ID: 1161245565

View in Genome Browser
Species Human (GRCh38)
Location 19:3249752-3249774
Sequence CCCTCTGATAGGGGAAGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 196}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161245554_1161245565 9 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245550_1161245565 26 Left 1161245550 19:3249703-3249725 CCCATCCATTGGCTGGTCCAACT 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245552_1161245565 21 Left 1161245552 19:3249708-3249730 CCATTGGCTGGTCCAACTTGTGG 0: 1
1: 0
2: 1
3: 11
4: 117
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245555_1161245565 -3 Left 1161245555 19:3249732-3249754 CCTCTCAGACCATCCCCTCTCCC 0: 1
1: 1
2: 8
3: 55
4: 634
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245548_1161245565 28 Left 1161245548 19:3249701-3249723 CCCCCATCCATTGGCTGGTCCAA 0: 1
1: 0
2: 1
3: 12
4: 115
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245551_1161245565 25 Left 1161245551 19:3249704-3249726 CCATCCATTGGCTGGTCCAACTT 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196
1161245549_1161245565 27 Left 1161245549 19:3249702-3249724 CCCCATCCATTGGCTGGTCCAAC 0: 1
1: 0
2: 0
3: 2
4: 88
Right 1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 24
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161245565 Original CRISPR CCCTCTGATAGGGGAAGGTG AGG Intronic
900150672 1:1178029-1178051 CCCACGGGCAGGGGAAGGTGGGG - Intronic
900179068 1:1303461-1303483 CCGTCTGGGAGGGGAGGGTGGGG + Intronic
900504436 1:3022289-3022311 CCAGCTGGCAGGGGAAGGTGTGG - Exonic
902275316 1:15335287-15335309 TCCTCTGATAAGGGAAGGAAAGG + Intronic
902282540 1:15384872-15384894 CCCGCTGAGAGGGGAAACTGAGG + Intronic
904464104 1:30697843-30697865 GGCTCTGACCGGGGAAGGTGGGG + Intergenic
904812247 1:33171018-33171040 CCATCTGAGAAGGGAAGGAGGGG - Intronic
905891565 1:41521531-41521553 CTCTGTGAAAGGGGAAGGTGGGG + Intronic
910145937 1:84079058-84079080 TCTTCTGAGAGCGGAAGGTGCGG + Intronic
913333555 1:117687010-117687032 CCCTCTCATAGTGGAAGCTATGG - Intergenic
917477792 1:175383847-175383869 CCCTCTGCTGGAGGAGGGTGAGG - Intronic
917962994 1:180159085-180159107 CCCTCTGGTAGGGGGTGTTGTGG - Intronic
919768362 1:201141628-201141650 CCCTCCTGTAGGGGAAGTTGCGG - Intronic
919853222 1:201687857-201687879 CCCTCAGATGGGGGAAGATGGGG + Intronic
919893869 1:201996247-201996269 CCTTATGTTTGGGGAAGGTGTGG + Exonic
922017481 1:221665572-221665594 AGTTCTGAAAGGGGAAGGTGGGG - Intergenic
922658584 1:227408713-227408735 CTTACTGATAGAGGAAGGTGTGG - Intergenic
1062843178 10:686690-686712 CCCCCTCACAGGGGAAGGTGAGG - Intronic
1065177198 10:23089841-23089863 CCCACAGTTATGGGAAGGTGAGG + Intergenic
1065536962 10:26724375-26724397 CAATCAGATTGGGGAAGGTGCGG - Intronic
1065554862 10:26905520-26905542 CCCTCTGCTTGCGGGAGGTGTGG + Intergenic
1066156282 10:32681459-32681481 CCTCTTTATAGGGGAAGGTGGGG - Intronic
1069275565 10:66587066-66587088 ACCTCTGATGGGGGTGGGTGGGG + Intronic
1073022998 10:100462503-100462525 CCCTCTGATTTGAGAATGTGGGG - Intergenic
1073329658 10:102661804-102661826 CCCTCGGATGGGAGAAGATGAGG - Intergenic
1077490938 11:2860680-2860702 CCTTGTGGTAGGGGAAGGAGGGG + Intergenic
1079060971 11:17248531-17248553 CCCTCTGCTAAGAGAAGGTGTGG - Intronic
1080072687 11:28108491-28108513 CCCTCTGCTAGGGGGAGAGGTGG + Intronic
1083182493 11:60996266-60996288 TGCTCTGATAGGGAAAGGGGAGG - Intronic
1083304340 11:61754815-61754837 CCCTGCGATGGGGGAAGGTGTGG + Intronic
1083433271 11:62626024-62626046 CCCTAGGATGGGGGAAGGAGGGG - Intronic
1084551912 11:69849125-69849147 CCCTCTTATAAGGAAATGTGTGG - Intergenic
1085320211 11:75569294-75569316 CTCTGTGATGGGGGAAGCTGGGG + Intronic
1087789670 11:102392989-102393011 CCCTGTGAGAGGGGGATGTGAGG + Intergenic
1088915877 11:114227304-114227326 CCATGTGCTGGGGGAAGGTGTGG + Intronic
1094319575 12:29170845-29170867 CCATCGAAAAGGGGAAGGTGAGG - Intronic
1096071485 12:48777866-48777888 GGCTCTGATGGGGGAAGGTCAGG - Intronic
1096558860 12:52421862-52421884 ACCTCTGACTGGGGCAGGTGTGG - Intergenic
1097044347 12:56176325-56176347 CCCCCAGAGAGGGGAAGCTGTGG + Intronic
1097277035 12:57820799-57820821 CCCTCTCATAGGGGGAGCTTTGG - Exonic
1099959017 12:89379164-89379186 CCCTTTGGCAGGGGAAGATGTGG - Intergenic
1102234418 12:111285365-111285387 CCCTCTGCCAGGGGAAGGCGGGG + Intronic
1103796950 12:123509921-123509943 CCTGCTGATGGGGGAAGATGAGG + Intronic
1103916225 12:124376999-124377021 CCCTGTCAAAGGGGAAGCTGGGG - Intronic
1104100004 12:125598818-125598840 CCCTCTATTAGGGGAATTTGAGG - Intronic
1104659098 12:130596378-130596400 GCCTGTGAAATGGGAAGGTGGGG - Intronic
1104668035 12:130661267-130661289 CCCTCCGATTGGCTAAGGTGTGG - Intronic
1105843084 13:24272353-24272375 CCCTCTCAGAGAGGCAGGTGAGG - Intronic
1107749174 13:43545890-43545912 ACCTCTGATAGGTGCAGGGGAGG + Intronic
1111333526 13:86792239-86792261 CCCTCTGCTGGCGGGAGGTGTGG + Intergenic
1113882441 13:113635269-113635291 CCCTCCCAGAGGGGACGGTGTGG + Intronic
1115123385 14:29964397-29964419 TTATCTGAAAGGGGAAGGTGAGG - Intronic
1116152878 14:41164759-41164781 CCCTCAGAGAGGAGAATGTGTGG - Intergenic
1118905073 14:70017894-70017916 CCCACTCATAAGGGAAGATGGGG - Intronic
1119780578 14:77274398-77274420 CCCTCTGGTAGGGGCTGGTGGGG - Intergenic
1122146360 14:99691248-99691270 ACCTGGGCTAGGGGAAGGTGAGG - Intronic
1122811615 14:104292130-104292152 CCCACTGATGGCGGGAGGTGGGG - Intergenic
1122885874 14:104710028-104710050 CCCTCTGGCAGGGACAGGTGGGG + Intronic
1124066140 15:26345877-26345899 CATTCTAATAGGGGATGGTGAGG + Intergenic
1125519729 15:40341008-40341030 CCCTCTGAGAGTGGAAGGGTGGG - Intergenic
1127169784 15:56289622-56289644 TGCTCTCATAGGGGAAGTTGTGG + Intronic
1128802910 15:70508362-70508384 CCCTCTGGAAGGGGCAGGGGAGG + Intergenic
1128979415 15:72175627-72175649 CCCTCTGCTGGGGGAAACTGAGG - Intronic
1131432094 15:92395188-92395210 CCCTGGGCAAGGGGAAGGTGAGG + Intronic
1132157234 15:99504198-99504220 GCCTCAGAAAGGGGAAGCTGAGG - Intergenic
1132556472 16:574920-574942 CCCTCTGAGAGGCGAGGGTTGGG - Intronic
1132600209 16:769724-769746 CCCTCTGGCTGGGGAGGGTGGGG + Intronic
1134645038 16:15858582-15858604 CCCTCTGCTTGGGGAAGGCCCGG + Intergenic
1136406436 16:30050658-30050680 CCCTCTGAGAGGGCCAGGGGTGG + Intronic
1136500548 16:30667873-30667895 CCACCTGGAAGGGGAAGGTGGGG + Intronic
1138454901 16:57115595-57115617 CCCATTGATGGGGGAGGGTGTGG - Intronic
1140555312 16:75915150-75915172 CCCTCTTACAGGGGGATGTGCGG - Intergenic
1140904987 16:79402413-79402435 GCCTCTGAAAGGGCTAGGTGTGG - Intergenic
1141007906 16:80370400-80370422 TCCTGTGATAAGGGAAGGTGAGG + Intergenic
1144324771 17:14168482-14168504 ACCTCTGCTAGGGTAATGTGGGG - Intronic
1144580985 17:16459443-16459465 CCCTAAGATAGGAGAGGGTGTGG + Intronic
1147314655 17:39613854-39613876 CCTGCTGAAAGGTGAAGGTGTGG - Intergenic
1147393965 17:40127084-40127106 CCCTTTGAGAGGGCAAGGTGGGG + Intronic
1147408680 17:40233021-40233043 CCCTCTGTTAGAGTAAGCTGTGG + Intronic
1147541099 17:41360670-41360692 CCCTCTGATGTTGAAAGGTGAGG + Intergenic
1147976966 17:44253370-44253392 GCCTACGGTAGGGGAAGGTGAGG + Exonic
1148492993 17:48035236-48035258 CCATCTGCTGGGGCAAGGTGTGG + Intronic
1148701761 17:49591608-49591630 GACCCTGATGGGGGAAGGTGAGG - Intergenic
1149785285 17:59429475-59429497 CCCCCTGATATGGGAAAGTTGGG + Intergenic
1150344134 17:64391140-64391162 CTCTTTGATGGGGGAAGGGGAGG - Intronic
1150933094 17:69606393-69606415 CTTTCTAATAGGGGAGGGTGGGG + Intergenic
1152806214 17:82357557-82357579 TCCTGGGATAGGGGCAGGTGTGG - Intergenic
1155082212 18:22421439-22421461 CCCTATGATAGGTGAAGGATTGG + Intergenic
1155124102 18:22854151-22854173 CTCTCTGATGGGAGAAGCTGTGG - Intronic
1158380153 18:56920642-56920664 CTCACTGAGAGGGCAAGGTGGGG - Intronic
1159378191 18:67621429-67621451 ACCTCTGATAGGGGAAGTTCAGG + Intergenic
1160488896 18:79320314-79320336 TCCTCTGCCAGGGGAAGGGGAGG + Intronic
1161245565 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG + Intronic
1161440722 19:4290262-4290284 CCCAGTGATATGGGAAGCTGAGG - Intronic
1161449775 19:4338641-4338663 CCCTGTGACCGGGTAAGGTGGGG - Exonic
1163202273 19:15777777-15777799 ACCCCTGGAAGGGGAAGGTGTGG + Intergenic
1163282994 19:16328406-16328428 CCCTGAGAATGGGGAAGGTGAGG - Intergenic
1163303302 19:16461730-16461752 CCCTCTGATGAGCGGAGGTGAGG + Intronic
1163548517 19:17952589-17952611 CCCTCCGCGAGGTGAAGGTGGGG + Intronic
1163612689 19:18309415-18309437 CCCTCTCAGAGGGGAAACTGAGG + Intronic
1165385056 19:35505430-35505452 CCATCTCAAAGGGGAAAGTGAGG + Intronic
1168149070 19:54435397-54435419 CCCTTTGACAGGGGAAACTGAGG + Intronic
930241762 2:48942840-48942862 CACTCTGGTGGGGGAAGCTGTGG - Intergenic
931819014 2:65933130-65933152 CCAGCTGAGAGGGGAAGGAGTGG + Intergenic
934749418 2:96783217-96783239 ACCTCTGGTAGGGGATGCTGGGG + Intronic
937236099 2:120432703-120432725 CCCTCTGATTGAGGAAGGAGTGG + Intergenic
937381738 2:121383466-121383488 GCCTCTGCTTGGGGAAGGAGTGG + Intronic
937496836 2:122429298-122429320 CCGTCTTATAGGGCAGGGTGTGG + Intergenic
938097839 2:128475103-128475125 CCCTCTGCTGGGAGAAGATGGGG - Intergenic
940032016 2:149273666-149273688 TTCTCTGGTAGGGGAAAGTGGGG - Intergenic
940162103 2:150724363-150724385 GCCTGTTATGGGGGAAGGTGAGG + Intergenic
942307377 2:174622001-174622023 CCCTCTGAGAAGGGAGGGTGGGG - Intronic
943836062 2:192515432-192515454 CCTTCTGGTAGGGGCAGGAGAGG + Intergenic
944242085 2:197496455-197496477 CCCTCTTGTAAGTGAAGGTGGGG - Intronic
948472582 2:238193764-238193786 TCCTCTGGTTGGGGAAGGTGAGG - Intronic
1170984196 20:21242992-21243014 TCCTCAGGTAGGGGGAGGTGGGG + Intronic
1171219525 20:23382291-23382313 TCCTCTGGCTGGGGAAGGTGGGG - Intronic
1172335328 20:34111479-34111501 CCCTCTGTTAAGGGAAGCTCAGG + Intronic
1172881651 20:38203662-38203684 CCCTCTGATAGGGGACCCTGAGG + Intergenic
1175173166 20:57093747-57093769 CGCTCTGAGAGGCGAAGATGGGG - Intergenic
1175246392 20:57584859-57584881 CGCTCTGATCAGGGGAGGTGAGG + Intergenic
1175281363 20:57806244-57806266 CCCTTTGCCAGGGCAAGGTGTGG + Intergenic
1176023907 20:62976176-62976198 CTCTCTGCTGGGGGAAGGTTGGG - Intergenic
1176289450 21:5036407-5036429 GCCTCTGATAGGAAAAGCTGGGG - Intronic
1176696785 21:9987371-9987393 TCCCCTGATGGGGGCAGGTGTGG - Intergenic
1178709711 21:34905351-34905373 CACTCTAATTGGGAAAGGTGGGG - Intronic
1179867780 21:44227180-44227202 GCCTCTGATAGGAAAAGCTGGGG + Intronic
1180822136 22:18837640-18837662 CCCTGTGGTTAGGGAAGGTGGGG - Intergenic
1181208367 22:21272101-21272123 CCCTGTGGTTAGGGAAGGTGGGG - Intergenic
1182153532 22:28048150-28048172 GCCTCTGAGAAGTGAAGGTGAGG + Intronic
1182549365 22:31092678-31092700 CCCTCTGACAAGGGATTGTGTGG + Intronic
1182623581 22:31630718-31630740 CCCTCTGAGCGGGCAGGGTGGGG + Intronic
1184029574 22:41884000-41884022 ACCTCTCATAGGGGAGGGTGTGG + Intronic
1203218564 22_KI270731v1_random:23311-23333 CCCTGTGGTTAGGGAAGGTGGGG + Intergenic
954334764 3:49909765-49909787 CCCTCTGCTGGGGGAGGGGGTGG + Intronic
954403421 3:50331524-50331546 CCCTCACATAGGGCAGGGTGGGG + Intronic
954878848 3:53820605-53820627 ACCCCTGATACGGGAAGGAGTGG + Exonic
955028046 3:55189307-55189329 CCCTGTGGGAGGGGAAGCTGGGG + Intergenic
960560084 3:119073786-119073808 CCCTCTGCTTGTGGGAGGTGTGG - Intronic
960572421 3:119198236-119198258 TCCTCTGGTAGTGGAAGATGGGG + Intronic
962705639 3:138041067-138041089 CGCTGTGATGGTGGAAGGTGAGG - Intergenic
969296921 4:6275668-6275690 CCCTCTGAGGGAGGAACGTGTGG + Intronic
969883681 4:10196636-10196658 CCCTCTGTCAGCAGAAGGTGGGG + Intergenic
969902580 4:10363369-10363391 CCCTCTGCAGGTGGAAGGTGTGG + Intergenic
971209170 4:24599501-24599523 CCCTCTGCTTGGAGTAGGTGTGG - Intergenic
974838440 4:67276922-67276944 CCATCAGAAAGGGGAAGGAGAGG - Intergenic
975747981 4:77493281-77493303 CCCTGTGATTGGGGAAGGGGTGG + Intergenic
976706053 4:88020459-88020481 TCCTCTGGTAGGGGGAGGGGAGG + Intronic
976938197 4:90665889-90665911 CCTTCTGACAGTGGGAGGTGTGG + Intronic
982701552 4:158663363-158663385 CCATCAAAAAGGGGAAGGTGAGG + Intergenic
984713181 4:182903079-182903101 CCCTGTGAGATGGGAAGGGGCGG - Intronic
985646740 5:1088554-1088576 CGCTGTCATAGGGGAAGGGGTGG - Intronic
986442992 5:7797794-7797816 CCCTCCTAGAGGGGAAGGTGGGG + Intronic
986684608 5:10265438-10265460 CCCTCTGATAGGGAAACAAGTGG - Exonic
988901798 5:35740894-35740916 CCCTCTGATGGGATAAGGGGGGG - Intronic
988999654 5:36746837-36746859 CCTTCTGATAGGGTGAGATGAGG - Intergenic
990539317 5:56756803-56756825 CCCTCAGGTGAGGGAAGGTGGGG + Intergenic
994768679 5:103954196-103954218 CCCTCGGTTTGGGGGAGGTGTGG - Intergenic
998500786 5:142630748-142630770 CCCTCTGAAAGGGGCATGGGAGG - Intronic
999252824 5:150192665-150192687 CCCTCTGATTGGGGGAGGAGGGG + Intronic
1001054289 5:168436383-168436405 CCCTCTGATATAGGGAGGTCAGG - Intronic
1001370883 5:171199659-171199681 TTCTCTGATAGGTGAAGATGAGG + Exonic
1004165314 6:13251506-13251528 GCCTCATATAGGGGAGGGTGGGG + Intronic
1004273292 6:14213329-14213351 CCCAGTGATTGGAGAAGGTGGGG + Intergenic
1005650087 6:27878273-27878295 CCCTCTCATAGGGGGAGCTTTGG - Intergenic
1007925439 6:45646164-45646186 CCCTATGGTAGGGGGAGGCGGGG + Intronic
1010427508 6:75743516-75743538 CCCAGTGACTGGGGAAGGTGAGG + Intergenic
1012723056 6:102772575-102772597 GACTCTAATAGGGGAAGGTAGGG + Intergenic
1012845467 6:104381993-104382015 CCCTGTGATGGGGGAATGTTAGG + Intergenic
1013498567 6:110723384-110723406 CCCTCTGAAAGGGCACAGTGGGG - Intronic
1013578511 6:111508942-111508964 TCCTCTGCTAGGGGGAGTTGAGG + Intergenic
1013976970 6:116090388-116090410 TACTATGATGGGGGAAGGTGAGG - Intergenic
1013985770 6:116191388-116191410 CTCTCTGGAAGGGGAAGGAGAGG + Intronic
1015009761 6:128331368-128331390 CCCTCTGTTAGGGGCTGGCGAGG - Intronic
1015318384 6:131843628-131843650 CCCTGGGAGAGGGAAAGGTGGGG - Intronic
1015470552 6:133600799-133600821 ACCTCTGATTGGGGAATGTCTGG + Intergenic
1019889390 7:3933934-3933956 CCCATGGCTAGGGGAAGGTGTGG + Intronic
1023569514 7:41557481-41557503 CCCTCTGATCTGGGGAGATGGGG + Intergenic
1024603425 7:51006699-51006721 CAGTCTGAAAGGGCAAGGTGAGG - Intergenic
1026267789 7:68810422-68810444 CAGTCTGGTAGGGGATGGTGGGG + Intergenic
1026287510 7:68976179-68976201 ACCTCAGATAGGGGCAGGGGTGG + Intergenic
1027120390 7:75514325-75514347 CCCTTTGAGAGGCCAAGGTGGGG - Intergenic
1028399390 7:90408255-90408277 CCCTTTGAAAGGTGGAGGTGGGG + Intronic
1030461305 7:109839731-109839753 CCCTCTCATAGGGGGAGCTTTGG + Intergenic
1032168788 7:129566910-129566932 CTCTGTGGTAGGGGATGGTGGGG - Intergenic
1034140354 7:148809980-148810002 GCCTCTGAGCGGGGAAGGAGGGG - Intronic
1035105189 7:156436225-156436247 CCCTTTTGTAGGGGTAGGTGAGG - Intergenic
1036569568 8:9968152-9968174 CCCTGAGATAGGGCAAGGCGAGG + Intergenic
1038648437 8:29380664-29380686 CCCTCGGATAGCAGATGGTGGGG + Intergenic
1039465870 8:37784600-37784622 CCCTCTGGTGGGGGATGGTGCGG + Intronic
1041159034 8:55018499-55018521 TCTTCTGATAGGGGAAGGAAGGG - Intergenic
1048671961 8:136732469-136732491 CCCTCTTAGAGGGAAATGTGGGG - Intergenic
1049479065 8:142811361-142811383 CCCTGTGCCAGGGGAATGTGGGG + Intergenic
1049940805 9:544617-544639 CGCTCTGATAGGGGAAGTACGGG + Intronic
1050387950 9:5110823-5110845 CCGTTTGTTCGGGGAAGGTGGGG + Intronic
1050520875 9:6498511-6498533 CTCTCTGGTAGGGGAAGGGTGGG + Intronic
1050566273 9:6887163-6887185 CCCTCTGAGTGAGGAAGGTGTGG + Intronic
1051851662 9:21516459-21516481 CCCACTGAAAAGGGAAGGTGGGG + Intergenic
1053633760 9:39973217-39973239 TCCCCTGATGGGGGCAGGTGTGG - Intergenic
1053771988 9:41490283-41490305 TCCCCTGATGGGGGCAGGTGTGG + Intergenic
1054210127 9:62277480-62277502 TCCCCTGATGGGGGCAGGTGTGG + Intergenic
1054314868 9:63571448-63571470 TCCCCTGATGGGGGCAGGTGTGG - Intergenic
1055924844 9:81499438-81499460 CTCTCCAATAGGGGAAGGAGGGG - Intergenic
1057181506 9:93033231-93033253 CCCTCTGACAGCTGGAGGTGAGG - Intronic
1057447485 9:95127530-95127552 GGCTCTGACAGGGGCAGGTGCGG + Intronic
1057698429 9:97344411-97344433 GCCTCTGGTAGAGGAAGGAGAGG - Intronic
1058336504 9:103836322-103836344 CCCTCTTATAAGGGGAGGAGGGG - Intergenic
1058967054 9:110048527-110048549 GCCACTGAGAGGAGAAGGTGTGG + Intronic
1059243988 9:112834038-112834060 CCCTCGGTTGGGGGAAGGTATGG + Intronic
1061298770 9:129692343-129692365 CACTCTGGTGGGGGATGGTGGGG - Intronic
1061976704 9:134071901-134071923 CACCTTGGTAGGGGAAGGTGAGG + Intergenic
1062365652 9:136207803-136207825 CCCTCTGTTGGGGGATGGGGAGG - Exonic
1062440240 9:136566464-136566486 GCCTCTGGATGGGGAAGGTGGGG + Intergenic
1187488149 X:19724120-19724142 CCCTCTGAGAGGGGGAGGAAAGG - Intronic
1189163790 X:38838716-38838738 CCCTCAGAGAGGGGAAGGTAAGG + Intergenic
1189239345 X:39513730-39513752 CCCTTTGATAGAGGCAGGTTAGG - Intergenic
1190734929 X:53249980-53250002 CCCTCTAAAAAGGGAAGGTGGGG + Intronic
1194544773 X:95219390-95219412 CCCTTTTACTGGGGAAGGTGGGG - Intergenic
1197982378 X:132230335-132230357 GCCTCTCAGAGGGGAAGGTGGGG - Intergenic
1198770637 X:140126549-140126571 GCCTGAGATAGGGGAAGGGGTGG + Intergenic
1199907402 X:152247422-152247444 TCCTCTAATAAGGGAGGGTGTGG - Intronic