ID: 1161234545

View in Genome Browser
Species Human (GRCh38)
Location 19:3191374-3191396
Sequence CAGGCTCTCAGCGACGGCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161234539_1161234545 -3 Left 1161234539 19:3191354-3191376 CCGTGATGGAGCGACAGCCCCAG 0: 1
1: 0
2: 1
3: 11
4: 156
Right 1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 74
1161234534_1161234545 30 Left 1161234534 19:3191321-3191343 CCGTGGGGAGCGCCACCGCAGAA 0: 1
1: 0
2: 0
3: 2
4: 74
Right 1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 74
1161234535_1161234545 18 Left 1161234535 19:3191333-3191355 CCACCGCAGAAGTGAATAAGCCC 0: 1
1: 0
2: 0
3: 5
4: 54
Right 1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 74
1161234536_1161234545 15 Left 1161234536 19:3191336-3191358 CCGCAGAAGTGAATAAGCCCGTG 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 74
1161234538_1161234545 -2 Left 1161234538 19:3191353-3191375 CCCGTGATGGAGCGACAGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 76
Right 1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG 0: 1
1: 0
2: 1
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161234545 Original CRISPR CAGGCTCTCAGCGACGGCCG TGG Intronic
900386430 1:2412995-2413017 CGAGCTCCCAGCGCCGGCCGCGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
903330601 1:22595179-22595201 CAGGCTCTCAGCCCTGGCCTTGG - Intronic
905179267 1:36156372-36156394 CGGGGTCTCAGCGGCGGCGGCGG - Exonic
905199605 1:36306972-36306994 CCGGCTCTTAGTGACGGGCGCGG + Intronic
906263314 1:44408838-44408860 TTGGCTCTCAGCTACGGCGGAGG + Intronic
910199967 1:84689958-84689980 CAGAGTCTCAGCAGCGGCCGTGG - Intronic
913531875 1:119739312-119739334 CAGGCCCTCAGCCCCGGCAGTGG + Intronic
915269071 1:154739898-154739920 CAGGCTGTCAGCCAGGGCTGTGG - Intronic
918079031 1:181191740-181191762 CAGGCTCACAGAGAAGGCCCAGG - Intergenic
920222071 1:204411426-204411448 CAGTCTCTCAGGTAGGGCCGCGG + Exonic
1063461681 10:6218891-6218913 CTGCCTCTCAGTGACGGCAGTGG + Intronic
1065190572 10:23204371-23204393 GAGGCTCTCAGCTAGGGCCAGGG - Intronic
1065483413 10:26215882-26215904 CAGGCTCTGAGTGACGGCTGGGG - Intergenic
1067808063 10:49406969-49406991 CAGGGTCTCAGGGACGGCCTGGG + Intergenic
1071291836 10:84194497-84194519 CAGGCTCCCAGCCGCGGGCGGGG - Intergenic
1072155356 10:92718645-92718667 GAGGCACTCAGCAACGGCCTTGG + Intergenic
1076590575 10:131579687-131579709 CAGGCTCTCTGCGTGGGCCCTGG + Intergenic
1077236158 11:1482917-1482939 CAGGCTCTCAGCGAAGGCCCAGG + Intronic
1078233073 11:9460427-9460449 GAGGCTCTCAGTGTCGGCCGAGG - Intronic
1079296333 11:19237977-19237999 AAGGCTCTCAGGGAGAGCCGTGG - Exonic
1084218410 11:67663915-67663937 CACCCTCTCAGTGACGGTCGGGG + Intronic
1085459871 11:76687055-76687077 CAGGCTCTGAGGGACAGCCAGGG + Intergenic
1088919533 11:114251152-114251174 GAGGCTCTCAGAGACCACCGGGG - Intergenic
1089624957 11:119745429-119745451 CAGCCTCTCAGAGAGGGCCCTGG - Intergenic
1097270799 12:57772675-57772697 CGGGATCTGAGCGCCGGCCGCGG + Exonic
1104599707 12:130144434-130144456 CAGGTGCTGAGCGACTGCCGGGG + Intergenic
1104738032 12:131151913-131151935 CAGGCTCTCAGCTACAGAAGTGG + Intergenic
1114690154 14:24573873-24573895 CGGGCTCTCAGGGAAGGCAGGGG + Intronic
1115320877 14:32077560-32077582 CAGGCTCCCCTCGGCGGCCGCGG - Intronic
1115641624 14:35339030-35339052 CAGCCCCTCAGCGAGGGCCTTGG + Intergenic
1121593027 14:95134738-95134760 CGGGCTCTCAGCTCCGGCAGTGG - Intronic
1122389877 14:101373044-101373066 CAGGCTCTGAGCGACCCCTGAGG + Intergenic
1123105060 14:105837407-105837429 CAGGCTCTCAGTGACCCTCGGGG - Intergenic
1128742879 15:70095956-70095978 CCGGCTCCCAGCGCCGCCCGTGG - Intronic
1132420007 15:101657356-101657378 CAGGCTGTCAGCCAGGGCTGCGG - Intronic
1132654969 16:1037905-1037927 CAAGCTGTCAGCCAGGGCCGAGG - Intergenic
1138478152 16:57284173-57284195 CACGCTCGCAGCGACGGCCACGG + Intronic
1142581896 17:948500-948522 CAGGCACTGAGGGACGGCTGTGG + Intronic
1148471428 17:47896235-47896257 CAGGCTCTCGGTGGCGGCGGAGG + Exonic
1148787236 17:50151226-50151248 AAGGCTCTCCGCGAGGGCTGGGG - Intergenic
1160765347 19:805176-805198 CAGCCTCTTACCGAAGGCCGCGG - Exonic
1161234545 19:3191374-3191396 CAGGCTCTCAGCGACGGCCGTGG + Intronic
1162351172 19:10150551-10150573 CAGGGGCTCAGCCACGGCCCAGG + Intronic
1163699206 19:18778781-18778803 CAGGTTCTCAGGGAGGACCGTGG - Exonic
1164590686 19:29505238-29505260 CAGGCTCCCAGCCACAGCTGAGG + Intergenic
1166853444 19:45771028-45771050 CTGGCCCACAGCCACGGCCGGGG + Exonic
925705501 2:6681242-6681264 CAGGCTCTGTGGGACAGCCGAGG + Intergenic
931874680 2:66498824-66498846 CAAGCTCCCAGGGACTGCCGAGG - Intronic
936075716 2:109400725-109400747 CTGGCTCTCATCGGCGGCTGAGG + Intronic
938365029 2:130727627-130727649 CAGGCTCTCAGAGGAGGACGCGG + Intergenic
1168766132 20:382343-382365 CAGGCTCTGAGGGATGGCCGGGG + Intronic
1172043815 20:32064866-32064888 CAGGTTCCCAGGGACGGCAGTGG + Intronic
1173568324 20:44058147-44058169 CAGGCTCTCTGGGACAGCCAAGG + Intronic
1175385211 20:58590509-58590531 CTGGCTCTCAGCGTGGGCCATGG + Intergenic
1175715673 20:61252977-61252999 CACGCCTTCAGCCACGGCCGGGG - Intronic
1180930454 22:19586981-19587003 CAGGCTCTCCTCGACTGCCCTGG + Intergenic
1184276575 22:43412233-43412255 CAGGCGCTGGGCGACGCCCGCGG + Intronic
968708554 4:2095638-2095660 CAGCCTCTCAGGGGAGGCCGCGG - Intronic
969529380 4:7722285-7722307 CAGCCTCTCAGGGAGGGGCGGGG - Intronic
972496348 4:39638641-39638663 CAGGCTCTCGGGGACTGCGGCGG - Intronic
978761787 4:112361237-112361259 CAGGCTCTGTGGGACAGCCGAGG + Intronic
986370748 5:7077853-7077875 CAGGCTCTCAGCCCTGGCTGTGG - Intergenic
990027601 5:51214057-51214079 CAGGCTCTCTGCTACGGCCTTGG + Intergenic
1000220523 5:159209542-159209564 CCGGCGCTCTGCGGCGGCCGCGG + Intronic
1004235828 6:13873730-13873752 CAGGGTCTCAGCCACGGACAAGG + Intergenic
1005939901 6:30553107-30553129 CAGGCTCTCAGCAACTGCTCTGG + Exonic
1007614333 6:43171515-43171537 CGGGTTCGCAGCGGCGGCCGCGG + Exonic
1019273185 7:162012-162034 CAGGCTCTAAGCAAACGCCGTGG - Intergenic
1021668755 7:23013967-23013989 GAGGCTCTCAGCGACAGCGACGG + Exonic
1026806059 7:73430248-73430270 CATGCTCTCAGGGATGGCAGTGG - Intergenic
1029526894 7:101100232-101100254 CAGGCTGTCACCGGCAGCCGAGG - Intergenic
1035169535 7:157009940-157009962 CAGGCCCCCAGCGGCGGCGGCGG + Exonic
1036674345 8:10817710-10817732 CAGGCTCTCAGCCCCCGCCCAGG + Intronic
1038176177 8:25184116-25184138 CAGGCTCTAAGCGGTGGCCCCGG + Intergenic
1042570310 8:70156731-70156753 CAGGCCCTCAGCGAGGGGCACGG - Exonic
1055664757 9:78542266-78542288 TAGGCTGTCAGCGGCTGCCGAGG - Intergenic
1057854848 9:98594285-98594307 CAGGCTCTCAGCCACGGGGTGGG - Intronic
1062003851 9:134229724-134229746 CTGGCTCCCAGCGACTGGCGGGG - Intergenic
1193836353 X:86349247-86349269 CAGGCTCTCACCGACCACCTGGG + Intronic
1195908173 X:109865420-109865442 CAGGCTCTGAACCACGACCGTGG - Intergenic
1195966497 X:110434444-110434466 CAGGCTCTGAACCACGACCGTGG + Intronic