ID: 1161241915

View in Genome Browser
Species Human (GRCh38)
Location 19:3227577-3227599
Sequence CTGGAGGTGCACCCGGCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161241915 Original CRISPR CTGGAGGTGCACCCGGCTCC TGG Intronic
900137648 1:1125179-1125201 CTGGAGGAGCTCCCGGCTCCCGG + Intergenic
900467079 1:2831095-2831117 GGGGAGGTGCACCTGGCACCAGG - Intergenic
900655039 1:3752672-3752694 CTGGAGGAGCACCAGGGCCCTGG - Exonic
900960447 1:5915698-5915720 CTGGAGGTGACCCCAGCTCAGGG - Intronic
901668309 1:10838808-10838830 CAGGAAGTGCACCAGCCTCCAGG + Intergenic
905365560 1:37449270-37449292 CTGGAACTGCTCCTGGCTCCTGG + Intergenic
906306779 1:44724663-44724685 CTGGAGGTGCGCGCGGCGGCTGG + Exonic
906325546 1:44843259-44843281 CTGGAGCTCCAGCCGCCTCCCGG - Intergenic
906719567 1:47995853-47995875 CTGGAGGTGCACCTTGCCCAAGG + Intronic
906961747 1:50423143-50423165 CTGGCGCTGCACGCGCCTCCCGG + Exonic
911689041 1:100810394-100810416 CTGTATGTGGACCCAGCTCCTGG + Intergenic
915574506 1:156766881-156766903 CTGGATGTGCACCCCGATCCTGG + Intronic
918067286 1:181109920-181109942 CTGGAGCTGCCCCCGGGTCCTGG + Intergenic
918299156 1:183186401-183186423 CTGGAGGTGGCCCGGGCTGCGGG - Exonic
918374742 1:183897866-183897888 CTGGAGCTGCAGCCGCCTCTGGG - Exonic
921481660 1:215671165-215671187 CTGGAGGTACAAATGGCTCCAGG - Exonic
1063450083 10:6145196-6145218 CTGGAGGGACACGCGGGTCCGGG - Intronic
1065529341 10:26653091-26653113 CCGGGGGTGCTCCTGGCTCCTGG - Intergenic
1065817475 10:29495236-29495258 CTGGAGATCCACCAGGGTCCCGG - Intronic
1076714341 10:132355687-132355709 CTTGCGGTGCACCTGTCTCCAGG - Intronic
1077078584 11:712565-712587 CTGCAGGAGGACCCAGCTCCAGG - Intronic
1077216934 11:1398869-1398891 CTGGGGGGGCTCCAGGCTCCAGG - Intronic
1079126170 11:17719981-17720003 GCGGCGGTGCACCCGGCCCCGGG + Exonic
1083596498 11:63920382-63920404 CTGGAGCTGCCCCCGCCTGCGGG - Intergenic
1084063961 11:66692920-66692942 CTGGGGGTGGAGCCGGCTGCAGG - Intronic
1084305271 11:68278604-68278626 CTGGGGGTGCACCACGCTCCTGG + Intergenic
1084431892 11:69115847-69115869 CTGGGGCTGCACCCGCCTGCTGG - Intergenic
1088705195 11:112455829-112455851 CTGGAGGTCCACTGGGCTCCAGG + Intergenic
1088991749 11:114960070-114960092 CTGGAGGTGCTGCAGTCTCCTGG + Intergenic
1089741938 11:120590488-120590510 ATCCAGGTGCACCCGGCTGCTGG + Intronic
1091097867 11:132840922-132840944 CTGGAGGTCCACCTGGGCCCTGG - Intronic
1091356878 11:134944196-134944218 CAGGTGGGGCACCCTGCTCCTGG - Intergenic
1095694452 12:45129032-45129054 TTACAGGTGCACCCAGCTCCAGG - Intergenic
1098467092 12:70800030-70800052 CTGGAGGTGCAGCCAGCATCTGG + Intronic
1104416648 12:128601311-128601333 CTGTCGGGGCACTCGGCTCCTGG + Intronic
1104458097 12:128932118-128932140 ATGAAGGTGCTGCCGGCTCCTGG + Intronic
1104753838 12:131256578-131256600 CTGGAGGTGCACAGGTTTCCTGG + Intergenic
1104837486 12:131800802-131800824 CTGGACGTGAAGCCGTCTCCAGG + Intergenic
1105778974 13:23690050-23690072 AGGGAAGGGCACCCGGCTCCTGG + Intergenic
1108727991 13:53201988-53202010 CTGGCGCTGCACCCGGCTTCGGG + Intergenic
1112356573 13:98678778-98678800 CTGGAGGGGCAGCCGGCTTAGGG - Intergenic
1114737200 14:25054356-25054378 CTGGAGGTGCTCACTGCTACTGG - Intergenic
1115382473 14:32756351-32756373 ATGGAGGTGGACCTGGCTTCTGG + Intronic
1115653347 14:35419740-35419762 CTGAAGGTGCATCCTTCTCCGGG - Intergenic
1115970695 14:38941656-38941678 CTGGAGGTGCCCTGTGCTCCAGG + Intergenic
1118329201 14:64802572-64802594 CTGATGGTGCACCAGGCTCCAGG - Intronic
1118329688 14:64805658-64805680 CTGATGGTGCACCAGGCTCCAGG - Intronic
1120852012 14:89180091-89180113 CTGGCGGTGGACCCTGATCCGGG + Intronic
1121432429 14:93897297-93897319 CTGCAGGTACAGCTGGCTCCAGG - Intergenic
1122273916 14:100581451-100581473 CTGGAGGGGCTTCCGGCTCCTGG + Intronic
1122588441 14:102827183-102827205 CTGGAGGTGCACTCGGGCCCGGG + Intronic
1202896577 14_GL000194v1_random:13908-13930 CCAGATGTGCACCCGGATCCTGG + Intergenic
1124831660 15:33154704-33154726 CTGGATGTTCGTCCGGCTCCTGG + Exonic
1125610592 15:40966890-40966912 CAGGAGGGGAACCGGGCTCCAGG + Intergenic
1125636356 15:41192100-41192122 CTGGTGGTTCTCCCCGCTCCTGG + Intronic
1128452198 15:67812077-67812099 CTGGGGGTCCACCTGGCCCCAGG - Intergenic
1132704460 16:1237126-1237148 CTGGAGGCAGACCCCGCTCCAGG - Intergenic
1132707056 16:1249299-1249321 CTGGAGGCAGACCCCGCTCCAGG + Intergenic
1135419735 16:22297683-22297705 GAGGAGGGGCAGCCGGCTCCAGG + Intronic
1137675301 16:50301075-50301097 CGTGATGTGCACCCGGCTACGGG - Exonic
1138023110 16:53502762-53502784 CTGGAGGGGCCCGCGGCTCCCGG - Intronic
1138093474 16:54194646-54194668 CTGGAGGTGAGCCCAGCCCCTGG + Intergenic
1138288053 16:55824897-55824919 CTGGAGGTTCTCCTGACTCCAGG + Intronic
1139491127 16:67286593-67286615 CTGGAAGTGCACAAGGCTCTGGG - Exonic
1141008057 16:80371644-80371666 CTGGAGGTGCTCCCAGCACCAGG + Intergenic
1141935193 16:87233805-87233827 CTGGAGGTGCTGTGGGCTCCAGG + Intronic
1142163345 16:88570661-88570683 CCGGAGGCGCGCCGGGCTCCCGG - Intronic
1147385030 17:40075934-40075956 TGGGAGCTGCATCCGGCTCCAGG + Intronic
1147971357 17:44220250-44220272 CCGGAGGTGCCCCCGGCGTCCGG + Intronic
1148687838 17:49510479-49510501 CTGGAGGTGCCTCAGGCTCCTGG - Exonic
1150790893 17:68199497-68199519 CTGGATGTGCCCGCGGCCCCTGG + Intergenic
1152810482 17:82379592-82379614 CGGGAGGAGCACCTGGTTCCGGG + Intergenic
1152913623 17:83020374-83020396 CTGGAAGTGGACTCGGCTCCTGG - Intronic
1153006136 18:500333-500355 CTGGGGGCGCACCCGGCTCCCGG - Intronic
1158920789 18:62188231-62188253 CTGGTGTTGCACTTGGCTCCTGG + Intronic
1159902920 18:74064858-74064880 GAGGAGGTCCACCAGGCTCCCGG - Intergenic
1160122588 18:76144022-76144044 CTTGAGGTGCACCCGGAGCTTGG - Intergenic
1160508678 18:79441339-79441361 CTGGAGGTGCACATGGCTGCTGG + Intronic
1160569098 18:79804362-79804384 CCGGTGCTGCACCAGGCTCCAGG + Intergenic
1160867543 19:1262474-1262496 GTGGGGCTGCACCAGGCTCCTGG - Intronic
1160874055 19:1289085-1289107 CTGGAGTCGCATCCGGCTGCAGG + Intronic
1161152265 19:2716185-2716207 CTGCAGGTACACTCGACTCCAGG + Exonic
1161158982 19:2751147-2751169 CTGGAGGTTCAACCTACTCCTGG + Intergenic
1161241915 19:3227577-3227599 CTGGAGGTGCACCCGGCTCCTGG + Intronic
1161295348 19:3516903-3516925 CTGCAGCTGCACACGGCCCCTGG - Intronic
1162344241 19:10110440-10110462 GTGGAGCTGCACCCGGATCTTGG + Intronic
1162744096 19:12789623-12789645 CTCGAGGCGCCCCCGGCGCCTGG - Intronic
1163371250 19:16902553-16902575 CAGGAGGAGCTTCCGGCTCCAGG - Intronic
1163540910 19:17909632-17909654 CTTCAGGTGCAGCTGGCTCCAGG + Intergenic
1163785946 19:19274981-19275003 CTGGAGGCTCACCAGGCTCAGGG - Intergenic
1167151845 19:47714555-47714577 CTGGAGGTGCTCATTGCTCCTGG + Intronic
1167428909 19:49443208-49443230 CTGGAGGTGGACTCAGCGCCGGG - Intergenic
1168319633 19:55501140-55501162 CTGGAGGACCACCCGGCGCCCGG + Exonic
926226240 2:10968790-10968812 CTGGGGGTGAGCCCCGCTCCTGG - Intergenic
928164374 2:28959074-28959096 CTGGAGGTGCAGCCACCACCTGG - Intronic
929863157 2:45696438-45696460 GTGGAAGTGCACCCATCTCCTGG + Intronic
933858656 2:86442228-86442250 CTGAAGGTACAGGCGGCTCCGGG + Exonic
935941088 2:108240000-108240022 CTGGAGCTGGACCTGGCTCTGGG + Intergenic
937065880 2:119017306-119017328 CTGGAGGGGCACTTGGCTCAAGG - Intergenic
937254003 2:120541865-120541887 CTGAAGGTGCTCCCGCCCCCCGG + Intergenic
938223016 2:129587812-129587834 CAGGAGGTGCACTGGCCTCCCGG + Intergenic
947223244 2:227814672-227814694 CTGGAGGTTCACTTGACTCCAGG - Intronic
948888176 2:240894136-240894158 CAGGAGGTGCCCCTGCCTCCAGG + Intronic
949072323 2:242033160-242033182 CTGGGGGTGACCCCGGCTCTCGG - Intergenic
1169728778 20:8764523-8764545 CAGCTGGTGCACCCGTCTCCTGG + Intronic
1175770200 20:61618595-61618617 CTGGAGGTGCATCCAGCACCCGG + Intronic
1175819682 20:61902075-61902097 CAGAAGGTGCCCCTGGCTCCAGG - Intronic
1176181560 20:63751985-63752007 GTGGAGGCGCCCCGGGCTCCGGG - Intronic
1176616263 21:9029904-9029926 CCAGATGTGCACCCGGATCCTGG + Intergenic
1180199282 21:46215061-46215083 ATGGAGGTACACCAGGCTCCAGG + Intronic
1180658389 22:17444080-17444102 CTGGCAGTGCACCCGGCCTCTGG + Intronic
1180711480 22:17842346-17842368 CTTCAGGGGCACCTGGCTCCTGG - Intronic
1181056157 22:20261400-20261422 CTCCTGGTGCACCTGGCTCCAGG - Intronic
1181169901 22:21002164-21002186 CCGGAGGTGCCCCCGCCACCGGG + Intronic
1181514287 22:23402444-23402466 CTGGATGTGGACCTGGCTGCGGG - Intergenic
1182903781 22:33920232-33920254 CTGGAGCTGCTCCCGGCCCGGGG + Exonic
1183726759 22:39594250-39594272 CAGCAGGGGCACCGGGCTCCTGG + Intronic
950571205 3:13801179-13801201 CTGGAGGTGTAGCAGGCACCAGG - Intergenic
950668020 3:14509089-14509111 CGGGACGTGGACCCTGCTCCTGG - Intronic
953449218 3:42992151-42992173 CTGGAGAGGCTCCTGGCTCCTGG + Intronic
953890606 3:46749542-46749564 CTGGATGTGCAGCTGCCTCCTGG - Intronic
954696715 3:52431318-52431340 CTGGAGGTACACCAGGTTCTTGG + Intergenic
955028385 3:55192125-55192147 CTGGAGTTCCACCAGGCACCAGG + Intergenic
961508246 3:127385713-127385735 CTGGAGGTGTCCCCTGCTCAAGG - Intergenic
962837061 3:139198828-139198850 CTGGAGGGGCACCAGGTTCAGGG + Intronic
963460687 3:145611181-145611203 CTGGAGCTGCACTGGGCTTCTGG - Intergenic
968190027 3:196660808-196660830 TCGGAGCTGCACCTGGCTCCGGG + Exonic
968606063 4:1536302-1536324 TTGGAGCTGCACCGGGCTCTCGG - Intergenic
968616270 4:1579132-1579154 CTGGAGGCGCAGCCGCCTCCGGG - Intergenic
968720393 4:2198294-2198316 CTGTGGGAGCAGCCGGCTCCAGG - Intronic
969525461 4:7701877-7701899 CTGGGGGTACCCCAGGCTCCAGG - Intronic
969626745 4:8309466-8309488 CAGGAGGAGCACCCTGCCCCAGG + Intergenic
979675181 4:123401941-123401963 CTGGAAGTGCAGCCAGCTCTGGG + Exonic
985713227 5:1441987-1442009 CTGGAGGGGCTCCCAGCACCTGG - Intronic
986206666 5:5630826-5630848 CTGGAGGTGCCCTTGCCTCCTGG + Intergenic
996744067 5:126830216-126830238 CAGCAGGTGCAGCCAGCTCCGGG + Intronic
997742678 5:136270989-136271011 CTGGAGGTGCTCTCCTCTCCTGG + Intronic
1001512237 5:172332114-172332136 CTGGAGGGGCATCCGCCTCATGG - Intronic
1001768589 5:174275171-174275193 CTTGAGGTGCTCCCAGCCCCTGG + Intergenic
1002079289 5:176727999-176728021 GTGGGGGTGCTCCTGGCTCCAGG + Intergenic
1005947366 6:30604114-30604136 CTGGGTGTGCCCCCGGCCCCTGG - Exonic
1008705234 6:54150254-54150276 CTGGAGGTTCACTAGGCTGCAGG + Intronic
1015038927 6:128692808-128692830 CTGGAGGTGCCTCAGCCTCCTGG + Intergenic
1019303637 7:322211-322233 CAGCAGGTGCACCGAGCTCCTGG - Intergenic
1019625002 7:2011498-2011520 CTGGGGGTGCCGCCAGCTCCTGG - Intronic
1021782995 7:24124409-24124431 CTGGAGGTGAACCAGCCTCTGGG + Intergenic
1022106238 7:27199761-27199783 CTGTAGGCGGACGCGGCTCCTGG + Exonic
1026399816 7:69998272-69998294 CAGGAGGGTCACCCGGGTCCAGG - Intronic
1026517224 7:71083387-71083409 CAGGAGGATCACCTGGCTCCAGG - Intergenic
1027231329 7:76274324-76274346 CTGGAGGAGCAACGGGCACCAGG + Intronic
1029479127 7:100802333-100802355 CCGGAGGTGCCCCAGGCTCTTGG + Intergenic
1029529934 7:101118614-101118636 ATGGTGGAGCACCGGGCTCCTGG - Intergenic
1029694246 7:102202544-102202566 CTGGATGTGGACTCGGCTGCCGG - Intronic
1034306537 7:150048619-150048641 CTGAAGGTGCAGCCGGCCCCGGG + Intergenic
1034781639 7:153887219-153887241 CTGGAGGAGCCCCCGGAGCCGGG + Intronic
1034800310 7:154052024-154052046 CTGAAGGTGCAGCCGGCCCCGGG - Intronic
1036651925 8:10649761-10649783 CTGGCTGTGCTTCCGGCTCCAGG + Intronic
1036711854 8:11084993-11085015 CTGCAGGTGCACCTGGATGCAGG - Intronic
1036810888 8:11867306-11867328 CCGGGGGCGCACCCTGCTCCTGG - Intronic
1037901360 8:22691284-22691306 TTGGGGGTGCCCCCGGCTTCAGG - Exonic
1039618205 8:38974055-38974077 CTGGGGGAGAACCTGGCTCCGGG + Intergenic
1041689790 8:60678313-60678335 GGGGCGGCGCACCCGGCTCCGGG + Intergenic
1045278184 8:100725168-100725190 CTGGAGGTGAACACGGCCCTAGG - Intergenic
1049214012 8:141399430-141399452 CTGGGGGTGCCCGGGGCTCCCGG + Intronic
1049256656 8:141617713-141617735 ATGGAGGTGGACCAGGCTGCAGG + Intergenic
1049575581 8:143388388-143388410 CTGGAGGTGCAGCGGGAACCAGG - Intergenic
1052896250 9:33750649-33750671 CTGGAGCTGCACCCGCTTCTGGG + Exonic
1054845121 9:69787115-69787137 CTGGTGGTGCACCAGGTACCTGG - Intergenic
1058091852 9:100814143-100814165 CTGGATGTACACACGGCTCAGGG + Intergenic
1059208179 9:112486430-112486452 GTGGAGGTGCACAGAGCTCCGGG + Exonic
1060055468 9:120409246-120409268 CTGAAGGTGCTCCAGGCTCACGG + Exonic
1060584579 9:124777823-124777845 CAGGGGGTGCACCCGGTCCCTGG - Intronic
1061295065 9:129672495-129672517 CTGAAGCTGCCCCTGGCTCCCGG + Intronic
1062093169 9:134689191-134689213 CTGCAGGTGCCCCTGGCTGCAGG + Intronic
1062206775 9:135341861-135341883 CTGCAGGTGCACCCGGACCCTGG - Intergenic
1062440689 9:136567997-136568019 CTGGAAGAGCCCCTGGCTCCCGG + Intergenic
1199854323 X:151747841-151747863 CTGATGGTGAACCAGGCTCCAGG - Intergenic
1201149640 Y:11088628-11088650 CCAGATGTGCACCCGGATCCTGG + Intergenic
1201756667 Y:17494029-17494051 CTGGAGATGGACCCAGTTCCCGG + Intergenic
1201844886 Y:18411955-18411977 CTGGAGATGGACCCAGTTCCCGG - Intergenic