ID: 1161245554

View in Genome Browser
Species Human (GRCh38)
Location 19:3249720-3249742
Sequence GGTCTGAGAGGACCACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161245554_1161245558 -1 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245558 19:3249742-3249764 CATCCCCTCTCCCTCTGATAGGG 0: 1
1: 0
2: 0
3: 25
4: 227
1161245554_1161245569 21 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245569 19:3249764-3249786 GGAAGGTGAGGCCCAGAGAGGGG 0: 3
1: 11
2: 132
3: 611
4: 1958
1161245554_1161245568 20 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296
1161245554_1161245570 22 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245554_1161245557 -2 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245557 19:3249741-3249763 CCATCCCCTCTCCCTCTGATAGG 0: 1
1: 0
2: 3
3: 29
4: 335
1161245554_1161245565 9 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245554_1161245567 19 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245567 19:3249762-3249784 GGGGAAGGTGAGGCCCAGAGAGG 0: 2
1: 15
2: 226
3: 1214
4: 4282
1161245554_1161245563 4 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245554_1161245559 0 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161245554 Original CRISPR GGTCTGAGAGGACCACAAGT TGG (reversed) Intronic
902851038 1:19156953-19156975 TCTCTGAGAGGACCAGGAGTAGG - Intronic
904289142 1:29472370-29472392 AGTCCCAGTGGACCACAAGTCGG + Intergenic
904563155 1:31412267-31412289 GGTGTGAGAGACCCAGAAGTAGG - Intronic
904858015 1:33514606-33514628 GGTCTGAGAGGGGCATAAGAAGG + Exonic
906126200 1:43428392-43428414 GGGCTGAGAGGACCAGGACTTGG - Exonic
906508918 1:46400234-46400256 AGTCTGAGAGGACCACAGCTTGG + Intronic
906773254 1:48504275-48504297 AGTCTGATAGTACCACATGTTGG - Intergenic
907048719 1:51315568-51315590 GGTCTGAAAGGACCAGAAAGTGG - Intronic
907604573 1:55803956-55803978 GCTCTGTGAAGAACACAAGTTGG + Intergenic
910160528 1:84267477-84267499 GGTGGGAGAGGACCACAAAAAGG - Intergenic
911084142 1:93962605-93962627 TGGCTGAGAGAACCACAGGTAGG + Intergenic
915135871 1:153731087-153731109 GGTCTGATAGGAAAACAGGTTGG + Intronic
915607851 1:156964815-156964837 GGTCTGAGAGCCCCAGAAGGTGG + Intronic
1063034231 10:2269344-2269366 GGTGTGAGTGGACCAGAGGTGGG + Intergenic
1075657219 10:124169903-124169925 GGGCTGAGGGTACCACAGGTGGG - Intergenic
1076424620 10:130358868-130358890 GGTCTCAGAGGACAACAAAGAGG - Intergenic
1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG + Intronic
1080559462 11:33449661-33449683 GGTCAGAGAGGACCATCAGGAGG - Intergenic
1080931690 11:36817947-36817969 GGTCAGAGAGGCCCACAGGCAGG + Intergenic
1082189882 11:49230184-49230206 TGTCTGAGTCTACCACAAGTGGG - Intergenic
1083414674 11:62517819-62517841 GGTCTGAAAGGTTCAGAAGTAGG - Exonic
1083923299 11:65791834-65791856 GGACAGAGAGCACCACAAGCAGG + Intronic
1086676640 11:89616335-89616357 TGTCTGAGTCTACCACAAGTGGG + Intergenic
1087658467 11:100956018-100956040 GGTCTGAGAAGAGGACAAGATGG - Intronic
1089498529 11:118919680-118919702 GGTCTGGGAGGAACACAGGCTGG - Intronic
1089559888 11:119338472-119338494 TTTCTGAGATGACCACAAGGGGG - Intergenic
1093353615 12:18135080-18135102 GGTCTGAGGAGACAACAGGTTGG + Intronic
1093894383 12:24561119-24561141 GGTATGTGAGGATCTCAAGTGGG + Intergenic
1094317466 12:29149359-29149381 GGATTTAGAGGACCACTAGTTGG + Exonic
1098301300 12:69056618-69056640 GGACTGTGAGGTCCACCAGTAGG + Intergenic
1100602932 12:96127846-96127868 GGTCGCAGAGGACACCAAGTTGG - Intergenic
1101574418 12:105984156-105984178 CGTCTGAGAGGAGGATAAGTGGG - Intergenic
1104664290 12:130636332-130636354 GTTCTGTGAGGACCACCAATAGG - Intronic
1104717253 12:131024256-131024278 GGTCAGAGAGGCCCACATGGAGG + Intronic
1107124413 13:36830972-36830994 GCTCTCAGAGGACTACTAGTAGG - Intergenic
1112509043 13:99991989-99992011 GGCCTGGGAGGAGCCCAAGTTGG - Intergenic
1116077294 14:40127192-40127214 AGTCTGACAGAACCACAAGCTGG - Intergenic
1119387014 14:74263844-74263866 GGTCTGCGAGGACCACATCTGGG - Intergenic
1130399348 15:83534674-83534696 AGTCTGAGGGGAACAGAAGTAGG - Intronic
1130994960 15:88898596-88898618 GCTCAGGGAGGACCACAGGTGGG + Intergenic
1135468657 16:22709531-22709553 AGTCTGAGAGGGCCAGAACTGGG - Intergenic
1136692004 16:32039315-32039337 GGTCACAGAGAACCACAAGGGGG + Intergenic
1139361108 16:66400835-66400857 TGTCTGAGATGACCACGGGTAGG - Exonic
1140126121 16:72120281-72120303 GGTCTGAGTGGACCAGGAGCTGG + Intronic
1143145075 17:4769984-4770006 GGTCTGAGTGGGCCGCAAGGAGG + Intergenic
1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG + Intronic
1147605176 17:41770341-41770363 GGTCTGGGAGTCCCACAGGTAGG + Intronic
1148587462 17:48791150-48791172 TGTCTAAGAGGACCTCAAGAAGG + Intronic
1151406855 17:73893419-73893441 AGTCAGAGAGGAAAACAAGTAGG + Intergenic
1157684724 18:49632900-49632922 GGTGGGAGAGGACCACAGGCAGG - Intergenic
1160725544 19:616464-616486 GGTCGGCGAGGGTCACAAGTTGG - Exonic
1160844603 19:1160904-1160926 GCTCTGCCAGGACCACAAGGGGG + Intronic
1160973500 19:1780742-1780764 GGTCTGACAGGGCCACGAGGAGG - Exonic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1162816509 19:13198651-13198673 GGTATGAGAGAACCAAGAGTGGG + Intergenic
1165278690 19:34777812-34777834 GGTCTGGGAGGAGGATAAGTGGG + Intergenic
1165443384 19:35843644-35843666 GGTGTGAGAGGGCCCCAGGTGGG + Intronic
925838783 2:7970989-7971011 GGACTGAGAGGACCACAGGGTGG + Intergenic
926704811 2:15829452-15829474 GGTCTGAGAGCAGGACAAGATGG + Intergenic
927899084 2:26806088-26806110 GGTGTGAGAGGATCACCATTAGG - Intergenic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
930263687 2:49175858-49175880 GGTCTGAGAGACCCAAGAGTTGG + Intergenic
935180781 2:100689463-100689485 GGGCTGAGAGGAGCTCAAGAGGG + Intergenic
935589933 2:104836741-104836763 GGTCTAAGAGCCTCACAAGTGGG + Intergenic
943701959 2:190996525-190996547 GGTCTAGGAGGACCACTAGGGGG + Intronic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
946398557 2:219456095-219456117 GGTCTGTGAGGAGGGCAAGTTGG + Intronic
947982917 2:234425576-234425598 GGTCTGAAGGGACCACCAGCAGG - Intergenic
1170392895 20:15894520-15894542 GGTCTGAGAGAGACACAAGATGG + Intronic
1170781270 20:19427672-19427694 GGCCTGGGAGGAGGACAAGTCGG - Intronic
1174210644 20:48875450-48875472 GGTGTGACATGACCACAAGCTGG + Intergenic
1175111905 20:56654375-56654397 GGTCTGCGAGGACCACCTGCTGG + Intergenic
1175746692 20:61461968-61461990 GATCTGGGAGGACTAAAAGTGGG - Intronic
1179781428 21:43703387-43703409 GGGCTGAGCGGGCAACAAGTGGG - Intergenic
1183218364 22:36495922-36495944 GGTCTGAGGAGCCCACAGGTTGG + Intronic
1184101036 22:42341899-42341921 AGTCTGGGAGGACCACAGGGAGG + Intronic
949279474 3:2329341-2329363 GGCCTGAGAGGCTCACAATTTGG - Intronic
951754197 3:26071720-26071742 GATCTGGGAGAACCAGAAGTGGG - Intergenic
953608729 3:44429380-44429402 GGCCTGTGAGGACCCCATGTGGG - Intergenic
954263340 3:49455634-49455656 GGTCTGAGAAGGCCACATGGAGG - Intergenic
956444974 3:69317350-69317372 GGTCTGAGAGGATAAAAACTTGG + Intronic
960523639 3:118683923-118683945 TGTCTGAGAGGAGCACCAGGTGG - Intergenic
960528043 3:118732826-118732848 GGTCTGAGAGGAAAACAAAGAGG + Intergenic
961916317 3:130378756-130378778 TCTCTGAGAGGATCACATGTGGG - Intronic
963346314 3:144099601-144099623 GTTCTCAGAGGACCCAAAGTGGG - Intergenic
965540120 3:169863535-169863557 GGTCTAAGAAAACCACACGTAGG + Intronic
976317133 4:83670523-83670545 GGAGTGATAGGACCACAACTAGG + Intergenic
978611458 4:110545640-110545662 GTTCAGAGAGGACCAAAAGTAGG - Intronic
983383393 4:167025570-167025592 GGTCTGTGAGAACCAAAAGCAGG + Intronic
984016010 4:174427784-174427806 GGTCAGAGAGCAACTCAAGTAGG + Intergenic
985233482 4:187847514-187847536 GATCTCAGAGAACCACAACTGGG - Intergenic
986011231 5:3717614-3717636 TGTTTAAGAGGACCACAAGAGGG + Intergenic
986674551 5:10171610-10171632 GGTCTGAGAGGTCCATAGGCAGG - Intergenic
987846733 5:23296300-23296322 ACTCTTAGGGGACCACAAGTGGG - Intergenic
994331487 5:98511752-98511774 GGTCTGAGAGCATGACAAGTGGG - Intergenic
997174183 5:131756954-131756976 GGTGTGAAAGGGCCAAAAGTAGG + Intronic
999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG + Intronic
1001434743 5:171691367-171691389 GGTTTGAGAGGACACCAAGGAGG - Intergenic
1017123085 6:151042135-151042157 GGTCTTAGATGACCACGAGCTGG - Intronic
1020970470 7:14931673-14931695 GGTCTGAGAGGAATCCATGTTGG - Intronic
1022274532 7:28842357-28842379 GTTGTGGGAGGGCCACAAGTGGG - Intergenic
1023830933 7:44038755-44038777 GCTCTGAGAGGCCGGCAAGTGGG - Intergenic
1023880814 7:44320316-44320338 GGTCAGAGTAGACCACAAGCTGG + Intronic
1026534369 7:71228022-71228044 GGCCTGAGAGGACCCCAGTTTGG + Intronic
1027429838 7:78100175-78100197 ACTCTGAGAGGAGCACCAGTGGG - Intronic
1028035086 7:85972200-85972222 GCTCTGAGAAGACCTGAAGTGGG + Intergenic
1029741267 7:102493064-102493086 GCTCTGAGAGGCCGGCAAGTGGG - Intronic
1029759257 7:102592233-102592255 GCTCTGAGAGGCCGGCAAGTGGG - Intronic
1029776626 7:102688143-102688165 GCTCTGAGAGGCCGGCAAGTGGG - Intergenic
1031910730 7:127514135-127514157 GCTCTGAGAGTACCAAGAGTAGG - Intergenic
1032186848 7:129734058-129734080 GGTCAGAGAGCTCCACAAGTGGG - Intronic
1037563118 8:20092549-20092571 GGTCAGAGAGGAGAACAAGAGGG - Intergenic
1037911900 8:22748599-22748621 GGTCTGAGGGGAGAACAAGGAGG + Intronic
1039100498 8:33936656-33936678 GGGCAGAGAGGATCACATGTGGG + Intergenic
1041954576 8:63543263-63543285 GCTCTGAGAGGTCCCCAAGTTGG - Intergenic
1042692440 8:71516381-71516403 GGTGAGAGAGGACAACTAGTTGG + Intronic
1046397374 8:113657654-113657676 TGTCTGAAAGGACCACCAGGAGG + Intergenic
1051528482 9:18074151-18074173 GGTCTGAGATGCCCACCAGCTGG + Intergenic
1053008421 9:34619901-34619923 GGTCTGAAAGGACCAGGATTAGG - Intronic
1057311912 9:93948264-93948286 GGGTTGAGAGGACCACATTTTGG + Intergenic
1059603732 9:115810414-115810436 AGTCTGACATGACCACAAGAAGG + Intergenic
1062203700 9:135322903-135322925 GGTCTGTGAGGACCACCCTTGGG + Intergenic
1062536779 9:137024513-137024535 GGTCAGAGTAGACCACAAGCTGG - Intronic
1187750960 X:22464329-22464351 AGACTGAGAGAACCCCAAGTAGG + Intergenic
1188953002 X:36399775-36399797 GGTGTCAGAGAAGCACAAGTAGG - Intergenic
1189629342 X:42934781-42934803 GGGCTGAGGGGACCACAGCTGGG + Intergenic
1189682500 X:43531360-43531382 GGACTGAGAGCAGGACAAGTGGG - Intergenic
1191218968 X:57965360-57965382 GGACTGAGAGGAGCACAGGGAGG + Intergenic
1192236839 X:69301535-69301557 GCTCGCAGAGGACCACAGGTGGG - Intergenic
1193428377 X:81369108-81369130 GATCTGAGAGGACCACATTTTGG + Intergenic