ID: 1161245563

View in Genome Browser
Species Human (GRCh38)
Location 19:3249747-3249769
Sequence CCTCTCCCTCTGATAGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 176}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161245549_1161245563 22 Left 1161245549 19:3249702-3249724 CCCCATCCATTGGCTGGTCCAAC 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245547_1161245563 26 Left 1161245547 19:3249698-3249720 CCACCCCCATCCATTGGCTGGTC 0: 1
1: 0
2: 1
3: 21
4: 213
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245555_1161245563 -8 Left 1161245555 19:3249732-3249754 CCTCTCAGACCATCCCCTCTCCC 0: 1
1: 1
2: 8
3: 55
4: 634
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245548_1161245563 23 Left 1161245548 19:3249701-3249723 CCCCCATCCATTGGCTGGTCCAA 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245551_1161245563 20 Left 1161245551 19:3249704-3249726 CCATCCATTGGCTGGTCCAACTT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245552_1161245563 16 Left 1161245552 19:3249708-3249730 CCATTGGCTGGTCCAACTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245554_1161245563 4 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176
1161245550_1161245563 21 Left 1161245550 19:3249703-3249725 CCCATCCATTGGCTGGTCCAACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 3
3: 17
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161245563 Original CRISPR CCTCTCCCTCTGATAGGGGA AGG Intronic
900576896 1:3387494-3387516 CCTCTCCCTGTCGGAGGGGAAGG - Intronic
900580086 1:3404525-3404547 CTTCCCCATCTGCTAGGGGAAGG + Intronic
904602243 1:31680000-31680022 CCTCTCCCCCAGTTGGGGGAAGG + Intronic
905803164 1:40858839-40858861 TCTCTTCCCCTGGTAGGGGATGG + Intergenic
906689220 1:47781676-47781698 CCTTTCCCTCTGCCAGGGCAGGG + Intronic
907238192 1:53065552-53065574 CCTCTCTCTCTGCCAGGGGCAGG + Intronic
908113629 1:60920636-60920658 CCTCTTCCTCTGCCTGGGGAAGG + Intronic
912491005 1:110062857-110062879 CCTCATCCTCTGTCAGGGGAGGG - Intronic
912563362 1:110566149-110566171 CCTCCCCCTCTGATATTGGTTGG - Intergenic
912598602 1:110904036-110904058 CCTCTCCTTTGGAAAGGGGAGGG + Intergenic
913225231 1:116693313-116693335 CCTCTCCATCTCAAAGGGCAGGG - Intergenic
914912178 1:151796454-151796476 CCTCTCCCTCAGATGGGTGCTGG + Intergenic
919139103 1:193547851-193547873 CCTCTCCTTGTCCTAGGGGATGG - Intergenic
921222983 1:212987020-212987042 TCTCTCTCTCTGAAATGGGAAGG - Intronic
924438612 1:244068066-244068088 ACACTCACTCTGATAAGGGAGGG + Intergenic
1062946649 10:1466594-1466616 CCTCACCCTATGAGAGAGGAGGG + Intronic
1062954925 10:1533818-1533840 CCTCCCCCTCTGTCAGCGGACGG + Intronic
1063157946 10:3397221-3397243 TCTCTCTCTCTGCTATGGGAGGG + Intergenic
1064449345 10:15427033-15427055 CCTCCCGCTCTGTTAGGGGAGGG - Intergenic
1064944424 10:20772009-20772031 TTTCTCCCTCTGATAGGGTTTGG + Intergenic
1065471497 10:26086407-26086429 GCTCTCCCTCTGATATGGTTTGG - Intronic
1067462528 10:46468266-46468288 CCTTTGCCTCTGCTAGGGAAAGG + Intergenic
1067532656 10:47085732-47085754 CCGCTCCCTCTGAAAGGTGCTGG - Intergenic
1067624667 10:47916371-47916393 CCTTTGCCTCTGCTAGGGAAAGG - Intergenic
1069862152 10:71478465-71478487 CAACTCCCTGTGACAGGGGAAGG - Intronic
1071034451 10:81226674-81226696 CCTTTCCCTTTGGTGGGGGATGG - Intergenic
1071681808 10:87713369-87713391 GCTCTCCAACTGCTAGGGGAAGG + Intronic
1073034858 10:100556771-100556793 CCTCTTCCTCTGTGAGGGGTAGG + Exonic
1073573961 10:104605473-104605495 CCCCTCCCTTTGAAAGTGGATGG - Intergenic
1076016897 10:127034967-127034989 CCTCTCCCTCAGTCTGGGGAGGG - Intronic
1076188045 10:128464142-128464164 CAGCTCCCTCTGACAGGGGAAGG - Intergenic
1076843003 10:133055835-133055857 CCCCTCCCTCTGAGAGGGCCTGG - Intergenic
1077011448 11:380998-381020 CCTCCTCCTCTGAATGGGGAAGG + Intronic
1078141201 11:8694206-8694228 CCTCTCCCACTGACAGGGTTAGG - Intronic
1079390961 11:20021875-20021897 CCTCTCCCACTGAAAAGGGAGGG - Intronic
1080030046 11:27650706-27650728 CCTCTTCCTCTGACAGTTGAGGG + Intergenic
1081476141 11:43433469-43433491 CCTCTCCCTCTGAGAGATGTTGG + Intronic
1083545275 11:63544912-63544934 CATCTCCCTCTGCTTGGGGCTGG + Intronic
1083787731 11:64962124-64962146 CCCATCCCTCTGTTAGGGGTGGG - Intronic
1083818388 11:65151000-65151022 CCCCTCCCTCTGCCAGGGCACGG + Intergenic
1086567914 11:88247912-88247934 CCACTCCCTGTGGCAGGGGAGGG + Intergenic
1086922368 11:92601986-92602008 CCTCTCCCTCCGTAAGAGGAAGG + Intronic
1087772178 11:102222704-102222726 CCTCTCTCCCTGCTAGAGGATGG + Intronic
1089178367 11:116564195-116564217 CCGCTGCCTCAGACAGGGGAGGG + Intergenic
1089577863 11:119459537-119459559 CCTCTGCATCTGAAAGGAGAGGG + Intergenic
1090111268 11:123911544-123911566 CCTCTGCCTTTGGTAAGGGAGGG + Intergenic
1091866535 12:3842031-3842053 CCTTTCCCTCTGCTACAGGAGGG - Intronic
1092999402 12:13981079-13981101 CCTGCCCCTCTGCTAGGTGAAGG + Intergenic
1093795888 12:23310046-23310068 CCTCTACCTGGGATAGGGGCAGG + Intergenic
1095313801 12:40733494-40733516 CCTCTTCCTCTGGCAGGGGAAGG - Intronic
1096493667 12:52026880-52026902 ACTCTTCCTCTGAGCGGGGAGGG + Intronic
1097478073 12:60083914-60083936 CTTCTCCCTCTCTGAGGGGAAGG + Intergenic
1098859378 12:75690159-75690181 CCTCTCCCTTTTCTAGGTGAGGG + Intergenic
1098904812 12:76151047-76151069 CCTCTCCTTAGGAAAGGGGAGGG - Intergenic
1100157854 12:91821772-91821794 CCTCACCCTCTCAAAGGGGTGGG + Intergenic
1100235094 12:92652872-92652894 CCTGTCCCTCTCATTGGGGAAGG - Intergenic
1100608389 12:96170321-96170343 CCACTCCTGCTGATAGTGGAGGG - Intergenic
1101183810 12:102251188-102251210 CCTCCCCATCTGGTAGGTGAGGG - Intergenic
1103970012 12:124664671-124664693 CCTCTCCCTCTTTTAAGAGAAGG - Intergenic
1104181994 12:126390680-126390702 TCTCTCCCTCTGATATGGTTTGG - Intergenic
1107603305 13:42034945-42034967 CTTCTCCCCCTAATAGGTGAGGG + Intergenic
1109952812 13:69523044-69523066 CCTCTCCTTCTGCTAGAGAAAGG + Intergenic
1111000041 13:82166012-82166034 CCTCCCCTTCTGAGATGGGATGG - Intergenic
1113404404 13:110024421-110024443 CTGCTTCCTCTGAGAGGGGACGG - Intergenic
1116932744 14:50705753-50705775 CCTCTCCCTCTGATTAGAGCTGG - Intergenic
1124006005 15:25795968-25795990 CTGCTTCCTCTCATAGGGGAAGG - Intronic
1124090481 15:26595330-26595352 CTGCTCCCTCTGGTAGGAGAGGG + Intronic
1125519733 15:40341013-40341035 CCTCGCCCTCTGAGAGTGGAAGG - Intergenic
1128065233 15:64760308-64760330 TGTCTCCCTCTGCAAGGGGAAGG + Intronic
1128320768 15:66692290-66692312 CCTCTCCCTCTGAAGGGGCTGGG + Intergenic
1130072001 15:80655350-80655372 CCACAACCTCTGATAGAGGAGGG - Intergenic
1130103068 15:80908625-80908647 CCTTTCCCTTTGCTAGGAGAAGG + Intronic
1130965498 15:88694722-88694744 TCTTTCCCTCTGCTAGGGTAGGG + Intergenic
1131411485 15:92211432-92211454 CTTCTCTGTCTTATAGGGGAAGG - Intergenic
1131959362 15:97772886-97772908 CCTCTGCCTTTGGAAGGGGAGGG - Intergenic
1132170281 15:99644780-99644802 CCTCTTCTTCTAATACGGGATGG - Intronic
1132230578 15:100181050-100181072 CCTCTGCCTGTGAAAGAGGAGGG - Intronic
1132658286 16:1050344-1050366 CCTCGCCCTCTGCAAGGAGAAGG + Intergenic
1132689109 16:1174594-1174616 CCTCTGCCCCTGCTTGGGGAGGG - Intronic
1134852193 16:17488858-17488880 CCTCTCCTTCTGATATGGTTTGG - Intergenic
1135562905 16:23490050-23490072 CCTATCCCTCTGACAAGGGATGG + Intronic
1137765591 16:50975299-50975321 CCTCTCTCTCTAAGAGGGAAAGG - Intergenic
1139282756 16:65784550-65784572 GCTCTCACTCTGAGAGTGGAGGG - Intergenic
1140755017 16:78059141-78059163 CCTCTCTCCCTGATAAGGGGAGG + Intronic
1141762928 16:86040474-86040496 CCTCTCCCTCTCTCAGGAGAGGG + Intergenic
1143252515 17:5533796-5533818 CCTCTGCCCCTGATGTGGGACGG - Intronic
1143330333 17:6130256-6130278 CCTCTCCCTGTTATAGGGCAAGG + Intergenic
1145267548 17:21387618-21387640 CCACACCCTCCGACAGGGGAAGG - Intronic
1148855138 17:50574913-50574935 CCCCTCCCTCAGATGTGGGAGGG - Intronic
1149304509 17:55335072-55335094 CCACTCCCTGTGATTTGGGAGGG + Intergenic
1149614572 17:57987779-57987801 CCTCTCGCTCTGAAGGGGAAGGG - Intronic
1154326467 18:13394949-13394971 CCTCTTCCTCTGTTAGTGTATGG + Intronic
1155548479 18:26939939-26939961 CCTTCCCCTCTGCTTGGGGAGGG - Intronic
1155681116 18:28488136-28488158 TCTCTCCCTCTGCTTGGAGAAGG + Intergenic
1156204124 18:34867612-34867634 CCTCTCTCTCTGCTAGGAGGAGG - Intronic
1157978528 18:52353516-52353538 CCTCGCCTTTTGATTGGGGATGG + Intronic
1158875896 18:61734286-61734308 TCTCTCCCTCAGATAGTAGAAGG + Intergenic
1159516729 18:69469014-69469036 CCTCTCTATCTGATAGGTCAGGG + Intronic
1161245563 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG + Intronic
1163966870 19:20754129-20754151 CCTCTCTCCCTGATAAGGGGAGG + Intronic
1165890468 19:39109167-39109189 CCTCTCCATTTTATAGGTGAGGG + Intronic
1166906453 19:46113203-46113225 CATCTCCCTCTAAGAGAGGACGG - Intergenic
1166983692 19:46647770-46647792 CCACTCCCTGTGAGAGGGAATGG - Exonic
1167396049 19:49229711-49229733 CCTCTCTTTGTGAGAGGGGAGGG - Intergenic
1167565955 19:50257283-50257305 CATCTCCATCTGACAGTGGAGGG + Exonic
1167619233 19:50551884-50551906 TCTCTCCTTCTGAACGGGGAGGG + Intronic
926989629 2:18663799-18663821 TCTCTCCATCAGCTAGGGGAAGG + Intergenic
927184977 2:20475562-20475584 CCTCTCCCTCAGATGGGGTGAGG + Intergenic
931370843 2:61661174-61661196 CCCCTCCCTCTAAGAGGGCAGGG - Intergenic
931642376 2:64393177-64393199 CCTCTCTCTCTCATAGTAGAGGG + Intergenic
937610471 2:123855518-123855540 CATCTCCCTTAGATAGGAGAGGG - Intergenic
942231008 2:173860851-173860873 CCTCTTCCTCTGAGGGCGGAGGG + Intergenic
942307381 2:174622006-174622028 GCACTCCCTCTGAGAAGGGAGGG - Intronic
943763219 2:191632141-191632163 ACTCTTCCTCTGGTAAGGGAGGG - Intergenic
943836060 2:192515427-192515449 CCTCTCCTTCTGGTAGGGGCAGG + Intergenic
944389303 2:199200809-199200831 CCTCTCCATCTGATAGGGTTTGG + Intergenic
944433088 2:199657847-199657869 CCTCTCCCTGTGAGACAGGATGG + Intergenic
944675241 2:202030001-202030023 TCTCTCCCTCTGAGAGAGGGAGG - Intergenic
946160061 2:217830513-217830535 CCTCTCCTTCTTATGGTGGAGGG - Intronic
946333998 2:219025600-219025622 GCTCTGCCTCTCATAGGGCAGGG + Intronic
947307624 2:228764860-228764882 CCTCTCCCTTTCCTGGGGGATGG - Intergenic
949078629 2:242078737-242078759 CCCCTCCCTCTCATATGGGAAGG - Intergenic
1169039292 20:2479914-2479936 CCTCTCCCTCTGCTGGGCTAGGG + Intronic
1170510036 20:17067130-17067152 CCTCTGCCTTTAGTAGGGGATGG - Intergenic
1170761517 20:19255303-19255325 CCTCTCCATCCTATAGCGGAGGG - Intronic
1170936944 20:20818608-20818630 CCACACCCTCTTGTAGGGGAGGG - Intergenic
1171878327 20:30598514-30598536 CCTCTCCCTCTGATGTAGCAGGG + Intergenic
1173064019 20:39692193-39692215 CTTCTCCCTCTGGTAGGAGCAGG + Intergenic
1173869119 20:46330682-46330704 TCTCTCCCTGTCATGGGGGATGG + Intergenic
1174551501 20:51365903-51365925 CCTCGCCCTCTGGGAGGAGAAGG - Intergenic
1175377315 20:58537137-58537159 CCTCTCCCACTGATATGGTTTGG - Intergenic
1175552854 20:59828216-59828238 CCTCTCCCACAGATTGGGGAGGG + Intronic
1178901561 21:36603047-36603069 CCTTCCCATCTGAAAGGGGATGG - Intergenic
1182037957 22:27214167-27214189 CCTCTTCCTTTGGTCGGGGATGG + Intergenic
1182939514 22:34261936-34261958 CCTCTGCCCCTCATGGGGGAGGG + Intergenic
953686360 3:45081342-45081364 CCTCTCCCACTGAGATGGGGTGG + Intergenic
953781262 3:45872776-45872798 CCTCTCAGGCTGATGGGGGAGGG + Intronic
955067335 3:55544490-55544512 CCTCCCCCACTGATATGGGGTGG - Intronic
955274309 3:57533070-57533092 CCTCTGCCTGTGAAAGGGGAGGG - Intronic
961309966 3:125990411-125990433 CGTCACCCTCTGGTAGGGGATGG - Intergenic
961515611 3:127431989-127432011 CCTCTCCCTCTGATCTGGGCTGG - Intergenic
964936410 3:162094490-162094512 CCTCTGCCTTGGAAAGGGGAAGG - Intergenic
972237392 4:37150239-37150261 CCTCTACCTTTGGAAGGGGAAGG - Intergenic
973852838 4:54977839-54977861 CCTCTGCCTGTGAAAAGGGAAGG + Intergenic
973940553 4:55905671-55905693 ACTCTCCCTCTGCTGTGGGAGGG + Intergenic
974666075 4:64963305-64963327 CCACCCCCACTTATAGGGGATGG - Intergenic
975931584 4:79530476-79530498 CCTCTCCCTCTGATGGTGGAGGG - Intergenic
976382790 4:84419427-84419449 CCTCTCAGTCAGATTGGGGAAGG - Intergenic
981471235 4:145137894-145137916 CCTTTCCCTCTGCTACAGGAGGG + Exonic
984707171 4:182856037-182856059 CCTCTTCCTCTCCTCGGGGATGG - Intergenic
985555995 5:558291-558313 CCTCTCCATCTGGCAGGGAATGG + Intergenic
991921574 5:71662758-71662780 CCTCTTTCTCTGCTAGTGGATGG + Intergenic
992667198 5:79021947-79021969 CCTCTGCTTCAGATGGGGGAGGG + Intronic
998137056 5:139679371-139679393 CCTCTCACTGTGGCAGGGGACGG + Intronic
999232849 5:150072172-150072194 TGTCTCCCTCTGAAAGGGCAGGG + Intronic
999364427 5:151012744-151012766 CCCCTCCCTCTTGCAGGGGATGG + Intergenic
999372717 5:151065610-151065632 TCCCTCCCTCAGAGAGGGGAAGG - Intronic
999755322 5:154659824-154659846 CCTCTCCATCTGCTAGAGGCTGG + Intergenic
999911428 5:156205089-156205111 CCTCCCACTCTGATGGAGGAAGG - Intronic
1002138384 5:177122705-177122727 CCTCAACCTCTGATACTGGAGGG - Intergenic
1002914487 6:1518116-1518138 CCTTTCAATCTGAAAGGGGATGG - Intergenic
1004512959 6:16297538-16297560 TCTCTGCCTCTGATAGGAGTGGG + Intergenic
1006528009 6:34624931-34624953 CCTCTCCTCCTGAAAGAGGATGG + Intronic
1008053820 6:46926445-46926467 TCTCTCCCTCTTCTAGGAGATGG - Intronic
1009266455 6:61561583-61561605 CCTCTCCCTGTGGAAAGGGAAGG - Intergenic
1016251618 6:142049449-142049471 CCTCTGCATTTGAAAGGGGAGGG + Intergenic
1019792336 7:3024227-3024249 CCTCCCCAACTGATAGGAGAAGG + Intronic
1024725235 7:52186598-52186620 CCTTTCCCTCTGAGACGCGATGG + Intergenic
1032072789 7:128819198-128819220 CCTCTCCCTCTGATTGGGCCGGG - Intronic
1033276773 7:139977513-139977535 CCTCACCCTCTGATATGGTTTGG - Intronic
1034508151 7:151512289-151512311 CCTCTACCTGTGATTGTGGAAGG - Intronic
1034738982 7:153455979-153456001 CCTCACCTTCTCACAGGGGATGG - Intergenic
1034755708 7:153617214-153617236 CCTCCCCCACTGACTGGGGAGGG - Intergenic
1035022351 7:155807132-155807154 CCTCTGCCTCGGATAGGGTTAGG - Intronic
1035536895 8:398760-398782 CCCCTCCCTCTCATATGGGAAGG - Intergenic
1037992521 8:23330980-23331002 CCACTCCCTCTGGTTGAGGAGGG + Intronic
1044829810 8:96236081-96236103 TTTCTCCCTCTGGTAAGGGACGG - Intergenic
1045764135 8:105646937-105646959 CCTTTCCCACTGTTAGGAGATGG - Intronic
1046190968 8:110793372-110793394 ACTCTCATTCAGATAGGGGAAGG - Intergenic
1046811481 8:118538207-118538229 CCTCTCTCTGGGATTGGGGAGGG + Intronic
1047901158 8:129423467-129423489 CCTCTCCCTGTGAAAGGGGAGGG + Intergenic
1049365052 8:142233046-142233068 CCCCTCCCTCAGCTTGGGGAGGG - Intronic
1049731133 8:144179104-144179126 GCTCCTCCTCTGACAGGGGAGGG + Intronic
1054826953 9:69582789-69582811 CCTCTCACTTTCATAGCGGAAGG - Intronic
1056079551 9:83077487-83077509 ATTTTCACTCTGATAGGGGAGGG - Intergenic
1058206772 9:102118459-102118481 CCTTTCCCTTTGATAAGGCAAGG - Intergenic
1060712764 9:125886304-125886326 CCTCTGCCTCTGATATGGGAGGG + Intronic
1061135341 9:128730366-128730388 CCTCTGCCTCTGAGAGGCGTGGG + Exonic
1188917805 X:35934294-35934316 CCTCTGCCTCTGGAAAGGGAAGG - Intronic
1190908031 X:54747243-54747265 CCTCAGCCACTGCTAGGGGATGG + Intergenic
1191221995 X:57998975-57998997 CCTCTGCCTTTGAAAGGGGTGGG + Intergenic
1191890137 X:65931578-65931600 CCTATCCCTCCCCTAGGGGAAGG - Intergenic
1194595034 X:95847427-95847449 CCCCTACCTGTGGTAGGGGAGGG - Intergenic
1195018524 X:100801904-100801926 CCTCTGCCTCAGAGAGGGCAGGG - Intergenic
1195834840 X:109102669-109102691 CCTCTGCCTTTGAAAAGGGAAGG - Intergenic
1196364859 X:114912836-114912858 CCTGGCCCTCTGATAGGGTTTGG - Intergenic
1200281462 X:154780737-154780759 CCTCACACCCTGATAGGGAAAGG + Intronic