ID: 1161238987

View in Genome Browser
Species Human (GRCh38)
Location 19:3211392-3211414
Sequence GGGCAGTGCTTACCTGACCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161238973_1161238987 25 Left 1161238973 19:3211344-3211366 CCTGACTCCGGAGCATGGGGCCG No data
Right 1161238987 19:3211392-3211414 GGGCAGTGCTTACCTGACCCCGG No data
1161238980_1161238987 5 Left 1161238980 19:3211364-3211386 CCGCTGGCCACTGGGGATGGAAT No data
Right 1161238987 19:3211392-3211414 GGGCAGTGCTTACCTGACCCCGG No data
1161238984_1161238987 -2 Left 1161238984 19:3211371-3211393 CCACTGGGGATGGAATGGCGGGG No data
Right 1161238987 19:3211392-3211414 GGGCAGTGCTTACCTGACCCCGG No data
1161238975_1161238987 18 Left 1161238975 19:3211351-3211373 CCGGAGCATGGGGCCGCTGGCCA No data
Right 1161238987 19:3211392-3211414 GGGCAGTGCTTACCTGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161238987 Original CRISPR GGGCAGTGCTTACCTGACCC CGG Intergenic
No off target data available for this crispr