ID: 1161237290

View in Genome Browser
Species Human (GRCh38)
Location 19:3204380-3204402
Sequence CAGTGGGTAAGGAGGGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 1, 2: 2, 3: 32, 4: 347}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161237290_1161237311 23 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237311 19:3204426-3204448 CAGGCCTTAGGGGGACCCCGGGG 0: 1
1: 0
2: 0
3: 9
4: 145
1161237290_1161237309 21 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237309 19:3204424-3204446 AGCAGGCCTTAGGGGGACCCCGG 0: 1
1: 0
2: 0
3: 13
4: 224
1161237290_1161237306 13 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237306 19:3204416-3204438 GGGGCTCCAGCAGGCCTTAGGGG 0: 1
1: 0
2: 1
3: 11
4: 225
1161237290_1161237314 28 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237314 19:3204431-3204453 CTTAGGGGGACCCCGGGGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 184
1161237290_1161237300 4 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237300 19:3204407-3204429 TTGCCCGCCGGGGCTCCAGCAGG 0: 1
1: 0
2: 1
3: 11
4: 117
1161237290_1161237310 22 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237310 19:3204425-3204447 GCAGGCCTTAGGGGGACCCCGGG 0: 1
1: 0
2: 0
3: 16
4: 177
1161237290_1161237299 -6 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237299 19:3204397-3204419 CCACTGCTCATTGCCCGCCGGGG 0: 1
1: 0
2: 0
3: 10
4: 164
1161237290_1161237297 -7 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237297 19:3204396-3204418 CCCACTGCTCATTGCCCGCCGGG 0: 1
1: 0
2: 1
3: 20
4: 146
1161237290_1161237295 -8 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237295 19:3204395-3204417 ACCCACTGCTCATTGCCCGCCGG 0: 1
1: 0
2: 0
3: 5
4: 104
1161237290_1161237305 12 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237305 19:3204415-3204437 CGGGGCTCCAGCAGGCCTTAGGG 0: 1
1: 0
2: 1
3: 5
4: 135
1161237290_1161237307 14 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237307 19:3204417-3204439 GGGCTCCAGCAGGCCTTAGGGGG 0: 1
1: 0
2: 3
3: 22
4: 250
1161237290_1161237312 24 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237312 19:3204427-3204449 AGGCCTTAGGGGGACCCCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 140
1161237290_1161237304 11 Left 1161237290 19:3204380-3204402 CCCTTGTCCCTCCTTACCCACTG 0: 1
1: 1
2: 2
3: 32
4: 347
Right 1161237304 19:3204414-3204436 CCGGGGCTCCAGCAGGCCTTAGG 0: 1
1: 0
2: 0
3: 28
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161237290 Original CRISPR CAGTGGGTAAGGAGGGACAA GGG (reversed) Intronic
901216654 1:7559003-7559025 CTTTGGGAGAGGAGGGACAAAGG + Intronic
901296820 1:8167229-8167251 CAGAGGGGGAGGAGGAACAATGG + Intergenic
902492837 1:16797686-16797708 CAGTGGCTCAGTAGAGACAAGGG + Intronic
902979656 1:20113782-20113804 GAGGGGGTGAGGAAGGACAAGGG + Exonic
903057271 1:20644970-20644992 CAGAGGGTGAGGAAGGAGAACGG - Intronic
903363291 1:22790590-22790612 AGGTGGGTAAGGAGAGACCAAGG - Intronic
904623415 1:31789040-31789062 CAGTTGGTATGGAGGGAAACGGG - Intergenic
905805474 1:40873954-40873976 CTGTGGGTAGGGAGGGACAACGG + Intergenic
906017877 1:42598498-42598520 CAATAAGAAAGGAGGGACAATGG + Intronic
906046803 1:42837373-42837395 CAGTGGGTAAGGAGGTGCCCAGG + Intronic
906072866 1:43029952-43029974 CAGTGGTTAAGGCTGGACAATGG - Intergenic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
908606585 1:65804343-65804365 CAGTAGCTAAGAAGGAACAAAGG + Intronic
909362033 1:74772050-74772072 CGGTGGGTAAAGAAGGAAAAAGG + Intergenic
912463770 1:109855216-109855238 CAGTGGGTATAGAGAGACAACGG + Intergenic
912474680 1:109928028-109928050 TACTGGGTAAGGAGGGAAGATGG - Intronic
914755995 1:150561913-150561935 GAGTGGGGAAGGAGGCAAAAGGG + Intergenic
914827486 1:151146255-151146277 CAGGGAGGAAGGAGGGACAGTGG - Intronic
915392382 1:155555945-155555967 AAGAGGGGAAGGAGGGACAGGGG + Intronic
915545169 1:156592890-156592912 CAGAGTGGAAGGAGGGACCAGGG - Intronic
915735013 1:158078949-158078971 GAGTGGGTGAGGGGGGGCAAGGG - Intronic
917746301 1:178011247-178011269 CAGTGGGAAATGAGGGGAAAGGG + Intergenic
918666652 1:187159488-187159510 CAGTGGGTAAGGACATAAAAAGG + Intergenic
919041380 1:192392609-192392631 AAGTGGGGAGGGAGGGACAGAGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919939805 1:202278436-202278458 CTGAGGACAAGGAGGGACAAGGG + Intronic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
920708050 1:208269180-208269202 AAGGGGGTGAGGAGGGAGAAGGG + Intergenic
920710128 1:208287115-208287137 CAGTGGGAAACCAGGGAAAATGG - Intergenic
921758587 1:218886184-218886206 AAGTTGGGAAGGAAGGACAATGG - Intergenic
922218828 1:223542467-223542489 AAGTGGGTAAGCACAGACAATGG + Intronic
922285741 1:224169053-224169075 CAGAGGCTAAAAAGGGACAAAGG - Intergenic
922346638 1:224701972-224701994 CAGAGAGTTAGGAAGGACAAGGG - Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923527612 1:234784846-234784868 CAGTGGCTCAGTAGAGACAAGGG - Intergenic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
1063369985 10:5514902-5514924 CAGTGGGAAAGGAAGGCCCAGGG + Intergenic
1063497585 10:6524743-6524765 AAGTGGGTGAGGAGGGAGGAGGG + Intronic
1065804044 10:29378630-29378652 CGGGGGGTATGAAGGGACAAAGG + Intergenic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1065945133 10:30599307-30599329 CAGGGGCTATGAAGGGACAAAGG - Intergenic
1067083637 10:43227085-43227107 CAGTGGGTTAAGGGGGAAAAGGG + Intronic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067704577 10:48597417-48597439 CAGTGGGTGAGGAGAGGCAGTGG + Intronic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1069717218 10:70529080-70529102 GAGTGGATATTGAGGGACAATGG + Intronic
1071147923 10:82597043-82597065 CATATGGTAAGGAGGGAGAAGGG - Intronic
1071328409 10:84538835-84538857 CAATGGGAAAGGAGGGGCAGGGG + Intergenic
1071331938 10:84569381-84569403 CATTGGGTATGGAGGGGCATGGG + Intergenic
1072471769 10:95719982-95720004 AGCTGGGTATGGAGGGACAATGG + Intronic
1072534032 10:96346263-96346285 CAACAGGCAAGGAGGGACAATGG + Intronic
1073615362 10:104989766-104989788 CAGTGGAAGAGGAGGCACAATGG + Intronic
1074065342 10:110008164-110008186 CAGAGGGTAGGGCGGGAGAAGGG - Exonic
1075898446 10:126018808-126018830 CACTGGGAAAACAGGGACAATGG - Intronic
1076494912 10:130890753-130890775 AAGTGGGAAAGGAGGGGGAAGGG + Intergenic
1077077480 11:708099-708121 CTGTTGGTATGGAGGGTCAAGGG - Intronic
1077358241 11:2128413-2128435 CTGTGGGGATGGAGGGACAGGGG - Intergenic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1078935411 11:15945192-15945214 TAGAGGGTAAGGAGGGATATAGG + Intergenic
1080294147 11:30705597-30705619 TCGTGGGTAAGGAGGCAAAAAGG + Intergenic
1081430390 11:42970244-42970266 TAGTGGGTAGGGAGGATCAATGG - Intergenic
1082258095 11:50054425-50054447 AAGAGGGTTAAGAGGGACAAAGG - Intergenic
1085083839 11:73653798-73653820 GAGTGGGTAAGGAGGGAAGGAGG + Intronic
1085394921 11:76202423-76202445 CACGGGGAAAGGAGGGACAAAGG - Intronic
1086776316 11:90837677-90837699 CAGGGGGTAAGCAGGGGCTAGGG + Intergenic
1086966540 11:93033639-93033661 GAATGGGCTAGGAGGGACAAGGG - Intergenic
1087239014 11:95754827-95754849 CAATGGGTAAGGAGAAACCAAGG - Intergenic
1087632153 11:100662520-100662542 CCGTGGATAAGGAGGGACTACGG - Intergenic
1088763898 11:112958469-112958491 CAGTGGGAAAGGAGGCAAAAAGG - Intergenic
1089365386 11:117918201-117918223 CAGTGGAAAATGAGGGGCAAAGG - Intronic
1089597371 11:119589340-119589362 CAGTGGGTAGGCAGAGAGAAAGG - Intergenic
1089791363 11:120946970-120946992 AAGTTGGTATGGAGGGAAAATGG - Intronic
1091081570 11:132673907-132673929 TAGTGGGTTAGGAGAGAAAAGGG - Intronic
1091305617 11:134534163-134534185 CTGAGGGTAATGAGGCACAATGG + Intergenic
1091908051 12:4205347-4205369 CAGTGGGAGAGCAAGGACAAAGG + Intergenic
1093267444 12:17020301-17020323 CAGGGAGGAAGGAGGGAGAATGG - Intergenic
1094001075 12:25694879-25694901 CAGTGAATAAGGGGGGACTATGG + Intergenic
1095599910 12:44002483-44002505 CAGAGCCTGAGGAGGGACAAGGG + Intronic
1096696947 12:53355331-53355353 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
1097270024 12:57768329-57768351 CAGTGGGGAATGAGGGAGTAAGG - Intronic
1097751013 12:63352945-63352967 CAGTGAGTAAGGCAGGCCAAGGG + Intergenic
1100159175 12:91837740-91837762 CAGTGATTAAGAAGGAACAAAGG + Intergenic
1100670948 12:96812303-96812325 CAGAGGGAAAGGTGGGCCAAGGG - Intronic
1100722033 12:97369341-97369363 CAGGGGGAAAGGATGGAAAAGGG + Intergenic
1100784172 12:98061660-98061682 CAATGGGAAAGGAGAGACAAAGG + Intergenic
1101789108 12:107911917-107911939 CAGTGAGTGAGGAGGGACCCTGG - Intergenic
1101884379 12:108648871-108648893 CCGTGGGTAAGGAAGAAGAAAGG + Intronic
1104786408 12:131452449-131452471 CAGTGGGTCATGAGGAACAAGGG + Intergenic
1106356887 13:28991763-28991785 CAAAGGGGAAGGAGGGAAAAAGG - Intronic
1106655321 13:31737715-31737737 CAGTTGGTAAGGAGGTTCCAAGG - Intergenic
1107367130 13:39693272-39693294 AAGAGGGAAAGGAGGGAGAAAGG - Intronic
1108805123 13:54145250-54145272 CAGGCGGTCAGGAGGAACAAAGG - Intergenic
1108972013 13:56388322-56388344 GAGTGGGTAGGGATGGAGAAAGG - Intergenic
1109309032 13:60671322-60671344 CACTAGGTAGGGAGGGAGAAAGG - Intergenic
1109909715 13:68893304-68893326 GAGAGGGTAAAGAGGGAGAAAGG - Intergenic
1111149770 13:84235150-84235172 AAGTGGGTAAAGCGGGACACTGG + Intergenic
1111294391 13:86260034-86260056 CAGTGGGTAAGGACAGAGTAAGG + Intergenic
1113153797 13:107294172-107294194 CATAGGGAAAGGAGGGACAAAGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1114450066 14:22819610-22819632 AGGTGGGAGAGGAGGGACAATGG - Intronic
1114707935 14:24746346-24746368 CAGGAGGTAGGGAGGGACACAGG + Intergenic
1115434061 14:33353806-33353828 CAGTGGGCAAGAAGGGACAGAGG + Intronic
1116305438 14:43248042-43248064 AAGTAGGGAAGGAGGGAGAAAGG - Intergenic
1116604082 14:46967604-46967626 CAGTGGGTAAGGATTGATGAAGG - Intronic
1116632346 14:47351620-47351642 CAGTGAATAAGGTGGGGCAATGG - Intronic
1116836191 14:49770545-49770567 AAGTGGCTAGGGAGGGTCAAAGG + Intronic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1117483937 14:56174863-56174885 TAGTGGGAAAGGAGGGTAAAAGG - Intronic
1117876371 14:60254439-60254461 CAGTCAGTAAGGAAGGACAAGGG + Intronic
1118110767 14:62716550-62716572 CAGTGGGTGAGGAGGAAGAAGGG - Intronic
1118116028 14:62777923-62777945 AAGGGGCCAAGGAGGGACAATGG - Intronic
1118405277 14:65416886-65416908 CAGAGGCTAAGGCGGGAGAATGG - Intronic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119494048 14:75063643-75063665 CAATGGTTAAGGATGGACAGGGG - Intronic
1119542724 14:75451273-75451295 CAGTGGTCAAGGAGAGACAGTGG + Intronic
1121227782 14:92334027-92334049 AAGTGGGTGAGGAGGTGCAATGG + Intronic
1121638186 14:95467741-95467763 CAGTGGGCAAGGAGGGTAAATGG + Intronic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122544798 14:102516594-102516616 CAGTGAGTCAGAAGGGGCAACGG + Intergenic
1125408828 15:39383513-39383535 TAGTGGGTAAGGTGGGAAAAGGG + Intergenic
1125447324 15:39772082-39772104 CAGAAGGTAATGAGGTACAAAGG + Intronic
1125507559 15:40275786-40275808 GAGGGGGTGGGGAGGGACAAGGG + Intronic
1125755048 15:42057896-42057918 CAGTGGGTGAAGGGGGACAGAGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1126512198 15:49490449-49490471 TAGTGGCTAAGGAGTGGCAATGG + Intronic
1128362467 15:66972080-66972102 AACTGGGTATAGAGGGACAATGG + Intergenic
1128604861 15:69029111-69029133 CAGTGGGCAAGGAGTTTCAATGG - Intronic
1128884316 15:71272429-71272451 AAGTGGGGAGGGAGGGGCAAAGG + Intronic
1129898792 15:79129745-79129767 CAGTGGGTTTGGAGGGGCATAGG - Intergenic
1130899715 15:88198244-88198266 CAGTGGGTAAGGATGGGAAGGGG - Intronic
1131439996 15:92452508-92452530 CAGGAGGAAAGGATGGACAATGG + Intronic
1131470907 15:92696048-92696070 CAGTGGGTTTTGAGGGAAAAGGG + Intronic
1131545818 15:93314711-93314733 CAGTAGTTCAGGAGAGACAAGGG + Intergenic
1132839811 16:1973536-1973558 CAGTGGAGAAGGAAGGAGAAGGG + Intronic
1132975064 16:2706911-2706933 CAGTGGGCATGGAGGAACAGAGG + Intronic
1133362288 16:5183999-5184021 CAGTGGGTGTGGTGTGACAATGG + Intergenic
1135124354 16:19795704-19795726 CAGTGGGTAAGGACAGAGTAAGG - Intronic
1136232401 16:28894394-28894416 CAGAGGGTAAGGAAGGACAGTGG - Intronic
1136718732 16:32303453-32303475 CATTGGGTAAGGCAGGGCAATGG + Intergenic
1136837103 16:33509717-33509739 CATTGGGTAAGGCAGGGCAATGG + Intergenic
1137286117 16:47017077-47017099 CAGGGGGTAGGGAAGGGCAAAGG + Intergenic
1137574404 16:49589224-49589246 CAGTGGGAAAGCTTGGACAAGGG - Intronic
1137742175 16:50789459-50789481 GAGTGGGTAGGGAGGGATCAGGG + Intronic
1137873940 16:51977415-51977437 CAATGGGGAAGAAGAGACAAGGG - Intergenic
1138795434 16:59962664-59962686 CAGTTGGAAGGGAGGGACATCGG + Intergenic
1139001820 16:62519885-62519907 AAGAGGGTAAGGAGTGACAAAGG + Intergenic
1139077170 16:63465274-63465296 CATTAGGCTAGGAGGGACAATGG - Intergenic
1139511981 16:67432729-67432751 TAGGGGGGAAGGAGGCACAAGGG + Intronic
1203007699 16_KI270728v1_random:214318-214340 CATTGGGTAAGGCAGGGCAATGG - Intergenic
1203147280 16_KI270728v1_random:1809996-1810018 CATTGGGTAAGGCAGGGCAATGG + Intergenic
1142478718 17:204949-204971 CAGTCGGGAAGGAGGGAGCAGGG + Intergenic
1143014444 17:3884151-3884173 CAGTGGACAAGGAGGGACTGAGG - Intronic
1143465348 17:7132765-7132787 CAGTGGAGACGGAGGGACAGTGG - Intergenic
1144110815 17:12030080-12030102 CAAAGGGTAAGGATGGGCAAAGG - Intronic
1144758898 17:17695959-17695981 CCCTGGGTGAGGAGGGAGAAAGG - Intronic
1144774451 17:17778103-17778125 CAGCGGGTCAGGTGGGACAGGGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1147721009 17:42539361-42539383 CAGAGGAACAGGAGGGACAAGGG - Intronic
1148239068 17:45988162-45988184 CAATGGGAGAGGAGGGACACAGG - Intronic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1150570789 17:66385186-66385208 CAGTGAGTAAGGTAAGACAAGGG - Intronic
1151964867 17:77426005-77426027 CAGTGGGTCAGGATGGCCAGAGG + Intronic
1152589673 17:81205376-81205398 CAGTGGGGTAGGAGGGGCAGCGG + Intronic
1152795286 17:82303443-82303465 CTGTGGGTAAGGAAGGAAAGGGG + Intergenic
1155552113 18:26975451-26975473 GAGTGTGTAATGATGGACAATGG - Intronic
1155947184 18:31868106-31868128 CAGTGGGAGAGAAGGGAAAAAGG + Intronic
1157226008 18:45865440-45865462 CAGTGGGGAAGGATTGACACTGG - Intronic
1158393594 18:57062926-57062948 CATTGGGTAGCGAGTGACAAAGG - Intergenic
1161237290 19:3204380-3204402 CAGTGGGTAAGGAGGGACAAGGG - Intronic
1163025373 19:14508019-14508041 CAGTGGGGCAGGAGAGACAACGG - Intergenic
1163283925 19:16334424-16334446 CAGTGGCTGGGGAGGGAGAATGG - Intergenic
1164623695 19:29713201-29713223 AAGTGGGTGAGGAGGGAGGATGG + Intronic
1165785669 19:38460354-38460376 CCCTGGGTAAGGAAGGACAATGG - Exonic
1165864053 19:38925338-38925360 CTGTGGGGAAGGAGGAAGAAGGG - Intronic
1167687002 19:50962688-50962710 CAGTGGGAAGGCAGAGACAATGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
927951680 2:27174466-27174488 CAGTGGGAGAGGAGGGGTAAGGG - Intergenic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929905869 2:46046113-46046135 CACTGGGTAAGCAGGGGCACTGG - Intronic
931707572 2:64960035-64960057 CAGTGGGGAAGCAGGGGGAAAGG - Intergenic
932740222 2:74285488-74285510 CTATGGATATGGAGGGACAATGG + Intronic
933275288 2:80277519-80277541 CAGTGGGGAAGGAGAGACTCAGG + Intronic
935148682 2:100414220-100414242 GAGTGGGCAAGCAGGGACAGGGG + Intronic
935442736 2:103121394-103121416 CAGTGTGTAAAGAAGGAGAAAGG + Intergenic
936073956 2:109389953-109389975 AGGTGGGTGAGGAGGAACAAGGG - Intronic
937837256 2:126484186-126484208 CAGTGGGGAGGGTGGGACAAAGG - Intergenic
937842133 2:126534639-126534661 CAGTGGTTAAGGAGAGGAAAAGG + Intergenic
938554137 2:132408595-132408617 CAGTGGGGAGGGAGGGAGAAAGG + Intergenic
939007023 2:136801026-136801048 CAGTGGGTAAAGAGGGACAAAGG - Intronic
939092184 2:137792109-137792131 CAGAAGGAAAGGAGGGGCAAGGG + Intergenic
940326819 2:152434308-152434330 CAGGGGGTATGGAGGAATAAAGG + Intronic
940330121 2:152465430-152465452 AAGTGGTTAAAGTGGGACAAAGG + Intronic
941712746 2:168731596-168731618 CCATGGGAAGGGAGGGACAAAGG + Intronic
942617819 2:177812798-177812820 AAGCGGGTAAAGAGGGAAAAAGG + Intronic
943600793 2:189918931-189918953 CTGTGGATAAGGGGGGACTATGG - Intronic
943683424 2:190791812-190791834 CAGTGGGAAAGGAAGGACGGGGG - Intergenic
944893965 2:204145300-204145322 CACTGGGTCAGGAAGGTCAAAGG - Intergenic
946102693 2:217340019-217340041 CAGTAGGGAAGAAAGGACAAGGG + Intronic
946428625 2:219613245-219613267 CAGTGAGTAAGGGGGGAGATGGG + Intronic
946764066 2:223023822-223023844 CAGTGGTTGAGGAGGGGCAATGG + Intergenic
947243476 2:228020961-228020983 CAGTGGGTACAGAAGGAGAAGGG + Intronic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
1168741247 20:193270-193292 AGGTGGGTATGGAGCGACAATGG + Intergenic
1168754892 20:309660-309682 CTGTGGGTAAGGAGGCAGGAGGG - Intergenic
1169347188 20:4838113-4838135 CAGTGGATGTGGAGAGACAAGGG + Intergenic
1169359668 20:4937411-4937433 CAGTGGGGAAGGAGGAGCAGAGG + Intronic
1170441666 20:16385686-16385708 CAGTGGGGAAGGAGGGGCCTGGG + Intronic
1170731578 20:18980536-18980558 CAGTTGGTAAGTAGGGGCACTGG + Intergenic
1171233843 20:23508923-23508945 CCCTGGCTCAGGAGGGACAATGG - Intergenic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172938812 20:38640663-38640685 CAGTGGGGAAGGAGGGGCCCAGG - Intronic
1173458252 20:43221154-43221176 CAGTTGGTAAGCAGGGGCACTGG - Intergenic
1174931858 20:54824832-54824854 CAGTGGGTAAAGAGAGAGAGAGG + Intergenic
1175081543 20:56424792-56424814 CAAAGGGGAAGGAGGCACAAGGG + Intronic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175349462 20:58308661-58308683 AAGAGGGCAAGAAGGGACAAGGG + Intergenic
1175508256 20:59502987-59503009 GAGTGAGAAAGGAGAGACAAAGG + Intergenic
1175960760 20:62635177-62635199 CAGTGGGGAGGGAGGGACACAGG - Intergenic
1176304476 21:5115965-5115987 CAGTGGGTGGGGAGGGCCGAGGG + Intergenic
1176879495 21:14173795-14173817 TAATGGGTAAGGAAAGACAAAGG + Intronic
1179226068 21:39454557-39454579 CAGTGGGGCAGGGGGGACAAAGG + Intronic
1179852580 21:44146065-44146087 CAGTGGGTGGGGAGGGCCGAGGG - Intergenic
1179957346 21:44749026-44749048 CAGTGGATGAGGAGGGGCAGTGG + Intergenic
1180607360 22:17068800-17068822 CAGTGGGTGAAGGGGGAGAAGGG - Intergenic
1182697782 22:32208148-32208170 AACTGAGTCAGGAGGGACAATGG + Intergenic
1183343572 22:37294964-37294986 CAGTGGGTCAGGAGAGACTTTGG - Intronic
1184019034 22:41808305-41808327 CAGAAAGTAAGAAGGGACAAAGG - Intronic
1184924165 22:47625835-47625857 TGGTGGGTATGGAGGGACAAGGG - Intergenic
951111285 3:18807342-18807364 CTGTAGGTAATAAGGGACAATGG + Intergenic
953025721 3:39143823-39143845 CAGTGGGAAAGTAGGGACCAGGG + Exonic
953474044 3:43191097-43191119 CACTGGGTGAGGAGCTACAATGG + Intergenic
954075606 3:48177152-48177174 GTGTGGGTTAGGAGGGACCATGG - Intronic
954104533 3:48402831-48402853 AAATGGGAAAGAAGGGACAATGG + Intergenic
956196777 3:66661112-66661134 GACTGGGTGAGGAGGGTCAAAGG + Intergenic
957982471 3:87526853-87526875 CAGTAGGTAAAGAGGAAGAAAGG - Intergenic
959578495 3:107960723-107960745 CAGTGGGGAGGGAGAGAGAAAGG + Intergenic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960707188 3:120492754-120492776 CAGCTGGATAGGAGGGACAAGGG - Intergenic
961319489 3:126063111-126063133 CAGTGGGAATGGAGGGTCACAGG - Intronic
961563842 3:127749527-127749549 CAGTGAGTAAGGATGAATAAAGG - Intronic
961580068 3:127873856-127873878 CAGTGGCTTAGAAGAGACAAGGG + Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
961681740 3:128604162-128604184 CACTGGGAAAGGAAGGACAGAGG + Intergenic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
966259487 3:177957891-177957913 AAGCAGGTAATGAGGGACAAAGG + Intergenic
966311436 3:178598568-178598590 AAAGGGGGAAGGAGGGACAAAGG + Intronic
966420836 3:179732814-179732836 CAGTGGGGGAAGAGAGACAAGGG - Intronic
969904812 4:10383961-10383983 CAGAAGGCAAGGAGGAACAAAGG - Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970649767 4:18163759-18163781 CAGAGGGTAAGGAGGTTTAAGGG - Intergenic
971029878 4:22624297-22624319 GAGTGTGTAATGATGGACAATGG - Intergenic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
972249165 4:37281040-37281062 GAGTGGGTCTGGAGGGGCAAAGG + Intronic
972333954 4:38089161-38089183 CAGTGAGTAAGGAGGTACACCGG - Intronic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
977044966 4:92058086-92058108 CAGTGGCTAAGAAGGGAGTAGGG + Intergenic
977285211 4:95097251-95097273 GAGAGGGGAGGGAGGGACAAAGG + Intronic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
979963532 4:127050073-127050095 CACTGTGCAAGGATGGACAATGG - Intergenic
981288974 4:143051947-143051969 AAGCGGGGAAGGAGGGAGAAAGG + Intergenic
981467383 4:145088884-145088906 CAGTGAGTAAGGAGGAGAAATGG - Intronic
981471577 4:145141407-145141429 CAGTGAATAAGGTGGTACAATGG + Exonic
981649305 4:147038004-147038026 CAGTGAGAAATCAGGGACAAAGG + Intergenic
981812613 4:148792978-148793000 CAGTGGGAAAGGAGGAACCTGGG - Intergenic
981866677 4:149429242-149429264 CAGTGCATAAGGAAAGACAACGG + Intergenic
982346622 4:154367294-154367316 CAGGGTGGAAGGAGGGAGAACGG + Intronic
983908383 4:173208513-173208535 GAGGGGGTAAGAAGGGATAAAGG - Intronic
983976218 4:173937225-173937247 CAGGAGGTAAGAAGGGAAAAAGG - Intergenic
984541188 4:181039621-181039643 CAGGGGGTGGGGAGGGATAAGGG - Intergenic
984853672 4:184175102-184175124 CACTGGGCAAGGAGGGAGAGCGG - Intronic
985930387 5:3052394-3052416 AAGTGGGAGAGGAGAGACAAAGG + Intergenic
986382876 5:7204424-7204446 TAGTGAGTAAGGAGGGACTGTGG + Intergenic
986621384 5:9679199-9679221 CAGGGGGAAAGGAAGGATAATGG + Intronic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
990976635 5:61566572-61566594 CAGTGTGTCAGGAGGCCCAAAGG + Intergenic
993085771 5:83361938-83361960 GAGAGGGGAAGGAGGGACAGAGG - Intergenic
995058030 5:107783311-107783333 ATTTGGGTAAGGAGGAACAAGGG + Intergenic
995891212 5:116954061-116954083 CAGTGGGCAAGAAGAGGCAAAGG - Intergenic
996201992 5:120686558-120686580 TAGTGGGAAAGGAGGGAGATGGG - Exonic
996777794 5:127151681-127151703 CAGAGGATAAGGAGGAAGAAAGG - Intergenic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
1001083499 5:168683936-168683958 CAGTGGGTCAGGAGGGAGAGAGG + Intronic
1001923200 5:175616917-175616939 CAGTGGTGATGGAGGGACAAGGG + Intergenic
1001939975 5:175733509-175733531 CACTGGGAAAGGAAGGGCAATGG - Intergenic
1005060703 6:21774514-21774536 AAGTGGGGAATGAGGGAGAAAGG - Intergenic
1005409880 6:25533193-25533215 CAGTAGATAAAGAGGGACAGAGG - Intronic
1006501458 6:34461775-34461797 CAGTGGGAAAGAAGGTACCATGG + Intergenic
1006727705 6:36211591-36211613 TGGAGGGTAAAGAGGGACAAAGG + Intronic
1006744293 6:36330567-36330589 CAGTGGGCAGGGAGAGCCAATGG + Exonic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007986762 6:46215115-46215137 CAGTGGGTAAGAATGGACTGTGG + Intergenic
1008395414 6:51000884-51000906 AAGTGGAGAAGGAGGGACAAAGG - Intergenic
1008527064 6:52417932-52417954 GAGTGGGTAGGGAGGGATCATGG + Intergenic
1009437806 6:63636922-63636944 CTGAGGGAAAGGAGGGACACAGG - Intronic
1010054735 6:71551951-71551973 CATTGGGTAAGAAGAAACAAGGG + Intergenic
1012546798 6:100428997-100429019 CTGTGGATAAGGGGGGACTATGG + Intronic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1013566925 6:111374502-111374524 CAGTGGGTAGGGAAGCAGAAAGG + Exonic
1014745881 6:125199958-125199980 GACTGGGTAAGCAGGGACACAGG + Intronic
1017787895 6:157771802-157771824 CAGTGGGTGAGGCAGGAGAATGG - Intronic
1018033860 6:159865619-159865641 CACTGGGCAAGGAGGGGAAAGGG + Intergenic
1018581486 6:165311804-165311826 CAGATGGGCAGGAGGGACAAAGG + Intergenic
1018753632 6:166829484-166829506 CAGAGGCTAAGGAAGGAGAATGG + Intronic
1019092389 6:169550108-169550130 CAGGGGGCCAGGAGGCACAAGGG + Intronic
1019219636 6:170463583-170463605 CAGTCGGTAAGGAGAGGCATTGG + Intergenic
1019714272 7:2531103-2531125 CAGAGGGAAAGCAGGGACCAGGG + Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1021620746 7:22549480-22549502 CAGTGGGCAAGGAGTGAGACTGG + Intronic
1023195029 7:37627247-37627269 CAGTGGTTAAGGAGGGAGTGAGG - Intergenic
1023396658 7:39757966-39757988 GAGTATGTAAGAAGGGACAAAGG + Intergenic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1025276946 7:57591010-57591032 CAGAGAGTAAAGAAGGACAAGGG + Intergenic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1029443826 7:100602283-100602305 CAATGGGGAAGGCGGGACAGTGG - Exonic
1029477161 7:100791974-100791996 CAGCGGAGGAGGAGGGACAAGGG + Exonic
1029801195 7:102949222-102949244 TAGTGGGGCAGGAGAGACAATGG + Intronic
1030230499 7:107203922-107203944 CAGTAGGGAAGCAGGGAAAAGGG - Intronic
1030698888 7:112617025-112617047 CAGAGGGGAAGCAGGGTCAAGGG + Intergenic
1031068509 7:117135095-117135117 CAGTGGGGAAGGAGAGTGAAAGG + Intronic
1032305929 7:130732994-130733016 CAGAGAGAAAGCAGGGACAACGG + Exonic
1032446761 7:131990901-131990923 AAGTGGACAAGGAAGGACAAAGG + Intergenic
1032794938 7:135269626-135269648 CAGTGGGAAGGCAGGGCCAAGGG + Intergenic
1034281818 7:149859847-149859869 CACTGGAGAAGGAGGGAGAAGGG - Intronic
1034338660 7:150338969-150338991 CTGCGGGTAAGAAGGGGCAAGGG - Exonic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414086 7:158668233-158668255 TAGTGGGTAAGGAGGGCAGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1036157712 8:6358044-6358066 CAGAGGCTAAGGCGGGAGAATGG - Intergenic
1036456027 8:8908756-8908778 GACTGGGTAAGGAGGTACATCGG + Intergenic
1036693409 8:10959193-10959215 GAGTGGGGAGGGAGGGACACTGG - Intronic
1037659783 8:20916616-20916638 CAGTGGGTATGGGGGGAAACTGG + Intergenic
1039161168 8:34622819-34622841 CACTGAGCAAGGAGGCACAATGG - Intergenic
1040556055 8:48478340-48478362 CAGAAGGCAAGGAGGGGCAAGGG + Intergenic
1040772872 8:51000206-51000228 AAGTGGGTATGGAGAGATAAAGG - Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044724290 8:95180373-95180395 CAGTAGCTAGAGAGGGACAAAGG + Intergenic
1045363648 8:101455481-101455503 GAGTGGCTGAGGAGGGACAGTGG - Intergenic
1047346873 8:124037475-124037497 CAGTGGGGACAGAGGGACAGTGG + Intronic
1048550422 8:135428244-135428266 CACTGGGGCTGGAGGGACAAGGG - Intergenic
1048928404 8:139291307-139291329 CAGTAGGTAAGGAGGAACCGAGG - Intergenic
1049281977 8:141754114-141754136 CTGTGGGTGAGGCGGGAGAATGG - Intergenic
1055277371 9:74634295-74634317 CAGTGGGGAAGGAGTAGCAAAGG - Intronic
1055602994 9:77939103-77939125 CAGTGGGAAAGAAGTGACACTGG - Intronic
1055954445 9:81761040-81761062 CAGTGGGAAAGGAAGTGCAAAGG - Intergenic
1056258215 9:84822244-84822266 CAGTGGGGGAGGAGTGTCAAGGG - Intronic
1056674112 9:88658716-88658738 CAGTGTGTGAGCAGGGAAAATGG + Intergenic
1057221755 9:93261293-93261315 AAGTGGGGAAGGAGGAACCATGG - Intronic
1057310791 9:93941831-93941853 CAGTAGGTAGCAAGGGACAATGG + Intergenic
1057884982 9:98823185-98823207 CACTGGGGATGGAGTGACAAAGG - Intronic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1058648375 9:107152100-107152122 CAGGAGGTAAGGAGAGAGAAAGG + Intergenic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059669336 9:116478109-116478131 GAGGGGGTAGGGAGGGAGAAAGG + Intronic
1060202123 9:121657360-121657382 GGGTGGGTCAGGAAGGACAAAGG - Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1061994572 9:134177112-134177134 CAGGGGGAGAGGAGGGACATGGG - Intergenic
1062000410 9:134213076-134213098 GAGGGGATAAGGAGGGACATGGG + Intergenic
1062623163 9:137431628-137431650 CAGTGGGAGGGGAGGGGCAATGG - Intronic
1062687466 9:137822084-137822106 CAGGGGAGAAGGAGGGACTAAGG - Intronic
1187977707 X:24719870-24719892 CAGTGGGCAAGAAGGGATCAGGG - Intronic
1188575602 X:31646206-31646228 CAGTGGGAAAGGAAAGCCAAAGG - Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189618507 X:42810594-42810616 CAGAGGCTAAGGCAGGACAATGG + Intergenic
1190752145 X:53372016-53372038 CAGTAGGTCTGGAGGGATAAGGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1194424440 X:93719127-93719149 CAGTGGTTACAGAGGGGCAAGGG - Intergenic
1195958537 X:110360810-110360832 CAGTGGGAATGGAAGGAAAATGG + Intronic
1196898422 X:120360280-120360302 CAGTGGCTACAAAGGGACAAGGG - Intergenic
1197338984 X:125243184-125243206 CAGAGGCTAAGGCGGGAGAATGG + Intergenic
1198097364 X:133393110-133393132 AAGTGGGAGAGGAGGGAGAATGG + Intronic
1198295513 X:135283005-135283027 CAGAGCCTAAAGAGGGACAAGGG + Intronic
1198711477 X:139508820-139508842 CAGTGTGGAATGAGAGACAATGG + Intergenic
1199474316 X:148229080-148229102 CAGTAGTAAAGGTGGGACAAAGG - Intergenic
1202117406 Y:21482766-21482788 CAGTGGGGGAGGGGAGACAAGGG + Intergenic