9:132988477-132988499 CGGGGGGTGTGGTGGGCACCTGG + Intronic
1062034406 9:134376484-134376506 AGCAGAGTGTGGCGGGCGGCAGG - Intronic
1062277175 9:135736586-135736608 GGCGGCGGGCGGCGGGCAGCGGG - Intronic
1062277177 9:135736593-135736615 CGCGGCGGGCGGCGGGCGGCGGG - Intronic
1062464135 9:136673760-136673782 TGCGGGGTCTGGCGTGCAGCCGG - Exonic
1062623512 9:137433136-137433158 CCCTGTGGGTGGAGGGCAGCCGG - Intronic
1186107855 X:6226499-6226521 CGCTGTGTCTGGCGGCGAGCAGG + Intronic
1190302269 X:49063926-49063948 CGCGGGCTGTGGGGGGCCGCCGG - Exonic
1192146542 X:68686503-68686525 CGTGGGGTGTGGAGGGCACCCGG + Intronic
1192260736 X:69504740-69504762 AGCGGCGTGGAGCGGGCAGCGGG + Intergenic
1195078326 X:101348424-101348446 CGGGGTGGGGGGCGGGCACCTGG - Intronic
1196782989 X:119399572-119399594 CACCGGGTGTGGCGGGCAGAGGG + Exonic
1199881387 X:151976199-151976221 CCCGGTGTGTGTCGGGGGGCGGG - Intergenic