ID: 1161245559

View in Genome Browser
Species Human (GRCh38)
Location 19:3249743-3249765
Sequence ATCCCCTCTCCCTCTGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 115}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161245554_1161245559 0 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1161245551_1161245559 16 Left 1161245551 19:3249704-3249726 CCATCCATTGGCTGGTCCAACTT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1161245550_1161245559 17 Left 1161245550 19:3249703-3249725 CCCATCCATTGGCTGGTCCAACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1161245549_1161245559 18 Left 1161245549 19:3249702-3249724 CCCCATCCATTGGCTGGTCCAAC 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1161245547_1161245559 22 Left 1161245547 19:3249698-3249720 CCACCCCCATCCATTGGCTGGTC 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1161245552_1161245559 12 Left 1161245552 19:3249708-3249730 CCATTGGCTGGTCCAACTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115
1161245548_1161245559 19 Left 1161245548 19:3249701-3249723 CCCCCATCCATTGGCTGGTCCAA 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG 0: 1
1: 0
2: 0
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161245559 Original CRISPR ATCCCCTCTCCCTCTGATAG GGG Intronic
902811441 1:18890168-18890190 AGCCCCTCTACCTCCGACAGGGG + Exonic
903802708 1:25981619-25981641 ATACCCTCTCCCTCTGACAAAGG + Intronic
904180628 1:28664254-28664276 ATTCACTCTCCATCTGTTAGTGG + Intergenic
906010886 1:42524486-42524508 AGCCCCTCCCCCTCTGGCAGAGG - Intronic
908842440 1:68293650-68293672 AGCACCTCTCCCTCTGAACGGGG + Intergenic
919767783 1:201138499-201138521 CTCCCCTCTCCCTCTGAGGCTGG + Intronic
1063253693 10:4302941-4302963 ATCCCCTCTCACTGTGACAAGGG - Intergenic
1064231897 10:13536617-13536639 ATCCCCTCTCCCTCAGCAAGAGG - Intergenic
1066634747 10:37489484-37489506 CTCTCCTCTCCCGCTGGTAGCGG - Intergenic
1068019012 10:51557135-51557157 ATCCCTTTTCCCTCTCATTGTGG + Intronic
1071681038 10:87706148-87706170 ATACCCTCTCCCTCAGAGAGTGG + Intronic
1071935816 10:90529011-90529033 CTCCCCCATCCCTCTTATAGTGG + Intergenic
1073318610 10:102600138-102600160 AACCTCTCTTCCTCTGATAGAGG + Intronic
1073798662 10:107016719-107016741 TTCCCTTTTCACTCTGATAGTGG - Intronic
1074218970 10:111417394-111417416 ATGTCATCTCCTTCTGATAGAGG + Intergenic
1075596292 10:123732060-123732082 ATCCCCTGTCCCTCTCCTGGAGG + Intronic
1076436735 10:130451512-130451534 ATCCCCTCTTCCTCTGGTATTGG + Intergenic
1080827311 11:35859235-35859257 TTAACCTCTCCCTCTGGTAGCGG + Intergenic
1083670408 11:64296993-64297015 ATCCCCTCCCCCACCGATGGTGG - Exonic
1083787735 11:64962128-64962150 ATGCCCCATCCCTCTGTTAGGGG - Intronic
1084780705 11:71406475-71406497 ATCCCGTCTCCCTCTCTAAGAGG - Intergenic
1089016310 11:115168148-115168170 ATCACCCCTACCTCTGATATGGG + Intergenic
1092037499 12:5349947-5349969 ATCCCCTCTCCCTAGCATTGTGG + Intergenic
1094388125 12:29917616-29917638 ATCCCTTTTTGCTCTGATAGAGG + Intergenic
1095231293 12:39743069-39743091 ATCCCCTGTGCCTCTGGTAGCGG + Intronic
1103412437 12:120721972-120721994 ATCCCTTCTCTCTTTGACAGAGG + Exonic
1103829634 12:123768435-123768457 GTCCTCTCTCCCTCTTATACAGG + Intronic
1110475315 13:75907045-75907067 ATCCACTCTTTCTCTGAAAGGGG - Intergenic
1113883774 13:113646606-113646628 ATCCCCTCTCCCTCAGCTCCTGG - Intergenic
1118143003 14:63105706-63105728 ATCCCTTCTCCATCTGTTTGCGG + Intergenic
1121807992 14:96849004-96849026 ATGCCCTCTTCCTCTGCTACAGG - Intronic
1127192417 15:56544922-56544944 ATCCCCTCATGCTCTGGTAGGGG - Intergenic
1127293511 15:57591091-57591113 CTCCCTCCTCCCTCTGTTAGGGG + Intergenic
1127854456 15:62943015-62943037 ACCCCCACTCCCTATGACAGTGG - Intergenic
1128419547 15:67478597-67478619 ATCCCCTCCTCCTCTTTTAGTGG - Intronic
1128985192 15:72215246-72215268 CTTCCCTCTCACTCTGACAGAGG - Intronic
1129795753 15:78374774-78374796 ACACCCTCTCCCTCTTATACTGG - Intergenic
1130072006 15:80655354-80655376 TTCCCCACAACCTCTGATAGAGG - Intergenic
1130342148 15:83008615-83008637 TTAGCCTCTCCCTCTGATGGAGG + Exonic
1132212424 15:100034336-100034358 ATCCCCTTTCCCTCTAATCTTGG + Intronic
1133073025 16:3259149-3259171 ATCCTTTCTCCATCTGGTAGTGG - Intergenic
1134097566 16:11428795-11428817 ATCCACTCTCCATCTGTCAGAGG - Intronic
1137536586 16:49331671-49331693 ATACCCTCTGCCTTTGATGGTGG + Intergenic
1137622082 16:49882883-49882905 ACCCCCTCTCCCACTGTTAGGGG - Intergenic
1137676353 16:50305617-50305639 CTCCTCTCCCCCTCGGATAGGGG + Intronic
1138273146 16:55710368-55710390 GTCCCTTCTCCCCATGATAGGGG - Intergenic
1138695021 16:58804911-58804933 CTCCCCTCCCCCTCAGCTAGAGG + Intergenic
1139084723 16:63570847-63570869 ATCCCCTTTACCTCTAATAAGGG - Intergenic
1139344088 16:66290791-66290813 ATCCCCTCTCCCTAAGATGAGGG + Intergenic
1139910318 16:70393657-70393679 ATCCCATCTCCCTCCCATTGGGG + Intronic
1140651965 16:77097978-77098000 ATTCTTTCTCCCTCTGATTGAGG - Intergenic
1142191314 16:88719509-88719531 ATGCCCTCTCCCTAAGACAGAGG - Intronic
1143020953 17:3916977-3916999 CACCTCTCTCCCTCTGATGGTGG - Intergenic
1143177420 17:4964183-4964205 ATCCCCTCTGCCTCTGGAGGAGG + Intronic
1145279080 17:21455367-21455389 ATCCCCACTGCCTCTGAGATGGG - Intergenic
1145398776 17:22515080-22515102 ATCCCCACTGCCTCTGAGATGGG + Intergenic
1152784572 17:82241165-82241187 CTCCCTTCTCCCTCTGATCTGGG - Intronic
1153008347 18:515428-515450 CTCTCCCCTCCCTCTGTTAGGGG + Intergenic
1153485360 18:5592654-5592676 AACCCCTCTGCCTCTGTTATGGG - Intronic
1156688965 18:39683426-39683448 ATCCTCTCTGCCTTTGATATTGG + Intergenic
1161245559 19:3249743-3249765 ATCCCCTCTCCCTCTGATAGGGG + Intronic
1161503774 19:4633024-4633046 TTCCCCTATCCCTCTGTGAGTGG + Intergenic
1162760882 19:12887528-12887550 ACCCCCTGTCCCCCTGATTGAGG + Intergenic
1164868240 19:31622959-31622981 ATCACCTCTCCCTCTGCTGCTGG + Intergenic
1165149986 19:33754496-33754518 ATCCCCTTTCCCTCTGTTTTTGG + Intronic
927375574 2:22409080-22409102 ATCCCCTCTCCATGTGACACTGG - Intergenic
928016000 2:27657657-27657679 TTCCCCTTTCCCACTGAAAGTGG + Exonic
930791358 2:55333064-55333086 ATCCCTTCTCCCAGTGAAAGAGG + Intronic
930800205 2:55435876-55435898 ATGGCATCTTCCTCTGATAGAGG + Intergenic
932144739 2:69307232-69307254 GTCCCCTCTCCCTCAGAGAGCGG - Intergenic
933580989 2:84126538-84126560 TTCCCCTGTCCCTCTGAAAGAGG - Intergenic
942993521 2:182232185-182232207 CTCTCCTCTCTCTCTGTTAGGGG - Intronic
945848624 2:214979100-214979122 ATCACCTCACCCTCTGATTAGGG - Intronic
947190046 2:227494810-227494832 AGCCCCTCTCACTCTGATTCTGG - Intronic
1168851901 20:982796-982818 ATTCCCTCTCCCTCTTGTCGGGG + Intronic
1172596800 20:36155458-36155480 AAGCCCTCTCCCTCTGATCAGGG - Intronic
1173684569 20:44913745-44913767 CTCCCCTCTCACTCTGAATGTGG - Intronic
1174068913 20:47886389-47886411 ATCCCCTCGCTCTCTGACTGTGG + Intergenic
1175815239 20:61880176-61880198 GTCCCCTTTCCCTCTGAGAGCGG + Intronic
1176973087 21:15288928-15288950 CTCCCCTCACCCCCTGACAGAGG - Intergenic
1180871245 22:19148554-19148576 ATCCCCTCTCCCGCTGGGGGAGG + Exonic
1181424234 22:22822731-22822753 ATCCCCTCTGCCTCAGAGAAGGG - Intronic
954109217 3:48424896-48424918 AGCCCCTCACCCTCTGATCTGGG - Intronic
954827297 3:53385291-53385313 TTCCCCTCTCACTCCAATAGAGG - Intergenic
955615618 3:60803760-60803782 CTCCCCTCTCCCTCTTTGAGGGG - Intronic
955698182 3:61657331-61657353 ATCCCTTCTCCCCCTGAAACTGG - Intronic
956682810 3:71797260-71797282 ATACCCTTTTCCTCTGATAACGG - Intergenic
960637435 3:119797123-119797145 CTCCCTTCTCCCTTTAATAGGGG + Intronic
966200106 3:177353212-177353234 ATCCCCTCACCTTCTCAGAGAGG - Intergenic
968539852 4:1161391-1161413 ATCCCCTTTCATTCTGATATTGG - Intergenic
973590958 4:52441129-52441151 TGCACCTCTTCCTCTGATAGTGG + Intergenic
974120934 4:57638516-57638538 ATCCCCTCAGCCTCTCAAAGGGG + Intergenic
975240710 4:72055468-72055490 CTCCCCTCTCCCTCTCCTTGAGG + Intronic
976044568 4:80930096-80930118 AGCCCCTCTCCCTTTTCTAGAGG - Intronic
978449249 4:108812804-108812826 ATCGCCTCTCCCGATGATATAGG - Intronic
982535985 4:156606624-156606646 AACAACTCTCCCACTGATAGCGG + Intergenic
987445694 5:18016414-18016436 ATTCTCTTTTCCTCTGATAGAGG + Intergenic
991502619 5:67292109-67292131 ATCCCCTCTGCGTCTGGTAAAGG + Intergenic
991921571 5:71662754-71662776 ATTCCCTCTTTCTCTGCTAGTGG + Intergenic
991972507 5:72154617-72154639 AGCACCTCTCCATCTGGTAGGGG - Intronic
999755318 5:154659820-154659842 AGCCCCTCTCCATCTGCTAGAGG + Intergenic
1001298443 5:170515831-170515853 AGCCCCTGCCCCTCAGATAGAGG - Intronic
1002059285 5:176616872-176616894 CTGCCCTCTCCCACTGATGGAGG - Intergenic
1003247691 6:4398281-4398303 TTCTCCTCTCCCTCTGCCAGTGG + Intergenic
1003547654 6:7074073-7074095 TTCCCCTCTCCCTCGAAGAGAGG - Intergenic
1010047175 6:71458760-71458782 ATTCCCTCTCCCTTTCACAGGGG + Intergenic
1011545443 6:88477742-88477764 ATCGCCTGTCCCTCTGAAATGGG - Intergenic
1011913565 6:92472773-92472795 ATTCCCTGTCCCTCTGCCAGGGG - Intergenic
1014474323 6:121854019-121854041 TTCCCCTCTCCCTCTGCTTTGGG - Intergenic
1018528677 6:164740784-164740806 ATCCCCCCACCTTCAGATAGGGG + Intergenic
1023656914 7:42432541-42432563 ATCCCTTCAGCCTCTGATAGTGG + Intergenic
1024532368 7:50404525-50404547 ATCTCTTCTCCCTCTCATATTGG - Intronic
1029079069 7:97957838-97957860 ATCCTCTCTCCCACGGATATCGG + Intergenic
1031067386 7:117119866-117119888 ATACCCTCCCTCTCTGATACAGG - Intronic
1039838274 8:41275241-41275263 ATCCCCTCTCGCTCTCCTACTGG - Intronic
1043924249 8:86018832-86018854 ATTCCCTGATCCTCTGATAGTGG - Intronic
1047084697 8:121503659-121503681 ATGTCCACTCCCCCTGATAGAGG + Intergenic
1048344342 8:133565726-133565748 ATTCCCACTCCCTCTGTTACAGG - Intronic
1049626211 8:143622905-143622927 CTCCCCTCTCCCTCTCTTTGTGG - Intergenic
1052845333 9:33330718-33330740 GTCCTCACTCCCTCTAATAGTGG + Intronic
1054826955 9:69582793-69582815 ATCTCCTCTCACTTTCATAGCGG - Intronic
1188328658 X:28840219-28840241 CACCCATCTTCCTCTGATAGTGG + Intronic
1189208816 X:39265570-39265592 ATCCCCTCATGCTCTGATACTGG + Intergenic
1190230121 X:48575541-48575563 ATCTTCTCTCCCTCTCACAGTGG + Exonic
1193154673 X:78159338-78159360 ATCCCCTTTTCCTGTGATTGTGG - Intergenic
1195323386 X:103739150-103739172 ATCCCATCTCCCTGAGCTAGGGG - Intergenic
1198048312 X:132924668-132924690 AACCCCTCTCCCTTTCCTAGAGG - Intronic
1198692516 X:139299772-139299794 ATCCCCTCACACTCAGATAAGGG - Intergenic