ID: 1161245568

View in Genome Browser
Species Human (GRCh38)
Location 19:3249763-3249785
Sequence GGGAAGGTGAGGCCCAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3191
Summary {0: 2, 1: 14, 2: 176, 3: 703, 4: 2296}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161245556_1161245568 -1 Left 1161245556 19:3249741-3249763 CCATCCCCTCTCCCTCTGATAGG 0: 1
1: 0
2: 7
3: 60
4: 712
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296
1161245555_1161245568 8 Left 1161245555 19:3249732-3249754 CCTCTCAGACCATCCCCTCTCCC 0: 1
1: 1
2: 8
3: 55
4: 634
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296
1161245562_1161245568 -7 Left 1161245562 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296
1161245561_1161245568 -6 Left 1161245561 19:3249746-3249768 CCCTCTCCCTCTGATAGGGGAAG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296
1161245560_1161245568 -5 Left 1161245560 19:3249745-3249767 CCCCTCTCCCTCTGATAGGGGAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296
1161245554_1161245568 20 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245568 19:3249763-3249785 GGGAAGGTGAGGCCCAGAGAGGG 0: 2
1: 14
2: 176
3: 703
4: 2296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161245568 Original CRISPR GGGAAGGTGAGGCCCAGAGA GGG Intronic
Too many off-targets to display for this crispr