ID: 1161245570

View in Genome Browser
Species Human (GRCh38)
Location 19:3249765-3249787
Sequence GAAGGTGAGGCCCAGAGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1532
Summary {0: 1, 1: 1, 2: 45, 3: 283, 4: 1202}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161245560_1161245570 -3 Left 1161245560 19:3249745-3249767 CCCCTCTCCCTCTGATAGGGGAA 0: 1
1: 0
2: 0
3: 10
4: 155
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245561_1161245570 -4 Left 1161245561 19:3249746-3249768 CCCTCTCCCTCTGATAGGGGAAG 0: 1
1: 0
2: 0
3: 12
4: 146
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245555_1161245570 10 Left 1161245555 19:3249732-3249754 CCTCTCAGACCATCCCCTCTCCC 0: 1
1: 1
2: 8
3: 55
4: 634
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245562_1161245570 -5 Left 1161245562 19:3249747-3249769 CCTCTCCCTCTGATAGGGGAAGG 0: 1
1: 0
2: 2
3: 12
4: 171
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245564_1161245570 -10 Left 1161245564 19:3249752-3249774 CCCTCTGATAGGGGAAGGTGAGG 0: 1
1: 0
2: 0
3: 10
4: 237
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245554_1161245570 22 Left 1161245554 19:3249720-3249742 CCAACTTGTGGTCCTCTCAGACC 0: 1
1: 0
2: 0
3: 9
4: 120
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202
1161245556_1161245570 1 Left 1161245556 19:3249741-3249763 CCATCCCCTCTCCCTCTGATAGG 0: 1
1: 0
2: 7
3: 60
4: 712
Right 1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG 0: 1
1: 1
2: 45
3: 283
4: 1202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161245570 Original CRISPR GAAGGTGAGGCCCAGAGAGG GGG Intronic
900074361 1:801076-801098 GAAAATGGGGCCCAGAGAGATGG - Intergenic
900310832 1:2032473-2032495 CAAGGTGAGCTCCAGGGAGGAGG - Intergenic
900370420 1:2329656-2329678 GGTGGCAAGGCCCAGAGAGGAGG + Intronic
900382728 1:2392826-2392848 GATGGTCAGGCCCAGAGGAGCGG + Intronic
900398134 1:2461664-2461686 GGATTTGAGGCCCACAGAGGCGG - Intronic
900558173 1:3290377-3290399 GATGAGGAGGCACAGAGAGGGGG + Intronic
900592426 1:3465977-3465999 CAAGCAGAGGCCAAGAGAGGTGG - Intronic
900627643 1:3616534-3616556 GCAGGTGATGGCCAGAGACGGGG + Intergenic
900646972 1:3713383-3713405 GAAAGAGAGGCCCACAGGGGAGG + Intronic
900689670 1:3972948-3972970 GAAGGTGAGGAACAGAGGGGTGG + Intergenic
900704575 1:4072249-4072271 GAGACTGAGGCTCAGAGAGGAGG + Intergenic
900746884 1:4366639-4366661 TAAGATGAGGCCAAGAGAGTGGG + Intergenic
900791363 1:4683151-4683173 GAGAGTGAGGCACAGAGAAGGGG - Intronic
900816646 1:4852289-4852311 GGAGGTGAGGCTGAGAGTGGGGG + Intergenic
900891423 1:5452322-5452344 GTAGGTTTGGCCCAGAAAGGCGG + Intergenic
901207958 1:7508139-7508161 GAACCTGGAGCCCAGAGAGGTGG + Intronic
901510767 1:9717127-9717149 GAAGGGGTGGCTCAGAGGGGAGG - Intronic
901537084 1:9889475-9889497 GATGCAGAGGCCCAGAGATGTGG - Intronic
901596922 1:10392630-10392652 GAAGGTGAGGCCGGGTGCGGTGG + Intergenic
901771335 1:11531803-11531825 GATGCTGAGGCCCAGAGAGGTGG + Intronic
901788538 1:11640904-11640926 GAAACCGAGGCTCAGAGAGGTGG - Intergenic
901877233 1:12173822-12173844 GACTGTGGGTCCCAGAGAGGTGG - Intronic
902099771 1:13977087-13977109 GTTGGTGAGGATCAGAGAGGAGG + Intergenic
902180651 1:14685940-14685962 GAAACTGAGGCCCAAAGAGATGG + Intronic
902230976 1:15027462-15027484 GAAACTGAGGCCCAGAGACGAGG - Intronic
902279427 1:15363476-15363498 GAAGCTAAGGCTCAGTGAGGTGG - Intronic
902396664 1:16135636-16135658 GAAGGTAACTCCCAGAGGGGCGG - Exonic
902583808 1:17425952-17425974 AGAGGTGGGACCCAGAGAGGGGG - Intronic
902601043 1:17540269-17540291 GAAAGTGAGGCACAGGGTGGGGG - Intronic
902620530 1:17648271-17648293 GAAATTGAGGCTCAGAGAGTTGG + Intronic
902719105 1:18292278-18292300 GATACTGAGGCCCAGAGAGGGGG + Intronic
902774297 1:18664742-18664764 GAAGGTGAGCCCCCGAGAAGGGG + Intronic
902799716 1:18821631-18821653 GAGACTGAGGCCCAGGGAGGAGG + Intergenic
902984567 1:20147879-20147901 GAAACTGAGCCCCAGAAAGGGGG - Intronic
903009416 1:20319503-20319525 GAAGGTGAGGGCAACTGAGGTGG + Exonic
903139242 1:21328908-21328930 GAAACTGAGGCTCAGAGAGGCGG - Intronic
903184902 1:21623281-21623303 GAAACTGAGGTCCAGAGAGGAGG - Intronic
903265381 1:22154908-22154930 GAATCCGAGGCGCAGAGAGGTGG + Intergenic
903267434 1:22166279-22166301 GAAGCTGAGGCTCAGAGACAGGG + Intergenic
903276100 1:22222814-22222836 GAAGATGAGGCCCCGAGAGGTGG - Intergenic
903281350 1:22251770-22251792 AAAACTGAGGCCCAAAGAGGGGG - Intergenic
903378454 1:22880934-22880956 GAAACTGAGGTCAAGAGAGGGGG - Intronic
903419681 1:23209700-23209722 GAAAGTGAGGCTCAGAGAAATGG + Intergenic
903536938 1:24073161-24073183 GAAACTGAGGCCCAGGAAGGTGG + Intronic
903544465 1:24115069-24115091 GAAACTGAGGCCCAGAAAGGAGG - Intergenic
903620487 1:24694589-24694611 GAAACTGAAGCCCAGAGGGGTGG + Intergenic
903663346 1:24992156-24992178 GAAACTGAGGCTCAAAGAGGTGG + Intergenic
903742356 1:25565648-25565670 GAAGGTCAGGCACAGTGAGGAGG + Intronic
903744214 1:25575839-25575861 GAAACTGAGGCCCAGAGAGATGG + Intergenic
903809218 1:26025430-26025452 AAAACTGAGGCCCAGAGAGGTGG + Intronic
903849344 1:26296812-26296834 CGAGGAGAGGCCCAGAGAGGTGG + Intronic
903968746 1:27105718-27105740 GAAACTGAGGCCCAGAAAGGGGG + Intronic
904032133 1:27539902-27539924 GAATGTGAGGCTCTGAGAGGTGG - Intronic
904166717 1:28561222-28561244 AAAGCTGAGGCTTAGAGAGGGGG + Intronic
904265714 1:29317615-29317637 GAAACTGAGGTCCAGAGAGAAGG - Intronic
904271645 1:29354140-29354162 AAAACTGAGGTCCAGAGAGGGGG - Intergenic
904322752 1:29707641-29707663 GAAGGAGGGACACAGAGAGGGGG + Intergenic
904330991 1:29757703-29757725 GAAACTGAGGTCCAGAGAAGGGG - Intergenic
904339866 1:29827773-29827795 GAAACTGAGGCCCAGGGAAGTGG - Intergenic
904374890 1:30074359-30074381 GAAGGTGAGGACCACAGATAAGG - Intergenic
904379783 1:30102933-30102955 GAGAATGAGGCACAGAGAGGAGG + Intergenic
904415678 1:30359877-30359899 GAAACTGAGGCCCAGAGAAGAGG + Intergenic
904422459 1:30403065-30403087 GGAACCGAGGCCCAGAGAGGTGG + Intergenic
904447736 1:30588508-30588530 GAAAGTGAGGCACAGAGCAGTGG - Intergenic
904467931 1:30719020-30719042 GAGGCTGAGGCCCGGAGAGGCGG + Intronic
904472216 1:30742927-30742949 GAAGGTCAGGCTTAAAGAGGTGG + Intronic
904474889 1:30758337-30758359 GAAACTGAGGCACAGAGAGGGGG + Intergenic
904503459 1:30931196-30931218 GGAGGAGAGGCCCAGACAGACGG + Intergenic
904504493 1:30939574-30939596 GCAGGTGGAGACCAGAGAGGTGG - Intronic
904524300 1:31121039-31121061 GCAGCTGAGACCCAGAAAGGTGG - Intergenic
904535912 1:31199274-31199296 AAAACTGAGGCTCAGAGAGGGGG - Intronic
904536262 1:31201686-31201708 GAAACTGAGGCCCAGAGCAGTGG + Intronic
904610148 1:31721358-31721380 GAAGCTGAGGCCTGGAGAGGAGG + Intergenic
904774724 1:32899839-32899861 GAACTTGGGGCCCAGAGGGGAGG - Intronic
904826107 1:33274820-33274842 GAAACTGAGGCTCAGAGAGAGGG - Intronic
905007857 1:34725492-34725514 AAAACTGAGGCCAAGAGAGGAGG + Intronic
905276203 1:36819706-36819728 GAAGGGGAGGCCCTGGGAGAGGG + Intronic
905481971 1:38267963-38267985 GAAGGAGAGAGGCAGAGAGGGGG - Intergenic
905649562 1:39647172-39647194 GAAACTAAGGCCCAGAGAGATGG - Intergenic
905851215 1:41276493-41276515 GAAACAGAGGCACAGAGAGGGGG - Intergenic
905859787 1:41342519-41342541 GAAACTGAGGCTCAGAGAGGAGG - Intergenic
905873434 1:41417736-41417758 GAAACTGAGACCCAGAGAGGGGG + Intergenic
905884024 1:41482168-41482190 GCAGCTCAGGCCCAGAGAGGGGG - Intronic
905923673 1:41735147-41735169 AAACCTGAGGCTCAGAGAGGTGG + Intronic
906206616 1:43990769-43990791 GAAACTGAGGCACAGAGAGGTGG - Exonic
906639287 1:47432071-47432093 GAAATTGAGACCCAGAGAGAGGG - Intergenic
906674685 1:47684762-47684784 GATGCTGTAGCCCAGAGAGGTGG - Intergenic
906951813 1:50341031-50341053 GAAGGGGAGGCCAAGAGGAGGGG - Intergenic
907051690 1:51333985-51334007 GAAACTGAGGCTCAGAGAGGTGG - Intronic
907243016 1:53091021-53091043 GAAGCTGACGCCCAGAGGGCGGG + Intronic
907257355 1:53190067-53190089 GAAGCTGAAGAGCAGAGAGGTGG + Intergenic
907273918 1:53306542-53306564 GACGCTGAGGCCCAGAGAGGGGG - Intronic
907274330 1:53308913-53308935 GATGGTGAGGCACAGAGAGGTGG - Intronic
907316696 1:53577020-53577042 GAAAGTGAGGCACAGAGATTGGG - Intronic
907318384 1:53587254-53587276 GAAGCTGAAGCCCAGAGAGCAGG - Intronic
907399355 1:54215282-54215304 GAAACTGAGGTTCAGAGAGGTGG - Intronic
907485938 1:54778196-54778218 GAAACTGAGGCCCAAAGAGCAGG - Intergenic
907490423 1:54805756-54805778 GAAACTGAGGCCCACAGAGAGGG - Intergenic
907750245 1:57256460-57256482 GAAAATGAAGACCAGAGAGGTGG - Intronic
907920878 1:58910614-58910636 CAAGGTGAGGCCCACAGAGCAGG - Intergenic
908046098 1:60170595-60170617 GAAAGTTAGGGCCAGAGAGTTGG + Intergenic
908065305 1:60396882-60396904 GAAGGTGAGGCTCAGAGAAGGGG - Intergenic
908115803 1:60938873-60938895 GAACCTGAGGCTCAGAGTGGTGG - Intronic
910216744 1:84851059-84851081 GAAATGGAGGCCCAGAGAGATGG - Intronic
910505222 1:87942864-87942886 GGAAGTGAGGCACAGAGAAGGGG + Intergenic
912493341 1:110075125-110075147 GAGGGAGGGGGCCAGAGAGGCGG + Intergenic
913269218 1:117076553-117076575 GGAGGTGAGGTCAAGAGAGAGGG - Intronic
913380537 1:118205520-118205542 GAAACTGAGGCATAGAGAGGTGG - Intergenic
914449066 1:147774605-147774627 GAAACTGAGGCCCAGAGAAAAGG + Intergenic
914988450 1:152478924-152478946 GAAGGTGGTGCCCTAAGAGGAGG + Intergenic
915580654 1:156811082-156811104 GAAGGAGATGCTGAGAGAGGAGG - Intronic
915898872 1:159832212-159832234 GAAGGAGGGGCCCAGAGGTGGGG - Intronic
915929296 1:160049077-160049099 GAAACTGAGGCTCAGAGAGATGG + Intronic
916092654 1:161319909-161319931 GGAGGTTAGGTCCAGAGAGTTGG + Intronic
916128646 1:161592739-161592761 ACAGCTGAGGCACAGAGAGGTGG - Intronic
916138564 1:161674570-161674592 ACAGCTGAGGCACAGAGAGGTGG - Intronic
916205694 1:162314284-162314306 TAGGGCCAGGCCCAGAGAGGCGG - Intronic
916255507 1:162783437-162783459 GAAGGTCAGGGCTAGAAAGGAGG + Exonic
916312357 1:163411052-163411074 GTAGTTCAGGACCAGAGAGGTGG + Intergenic
917420243 1:174855631-174855653 GAAAATGAGGCCCATAGAAGTGG - Intronic
917455465 1:175182274-175182296 GAGGGTGAGGGACAGGGAGGAGG - Intronic
918195459 1:182217496-182217518 GAAAATGAGTCCCAGAAAGGTGG - Intergenic
918449328 1:184643708-184643730 GAAACTGAGCCCCAGAGAAGAGG - Intergenic
918587924 1:186209169-186209191 GAAGCTGAGGTCCAGAAAGCAGG + Intergenic
919580751 1:199368852-199368874 TGAGGTGAAGCCCAGAGAGAAGG - Intergenic
919766218 1:201129011-201129033 GAGGCTGAGGCTCAGAGAGGAGG + Intergenic
919802413 1:201361677-201361699 GTAGGTGAAGCTCAGAGGGGTGG + Intronic
919818173 1:201455212-201455234 GAAAGTGAGACCCAGCAAGGAGG + Intergenic
919867138 1:201790932-201790954 AAAGTTGAGGCTCAGAGAAGGGG - Intronic
919914778 1:202132636-202132658 GAAGGAGAGGCCGAGGGAGGTGG + Exonic
920106356 1:203556185-203556207 GAAGGCGTGGCTCAGGGAGGGGG - Intergenic
920207348 1:204302197-204302219 GAATCTGAGGCCCAGAGAGAAGG + Intronic
920216827 1:204367033-204367055 GAAGGTGAGGCCCACAGGCCTGG + Intronic
920258321 1:204671817-204671839 GAAGGTGATGACCAGAAAGTTGG + Intronic
920385362 1:205567749-205567771 GACAGTGAGCCCCAGAGAAGGGG - Intergenic
920512480 1:206561190-206561212 GAAACTGAGGCCCAGAGAGGTGG + Intronic
920513511 1:206567582-206567604 GAAAGTGAGGCCTAGAGTGGTGG - Intronic
920561358 1:206941024-206941046 GAAACTGAGACCCACAGAGGAGG + Intronic
920615447 1:207487946-207487968 GAGAGTGAGGCTCAGAAAGGAGG + Intronic
920974504 1:210773331-210773353 GAAGTTGAGGCCCAGAGTTGAGG + Intronic
921448139 1:215270817-215270839 AAAGGAGAGGCCCAGAGTAGAGG - Intergenic
921668855 1:217904852-217904874 GAAGCTGACTCCCAGAGAAGAGG + Intergenic
921693753 1:218183373-218183395 GAAGGTGGGGTCTAGTGAGGGGG - Intergenic
921840743 1:219825721-219825743 GAGGGAGAAGGCCAGAGAGGTGG + Intronic
921922408 1:220684477-220684499 GAAGGTGGGGGGCATAGAGGTGG - Intergenic
922270210 1:224025980-224026002 GAAAATGGGGCCCAGAGAGATGG - Intergenic
922335575 1:224616265-224616287 GAGGGTGGGGCGCCGAGAGGAGG + Intronic
922620316 1:226984652-226984674 CAAGGTGAGCCCCAGGGTGGGGG + Exonic
922719035 1:227890972-227890994 GAAACTGAGGCTCAGAGAGCTGG + Intergenic
922730866 1:227948148-227948170 GAAGGGGAGGCGGAGAGCGGTGG + Intergenic
922799444 1:228358293-228358315 GAAGCTGAGGCTCAGAGATGTGG - Intronic
922982001 1:229835051-229835073 GAGGGAGAGGCCCAGCAAGGTGG - Intergenic
923127161 1:231041930-231041952 GAAGGTGAGGCACAGTGAAGAGG - Intergenic
923470119 1:234282751-234282773 CAATGCCAGGCCCAGAGAGGAGG - Intronic
923532495 1:234822557-234822579 TCAGGTGAGTCCCAGAGAGCAGG - Intergenic
924042992 1:240002049-240002071 GCAGCTAAGGCCCAGAGAGAGGG - Intergenic
924632548 1:245754477-245754499 GAGGGTGGGGCACAGGGAGGAGG + Intronic
924906459 1:248458419-248458441 GAAGCTGAGGCCCAAAGATATGG - Intergenic
924921427 1:248633608-248633630 GAAGCTGAGGCCCAAAGATATGG + Intergenic
1063137827 10:3232456-3232478 GAAACTGAGACCCAGAGAGCTGG + Intergenic
1063478867 10:6353067-6353089 GAAAGTGAGGCCCAGATAAATGG - Intergenic
1064133631 10:12731806-12731828 GAAGGTGGAGATCAGAGAGGAGG + Intronic
1064470981 10:15635469-15635491 GAAGGCAAGACCCAGAGAGGTGG + Intronic
1065130149 10:22612437-22612459 GAAGGCGAGTCCTAGAGAGGAGG + Intronic
1065737033 10:28763645-28763667 GAATGTCAGACCCAGAGAAGTGG - Intergenic
1066181966 10:32971334-32971356 AAAGCTAAGGCCCCGAGAGGAGG - Intronic
1066370390 10:34814774-34814796 GGAGGAGAGGCGCAGGGAGGCGG - Intronic
1066721971 10:38349097-38349119 GAAGGTCAGGGCTAGAAAGGAGG + Intergenic
1067062636 10:43085726-43085748 GAAGGGGATGCCCAGGGAAGTGG - Intronic
1067243501 10:44516757-44516779 CAAGCTGAGGCCCAGAGTGCAGG - Intergenic
1067337176 10:45374981-45375003 GAAACTGAGGCCCAGACAGACGG - Intronic
1067690106 10:48496465-48496487 GAAACTGAGGCTCAGAGAGATGG + Intronic
1067788502 10:49270568-49270590 GAAAATGAAGCCCAGAGGGGTGG + Intergenic
1068083418 10:52347063-52347085 GAGGGTCAGGCTCAGAGGGGTGG - Intergenic
1068491413 10:57729325-57729347 GAAGGTGGGGCAGAGAAAGGAGG - Intergenic
1068589325 10:58837509-58837531 GGAGGTGAGGGGCAGAGAGCAGG + Intergenic
1068669578 10:59709747-59709769 GAAGGTGGAGCTCAGAGAAGGGG - Exonic
1069628254 10:69881278-69881300 GAAACTGAGGCTCAGAGAGGGGG + Intronic
1069739529 10:70678737-70678759 GCAACTGAGGCCCAGAGAAGGGG - Intronic
1069793051 10:71035596-71035618 GAAACTGAGGTGCAGAGAGGGGG + Intergenic
1069913365 10:71773020-71773042 GAAGGAGAGGCACAGGGTGGGGG - Intronic
1069919907 10:71810236-71810258 GAAACTGAGGCCCAGAGACCTGG - Intronic
1069921510 10:71818477-71818499 AAAGCTGAGGCCCAGAGAGGTGG - Intronic
1070191289 10:74114102-74114124 GAAGGAGAAGCACAGAGAAGAGG - Intronic
1070309314 10:75261858-75261880 CAGACTGAGGCCCAGAGAGGAGG - Intergenic
1070342347 10:75509582-75509604 GACACTGAGCCCCAGAGAGGTGG + Intronic
1070449052 10:76539410-76539432 GAAGCTGAGGCCCAGAGAGATGG + Intronic
1070597856 10:77845243-77845265 GAAGCTGAAACCCAGAGAGGTGG - Intronic
1070683566 10:78465714-78465736 GCAGGTCAGCCCCAGAGAGCAGG + Intergenic
1070783489 10:79150376-79150398 CACGGGGAGGCCCAGGGAGGGGG - Intronic
1070793367 10:79202906-79202928 GAAGCTGAGGCTCAGAGAAATGG - Intronic
1070812563 10:79305729-79305751 GAGGGTAAGGGACAGAGAGGTGG - Intronic
1070827859 10:79401631-79401653 AAAACTGAGGCCCAGAGATGGGG - Intronic
1070830162 10:79413255-79413277 CATGGAGAGGCCCAGAGAGGTGG + Intronic
1070898576 10:80007023-80007045 GAAGGTTAGGGATAGAGAGGAGG + Intergenic
1071478588 10:86045666-86045688 GAAGGCGAGGCACCGAGTGGTGG + Intronic
1071609537 10:87020477-87020499 GCAGGTGAGGACCTGGGAGGAGG + Intronic
1071683198 10:87728413-87728435 GAAACTGAGGCCCAGAGGGAGGG - Intronic
1071890408 10:90000184-90000206 GAGGTTGAGGCCCAGAGACCAGG - Intergenic
1072256069 10:93621437-93621459 GAAACTGAGGTCCAGAGAGTGGG - Intronic
1072432414 10:95384747-95384769 GAAGGAGAGGCCCAGAGGGTGGG + Intronic
1072555393 10:96510958-96510980 GGAACTGAGGCCCAGAGAGGAGG + Intronic
1072628178 10:97127819-97127841 GACAGTGAGGCCCGAAGAGGTGG - Intronic
1072662297 10:97370436-97370458 GAAGGTGAGGCCCAGGGGGCTGG - Exonic
1072782709 10:98261266-98261288 GAAACTGAGGCCCAGAGAAGGGG + Intronic
1073049741 10:100659923-100659945 GAAGGAGAGGCTCAGGGAGTGGG + Intergenic
1073074816 10:100817261-100817283 GAAACTGAGGCTCAGAGAGAGGG - Intronic
1073286488 10:102392762-102392784 GAAATTAAGGCTCAGAGAGGTGG - Intergenic
1073456560 10:103640361-103640383 GAGGGTGTGGCACAGGGAGGAGG + Intronic
1073459456 10:103658295-103658317 CAAGGCAAGGCCCAGGGAGGTGG + Intronic
1073465674 10:103693315-103693337 GAAGGTGAGCCCCAGTTAGCGGG - Intronic
1073755292 10:106574758-106574780 CAAGGTGCTGCTCAGAGAGGAGG - Exonic
1073787429 10:106905704-106905726 GAAGGTGAGACTCACAGAAGTGG - Intronic
1074343776 10:112660469-112660491 GAAACTGAGGCCCAGAGAAAGGG + Intronic
1074405271 10:113176065-113176087 GAAACTGAAGCCCAGAGAGGGGG + Intergenic
1074408092 10:113198034-113198056 GAAGGTGTCGCCCAGAGATTAGG - Intergenic
1074429075 10:113377959-113377981 GAAGGTGCGGTCAAGAGATGGGG + Intergenic
1074562995 10:114551011-114551033 AAAAGTGAGGTCCAGGGAGGTGG + Intronic
1074685522 10:115959289-115959311 GGAGGTAAGGCCCAGAGCTGTGG - Intergenic
1074757774 10:116638659-116638681 AAGAGTGAGGCCCAGAGAGAGGG + Intronic
1075427035 10:122350038-122350060 CCAGGTGAGGCCCAAAGGGGTGG + Intergenic
1075439007 10:122464635-122464657 GAGTGTGAGATCCAGAGAGGGGG - Intronic
1075557582 10:123444592-123444614 GAGGGGGAGGCTCAGAGAGATGG + Intergenic
1075632783 10:124011154-124011176 GAAGCTGTGGCCCAGAGGGCGGG - Intronic
1075764822 10:124885055-124885077 GAAGGTGAGGCCAGGCGTGGTGG + Intergenic
1076009481 10:126975904-126975926 GAAAATGAGGCCAAGAGTGGTGG - Intronic
1076268839 10:129132876-129132898 GAAACTGAGACCCAGGGAGGTGG - Intergenic
1076509263 10:131000486-131000508 GATCAGGAGGCCCAGAGAGGCGG - Intergenic
1076710739 10:132332395-132332417 GAATGTGAGGCCCAGAGCGTCGG + Intronic
1076727128 10:132419188-132419210 GGAGCGGAGGCCCAGGGAGGTGG + Intergenic
1076833949 10:133010551-133010573 GAACCTGAGGCCCAGACCGGTGG - Intergenic
1076854589 10:133109570-133109592 GAAGCTGAGGTGCAGGGAGGAGG - Intronic
1077163298 11:1123337-1123359 GAAGGAGAGACAGAGAGAGGAGG - Intergenic
1077298732 11:1837733-1837755 GGAGGTGGGGGCCAGAGAGTCGG + Intergenic
1077309601 11:1882496-1882518 GAGACTGAGGCCCAGGGAGGGGG - Intronic
1077316744 11:1922685-1922707 AAAGGGGAGGCCCAAGGAGGTGG + Intronic
1077336737 11:2008627-2008649 AAAAGTGAGGCTCAGAGAAGTGG - Intergenic
1077351972 11:2097236-2097258 GATGCGGAGGCCCAGAGAGCTGG + Intergenic
1077409470 11:2396737-2396759 GAAGGGGCAGCCCAGAGAGCAGG - Intronic
1077497124 11:2891789-2891811 GAAACTGAGGCCCAGAGAGGTGG + Intronic
1077500778 11:2909021-2909043 GAAACTGAGGCCCTGAGAGGAGG + Intronic
1077501086 11:2909985-2910007 GAAACTGAGGCCCTGAGAGGAGG + Intronic
1077838735 11:5948832-5948854 GAAGGAGAGGGAGAGAGAGGAGG - Intergenic
1078087893 11:8245118-8245140 GAAACTGAGGCTCAGAGAGGTGG + Intronic
1078361212 11:10669309-10669331 GAAAGCTAGGCCCAGAGAGGCGG - Intronic
1078464491 11:11540085-11540107 GAAACCGAGGCCCAGAGAGATGG - Intronic
1078669132 11:13349444-13349466 GAGACTGAGGCACAGAGAGGTGG - Intronic
1078838318 11:15053420-15053442 GAAAGTGAGGACCAGAGATGAGG + Intronic
1079251430 11:18790829-18790851 GAAACTGAGGCCCAGTAAGGTGG - Intronic
1079281040 11:19087447-19087469 GAAATTGAGGCACAGAGAGAGGG + Intergenic
1079607190 11:22384751-22384773 GAAGCTGAGGCTCAGAGATCTGG - Intergenic
1080419419 11:32096731-32096753 GAAACTGAGGCCCAGAGAAATGG - Intronic
1081099887 11:38988119-38988141 GAAGCTGAGGCACAGAGAAGTGG + Intergenic
1081545360 11:44067665-44067687 GCAGGTGGGGCCCAGACAGGTGG - Exonic
1081584159 11:44372690-44372712 GAAACTGAGGCTCAGAGAGGTGG - Intergenic
1081595885 11:44459234-44459256 GAAGATGAGGCCCAAGGATGGGG - Intergenic
1081655861 11:44857107-44857129 GAAACTGAGGCCCAGAGGTGGGG + Intronic
1081679019 11:44988905-44988927 GCAGGTGAGGCTCAGAGAGCTGG - Intergenic
1081703791 11:45168533-45168555 GAAAGTGAGACCCAGAGGGGAGG - Intronic
1081744395 11:45462821-45462843 GAAACTGAGGCCTAGGGAGGGGG + Intergenic
1082079130 11:47998467-47998489 AGAGATGAGGCACAGAGAGGTGG + Intronic
1083265216 11:61543570-61543592 GAAACTGAGGCCCAGAGAGGTGG - Intronic
1083298223 11:61726681-61726703 GCAGCTGAGGCCCAGAGAGGTGG + Intronic
1083299247 11:61731680-61731702 GAAACTGAGGCTCAGAGAGGTGG - Intronic
1083341253 11:61959784-61959806 GAAACTGAGGTCCAGAGAGAGGG + Intronic
1083341297 11:61960013-61960035 GAAGGTGGAGCCCATAAAGGAGG - Exonic
1083461860 11:62818930-62818952 GAAGGTGAGGCCGGGTGCGGTGG + Intronic
1083468186 11:62863206-62863228 GAAATTGAGGCCCAGAGTGGTGG - Intronic
1083475795 11:62914635-62914657 GCAGCTGAGGCCCAGAGAAAAGG + Intronic
1083477608 11:62924102-62924124 GAAACTGAGACCTAGAGAGGGGG - Intergenic
1083544571 11:63538780-63538802 GAAACTGAGGATCAGAGAGGTGG - Intronic
1083618548 11:64037835-64037857 GAAACTGAGGCACAGGGAGGTGG - Intronic
1083649991 11:64197394-64197416 GCAGGTGAGGCCCAGAAACAAGG + Exonic
1083693944 11:64430160-64430182 GCAGGTGAGGCCCTGAGAAATGG + Intergenic
1083757460 11:64799376-64799398 GAAGGTGGTGCCCAGAGGTGGGG - Intronic
1083799705 11:65039559-65039581 GATGCTGGGCCCCAGAGAGGAGG + Intronic
1084121336 11:67070799-67070821 CAACCTGAGACCCAGAGAGGGGG + Intronic
1084190604 11:67497072-67497094 GAACCTGAGGCCCAGAAAGAAGG - Intronic
1084335587 11:68455739-68455761 GAAGGTGTGGCCCAACCAGGAGG - Intergenic
1084417787 11:69043404-69043426 GAAACTGAGGCTCAGAGAGGGGG + Intergenic
1084436934 11:69148330-69148352 GCATGCGAGGCTCAGAGAGGTGG - Intergenic
1084459662 11:69289521-69289543 GAACGGGAGGCCCAGAGAGGTGG + Intergenic
1084460168 11:69292781-69292803 AAAGGTGAGGGCCAGGGAGAGGG - Intergenic
1084460192 11:69292874-69292896 AAAGGTGAGGGCCAGGGAGAGGG - Intergenic
1084476662 11:69393387-69393409 GGAAGAGAGGCACAGAGAGGGGG - Intergenic
1084541259 11:69788481-69788503 GAAACTGAGGCCCAGAGAGGAGG + Intergenic
1084554208 11:69866047-69866069 GAAACTGAGGCACAAAGAGGAGG - Intergenic
1084590948 11:70089926-70089948 GGAGCTGAGGCCGAGAGAGCTGG + Intronic
1084899498 11:72299073-72299095 GAAGGTGAGGCACTGAGGTGTGG - Intronic
1084900555 11:72306990-72307012 GAAACTGAGGCACAAAGAGGTGG + Intronic
1084920344 11:72464479-72464501 GAAGGAGAGGGACAGAGAGAGGG - Intergenic
1085056207 11:73405520-73405542 GAAACTGAGGCCCAGAGAAGCGG - Intronic
1085069153 11:73526478-73526500 GAAACTGAGGCCCAGAGAAGAGG - Intronic
1085085701 11:73665139-73665161 GAAAGTAATTCCCAGAGAGGAGG + Intergenic
1085342922 11:75745100-75745122 GACACTGAGGCTCAGAGAGGGGG + Intergenic
1085405631 11:76260163-76260185 ACAGTTGAGGCCCAGAGAGGAGG + Intergenic
1085405717 11:76260571-76260593 GAAGTTGAGGCACAGGAAGGAGG + Intergenic
1085413624 11:76306280-76306302 GAAGGTGAGGAAGACAGAGGAGG - Intergenic
1085439043 11:76540935-76540957 GAAGTTGAGGCCAAGTGTGGTGG + Intronic
1085445753 11:76599542-76599564 GAAGTTGAGGTGCAGACAGGAGG - Intergenic
1085802434 11:79602854-79602876 GAAACTGAGGCCCAGAGAGAGGG + Intergenic
1085976970 11:81667936-81667958 GAAGGTCAGGCCGAGATGGGCGG - Intergenic
1086030598 11:82350579-82350601 TAAACTGAGGCCCAGAGAGGGGG + Intergenic
1086377865 11:86219557-86219579 AACGCTGAGGCCCAGAGAGTAGG - Intergenic
1086389961 11:86353623-86353645 GAAGATGAGGCCGAGGCAGGGGG - Intergenic
1086411463 11:86548757-86548779 GAAAGTGAGGCCCAGAAAGGGGG + Intronic
1086736492 11:90312379-90312401 GATGGCAAGGGCCAGAGAGGTGG + Intergenic
1086910059 11:92461702-92461724 GGAGGTGAGGCACAGGGAAGAGG + Intronic
1087224846 11:95586906-95586928 TAAGGTGAGGCCCAGTTATGGGG + Intergenic
1087274285 11:96145151-96145173 GAAACTGAAGCTCAGAGAGGTGG + Intronic
1087838941 11:102902988-102903010 GGAGGTGAGGCAGAGACAGGAGG + Intergenic
1088287369 11:108202450-108202472 AAAGGTGTGTCCCTGAGAGGTGG - Intronic
1088520505 11:110693343-110693365 GAAATGGAGGCCCAGAGAAGTGG - Intronic
1088590711 11:111400163-111400185 GAAACTGAGGCACAGAGAGGCGG - Intronic
1088850394 11:113699154-113699176 GAGGCTGAGGCCGAGAGAGATGG - Intronic
1088918313 11:114243573-114243595 GGAGGTAGGGCCCAGAGGGGTGG + Intronic
1089098787 11:115942341-115942363 AAAAGGGAGGCCCAGGGAGGTGG + Intergenic
1089134434 11:116237999-116238021 GCAGCTGAGGCCTAGAGAGATGG - Intergenic
1089293296 11:117451265-117451287 GAGAGACAGGCCCAGAGAGGAGG - Intronic
1089338681 11:117743250-117743272 GGAGTGGAGGCCCAGGGAGGAGG + Intronic
1089500564 11:118929267-118929289 GAAAGGGAGGCTGAGAGAGGGGG + Intronic
1089582046 11:119487408-119487430 AAAGCTGAGGCACAGAGAGGTGG - Intergenic
1089584369 11:119500968-119500990 GAAACTGAGGCTCAGAAAGGTGG - Intergenic
1089651914 11:119920172-119920194 GAAACTGAGGCCCAGGGAGATGG + Intergenic
1089774770 11:120828549-120828571 GAAACTGAGGCACAGAGGGGTGG + Intronic
1090024827 11:123158513-123158535 GACAGTGAGGCCCATAGAGGAGG - Intronic
1090071682 11:123549637-123549659 GAAACTGAGGCCCAGAGAAAGGG + Intronic
1090379977 11:126319593-126319615 GCAAGTGAGGTCCAGACAGGGGG - Intronic
1090387248 11:126364334-126364356 GGAGACGAGGGCCAGAGAGGAGG + Intronic
1090389812 11:126381532-126381554 GGAGACGAGGGCCAGAGAGGAGG + Intronic
1090405421 11:126473290-126473312 CAAGGTGAGGCCTGGAGGGGAGG - Exonic
1090491523 11:127165632-127165654 AAAGGAGAGAGCCAGAGAGGGGG + Intergenic
1090833411 11:130436217-130436239 GAAGATTAGGCCCAGCAAGGTGG - Intergenic
1202819721 11_KI270721v1_random:63809-63831 AAAAGTGAGGCTCAGAGAAGTGG - Intergenic
1091388816 12:112610-112632 GAAGCTGGGGCCCAGAGAAGAGG - Intronic
1091399973 12:175648-175670 GAAGCAGAGGCCCTGGGAGGAGG - Exonic
1091671054 12:2452440-2452462 GATCGTGAGGCCCAGAGAATGGG - Intronic
1091967947 12:4761407-4761429 GAAGCTGAGGCACAGAGAGTTGG + Intronic
1092068186 12:5609773-5609795 GAAGGTAAGGCCCAATGAGCTGG - Intronic
1092090646 12:5800981-5801003 GAAGGAGAGGCCCAGTGATGTGG + Intronic
1092090941 12:5803243-5803265 GACGCTGAGACCTAGAGAGGTGG - Intronic
1092143080 12:6197465-6197487 GAGACTGAGGCCCAGAGAGGAGG + Intergenic
1092223234 12:6729610-6729632 GTAGGGGAGGCCCTGGGAGGCGG + Intronic
1092868960 12:12788345-12788367 GAAGCTGAGGGCCAGATAGATGG + Exonic
1093710190 12:22321201-22321223 GATGGTGAGGCTGAGAGGGGTGG + Intronic
1094056471 12:26273983-26274005 GAAAGTGAGGCCCAGTTAGAGGG + Intronic
1094148384 12:27254784-27254806 GTAGGGGAGGCACAGAGAGGGGG + Intronic
1096258254 12:50075563-50075585 GTGGGTGAGGTCCAGAGATGAGG - Intronic
1096816840 12:54207145-54207167 GAAATTGAGGCACAGAAAGGTGG - Intergenic
1096874116 12:54614016-54614038 AAGGATGAGGTCCAGAGAGGTGG - Intergenic
1097134236 12:56838010-56838032 GAGGGTTAGGTTCAGAGAGGAGG + Intergenic
1097285270 12:57872358-57872380 GAAGTTAAGGGCCAGGGAGGAGG - Intergenic
1097633533 12:62093928-62093950 GAAGGCAAGTCCCAAAGAGGAGG + Intronic
1097711677 12:62924196-62924218 GAAACTGAGGCCCAGAGTGGGGG + Intronic
1097900025 12:64863315-64863337 GAAAAGGAAGCCCAGAGAGGTGG + Intronic
1098022958 12:66174421-66174443 AAAGGTGAGGGCGAGGGAGGAGG - Intergenic
1098088918 12:66880068-66880090 GATGATGAGGCACAGAGAGTAGG + Intergenic
1098582910 12:72121946-72121968 GGAGGGGAGGCACAGAGAGCTGG - Intronic
1100459818 12:94788229-94788251 GGTGGTGAGGCCCAGGGATGTGG - Intergenic
1101041423 12:100759784-100759806 GCAGGGGAGGCCCAGAGAACAGG - Intronic
1101138423 12:101770002-101770024 GAAGGTGAGTGCCTAAGAGGAGG - Exonic
1101561021 12:105858182-105858204 GAAACTGAGGCACAGAGAGGTGG - Intergenic
1101749418 12:107571262-107571284 GAAACTGAGGCACAGAGATGGGG + Intronic
1101808136 12:108082910-108082932 AAAAGTGAGGCACAGAGAAGGGG - Intergenic
1101894553 12:108746087-108746109 GAAACAGAGGCCCAAAGAGGTGG - Intergenic
1101915044 12:108889504-108889526 GAAGCTGACCCCCAGAGAGCTGG + Exonic
1101998981 12:109544954-109544976 ATAGGTGAGGCTCTGAGAGGTGG + Intergenic
1102010207 12:109613598-109613620 GAAACTGAGGCCCAGAGATTAGG + Intergenic
1102030284 12:109736403-109736425 GAAACTAAGGCTCAGAGAGGAGG + Intronic
1102038605 12:109786521-109786543 GAAACTGAGGCTGAGAGAGGTGG + Intronic
1102040218 12:109796216-109796238 GAAGCTGAGACCCAGAGAGGTGG + Intronic
1102168379 12:110824006-110824028 GAAACTGAGGCACAGAGAGTTGG + Intergenic
1102196078 12:111025973-111025995 TAAACTGAGGCTCAGAGAGGTGG - Intergenic
1102394283 12:112574320-112574342 GAAGGTGGAGCACGGAGAGGGGG + Intronic
1102403242 12:112649474-112649496 GAAACTGAGGCCCAAAGAGACGG - Intronic
1102515240 12:113441829-113441851 GGAGGTGAGGCCCCTGGAGGTGG - Intergenic
1102535809 12:113580122-113580144 GAAACTGGGGCCCAGGGAGGAGG - Intergenic
1102593914 12:113978118-113978140 GAAACTGAGGCCCAGAAAGGAGG + Intergenic
1102653127 12:114457438-114457460 GAAACTGAGGCCAAGAGAGAGGG - Intergenic
1102934802 12:116887431-116887453 AAAGTGGAGGCTCAGAGAGGTGG - Intergenic
1102965163 12:117120069-117120091 GAAACTGAGGCTCAGTGAGGGGG - Intergenic
1103006710 12:117426712-117426734 GATGGTGATGCCCAGAGAACTGG - Intronic
1103031982 12:117623071-117623093 GAAAATGAGGCTCAAAGAGGTGG - Intronic
1103053740 12:117802532-117802554 AAAGTTGAGGCTCAGAGAGGAGG - Intronic
1103324808 12:120113382-120113404 TAAATTGAGGCTCAGAGAGGGGG - Intronic
1103366652 12:120389109-120389131 GAAGGTGAGGCCGAGCTGGGCGG + Intergenic
1103380553 12:120491006-120491028 GAACCTGAGGCTCAGAGAGGTGG + Intronic
1103419225 12:120766740-120766762 CAAGCTGAGGCTCAGAGAGGTGG - Intronic
1103563099 12:121802914-121802936 GAAGGAGAGGCCAACAGATGAGG - Intronic
1103722961 12:122984293-122984315 TAAGGTGGGGCCAAGAGAGGAGG + Exonic
1103946019 12:124526869-124526891 GAAACTGAGGCTCAGGGAGGTGG - Intronic
1103983142 12:124749889-124749911 GAAACTGAGACTCAGAGAGGGGG + Intergenic
1104072783 12:125360930-125360952 GAAGGCAAGGCTCAGAGAGGTGG - Intronic
1104485971 12:129151406-129151428 GGACGTGAGGTGCAGAGAGGGGG + Intronic
1104506802 12:129339759-129339781 GAAGGCGAGGCCCACAGACTCGG - Intronic
1104727743 12:131088191-131088213 GAAACTGAGCCCCAGAGAGAGGG + Intronic
1104977339 12:132558044-132558066 GATGGTGAGGCCCACAGAGAGGG - Intronic
1105024562 12:132839517-132839539 GGGGGTGAGGCCGAGAGGGGAGG - Intronic
1105281086 13:18962951-18962973 GAAACTGAGGCCCAGAGCTGAGG + Intergenic
1105290289 13:19048963-19048985 GAAGCCGAGGCCCAGAGCTGAGG + Intergenic
1105291332 13:19055582-19055604 GAGAGTGAGGCTCAGAGTGGTGG + Intergenic
1105621786 13:22074753-22074775 GAAACTGAGTCCCACAGAGGTGG + Intergenic
1106413358 13:29526038-29526060 GAGGATGAGGCCAAGGGAGGAGG + Intronic
1106691135 13:32117944-32117966 GAGGCTGAGGTACAGAGAGGCGG - Intronic
1107017150 13:35716770-35716792 GAAGCTGGGGCCCAGAGCGTTGG - Intergenic
1107391205 13:39966231-39966253 AAAGTTGAGGCTCAGAGAGGTGG + Intergenic
1107602480 13:42028081-42028103 GAATGTGAGGGCTAGAGGGGTGG - Intergenic
1107891856 13:44921098-44921120 CAAGTTTAGGCCCAGAGAGCTGG - Intergenic
1108701933 13:52951060-52951082 GAAGCTGAGGCTCAAAGAGGTGG + Intergenic
1108945393 13:56016975-56016997 CAGGGTGAGGCTGAGAGAGGAGG - Intergenic
1109223967 13:59670400-59670422 GAAGGTGAGGACCAGAATGGGGG - Intronic
1110167219 13:72457810-72457832 GAAGGTAAAGTCCAGAGAGATGG + Intergenic
1110195232 13:72781522-72781544 GAAACTGAGGCCCAGGGAGGCGG - Intronic
1110297099 13:73880145-73880167 GCAGGTGTGGACCAGAGAGGAGG - Intronic
1110305936 13:73986722-73986744 GAAGGGGAGAACCAGAGAGATGG + Intronic
1110386757 13:74921247-74921269 GAAGGTAAGGCCCAGAAAATGGG - Intergenic
1110556026 13:76860475-76860497 GAAGATGTGGCCAGGAGAGGTGG + Intergenic
1112205753 13:97321879-97321901 GAAACAGAGGCACAGAGAGGGGG - Intronic
1112440656 13:99422387-99422409 GATGCTGAGACCCAGAGAGGTGG + Intergenic
1112907642 13:104444233-104444255 GAAAGTGAGACACAGAGTGGAGG + Intergenic
1113661118 13:112106939-112106961 GGAGGAGGGGCCCAGGGAGGGGG + Intergenic
1113796135 13:113059732-113059754 GAAGCTGAGACACAGAGAAGGGG + Intronic
1114529955 14:23389374-23389396 CAAGGTGAGGCCCAGTGGGGAGG - Exonic
1114536140 14:23424152-23424174 GAAGGTGAGGAACAGAGGGGAGG + Intronic
1114614868 14:24062942-24062964 GAAGGCCAGGCACAGTGAGGTGG - Intronic
1115051302 14:29067028-29067050 GAAGGTGAGCCCGGGAAAGGAGG + Intergenic
1115346130 14:32344985-32345007 TAGGATGAGGCTCAGAGAGGAGG + Intronic
1115862408 14:37701983-37702005 GAAGGTGAGACCCAAGGAGAAGG - Intronic
1115986512 14:39108112-39108134 GAATGTGAGGACAAGAGAAGTGG + Intronic
1116000085 14:39233413-39233435 GAAACTGAGGCACAGAGAGATGG - Intronic
1116801042 14:49443410-49443432 GAAACCGAGGACCAGAGAGGAGG - Intergenic
1117616254 14:57536641-57536663 GGAAATAAGGCCCAGAGAGGTGG + Intergenic
1117810119 14:59536655-59536677 GAAGGTGAGGGCCAGAAAATAGG - Intronic
1118489753 14:66247580-66247602 GAAAGTCAGTCCCAGAGAGAAGG - Intergenic
1118821424 14:69348715-69348737 GAAAGTGATGCACAGAGAGGTGG + Intronic
1118897016 14:69953677-69953699 GACGGGGAGGGCCAGAGAGGGGG - Intronic
1119180245 14:72600456-72600478 GAAACTGAGGCCTAGAGAGGGGG - Intergenic
1119210988 14:72831578-72831600 GAAACTGAGGCTCAGAGAGGGGG + Intronic
1119325938 14:73759631-73759653 GCAGGCGCGGCCCGGAGAGGGGG - Intronic
1119436551 14:74601223-74601245 GAAAGTGAGCCTCAGAGAGGCGG - Intronic
1119559142 14:75576518-75576540 GAAACTGAGGCCTGGAGAGGCGG - Intergenic
1119559248 14:75577679-75577701 GAAACTGAAGCGCAGAGAGGTGG + Intergenic
1120835512 14:89035409-89035431 GGAGGAGAGGCCCACAGAGCAGG - Intergenic
1121038630 14:90727093-90727115 GAAAGGGAGGCCGGGAGAGGAGG + Intronic
1121076719 14:91075228-91075250 GATGATGAGCCTCAGAGAGGAGG - Intronic
1121310712 14:92933690-92933712 GACTGCCAGGCCCAGAGAGGGGG - Intronic
1121322394 14:92999580-92999602 GGAGCTGAGGCCCAGCAAGGAGG - Intronic
1121439653 14:93940636-93940658 GAAGGTGAGGCAGAGAGACTGGG - Intronic
1121565017 14:94902831-94902853 GAAGCTGGGGCCCAGAAGGGTGG + Intergenic
1121571740 14:94951521-94951543 GAAACTGAGGCCTACAGAGGGGG - Intergenic
1121656654 14:95601899-95601921 GATGATAAGGGCCAGAGAGGAGG + Intergenic
1121835777 14:97090796-97090818 GAAACTGAGGCCCAGAAAGGCGG + Intergenic
1122151819 14:99729942-99729964 GAAACTGAGGCCCAGGCAGGTGG - Intergenic
1122208711 14:100161050-100161072 GAGACTGAGGCCCAGAGATGAGG + Intergenic
1122230495 14:100304414-100304436 GAAACCTAGGCCCAGAGAGGTGG - Intronic
1122267199 14:100552205-100552227 GAAACTGAGGCCCAGGGAAGGGG + Intronic
1122428876 14:101627633-101627655 GAAGGTGAGGCCGGGAGCGGTGG - Intergenic
1122629581 14:103101418-103101440 AAAAGTGAGGCTCAGAGAGGTGG + Intronic
1122733277 14:103818612-103818634 AAATGTGAAGCCCAGAGAAGAGG - Intronic
1122977473 14:105176843-105176865 GAAGCTGAGGCCCTGGGAGGGGG - Intronic
1124496103 15:30188260-30188282 GAAACTGAGGCTTAGAGAGGGGG - Intergenic
1124602556 15:31147503-31147525 GAAACTCAGGCCCAGAGAGGTGG + Intronic
1124747471 15:32350387-32350409 GAAACTGAGGCTTAGAGAGGGGG + Intergenic
1125171180 15:36768318-36768340 GACAGTGAGGCCCAGAGAAGAGG - Intronic
1125520347 15:40344892-40344914 GAAGCTGAAGCCCAAAGAGGTGG + Intergenic
1126738276 15:51752610-51752632 CATGCAGAGGCCCAGAGAGGTGG - Intronic
1127098555 15:55537599-55537621 AAAGATGAGGCCCAGAGCGGTGG - Intergenic
1127958189 15:63871231-63871253 GAAACTGAGGCACAGAGAGGTGG + Intergenic
1128092023 15:64925784-64925806 AAAGTGGAGGCTCAGAGAGGTGG + Intronic
1128312499 15:66640095-66640117 GAAACAGAGGCTCAGAGAGGAGG + Intronic
1128367679 15:67016019-67016041 GAGACTGAGGTCCAGAGAGGTGG - Intergenic
1128472793 15:67968965-67968987 GAAACTGAGGCCCAGAAAGGAGG + Intergenic
1128578745 15:68793902-68793924 GAAGGACAGGACCAGAGAGAAGG + Intronic
1128612385 15:69084484-69084506 CAAGCTGAGTCCCAGGGAGGGGG + Intergenic
1128717496 15:69919389-69919411 AAAACTGAAGCCCAGAGAGGAGG - Intergenic
1128870462 15:71151548-71151570 GAAACTGAGGCACAGAGAGACGG + Intronic
1128998939 15:72317489-72317511 GAAACTGAAGCCCAGAGAGTGGG + Intronic
1129071136 15:72952555-72952577 GAAACCGAGGCCCAGAGAGTAGG - Intergenic
1129228944 15:74185799-74185821 GAAGCTGAGGCTCAGAGAGAGGG + Intronic
1129232271 15:74203362-74203384 GAAGGTCTGGGCCAGGGAGGAGG + Intronic
1129298133 15:74610969-74610991 ACAGGCGAGCCCCAGAGAGGGGG - Intronic
1129316929 15:74750725-74750747 GAAACTGAGGCCCAGAGAAGGGG - Intronic
1129324400 15:74792576-74792598 GGGGGTCAGGCACAGAGAGGGGG - Intronic
1129366809 15:75060912-75060934 GAACCTGAGGCCCAGAAAGAAGG + Intronic
1129518746 15:76172499-76172521 TAGGGTGAGGCCCAGGGAGAGGG - Intronic
1129519260 15:76175809-76175831 GAACCTGAAGCCCAGAGAAGGGG + Intronic
1129600208 15:76994382-76994404 GAAGCTGAGGCTCAGCGAGTTGG + Intronic
1129726063 15:77902369-77902391 GAAACTGAGGCTCAGAGAGGGGG - Intergenic
1129847759 15:78775812-78775834 GAAATGGAGGCCCAGAGAAGGGG + Intronic
1129852792 15:78804059-78804081 CAAAGGGAGGCTCAGAGAGGTGG + Intronic
1130115791 15:81002976-81002998 GAAGGTGGCGCCCAGTGAGCTGG + Exonic
1130250180 15:82294985-82295007 CAAAGGGAGGCTCAGAGAGGTGG - Intergenic
1130254146 15:82318103-82318125 GAAACGGAGGCCCAGAGAAGGGG - Intergenic
1130274124 15:82467734-82467756 GAAACTGAGGCTCAGAGGGGGGG - Intergenic
1130377439 15:83341816-83341838 AAAGGTGAGGTCCAGATAAGAGG + Intergenic
1130460181 15:84154492-84154514 GCAGCCGAGGCTCAGAGAGGTGG - Intergenic
1130466470 15:84195108-84195130 GAAACTGAGGCTCAGAGGGGGGG - Intergenic
1130497794 15:84478428-84478450 GAAACTGAGGCTCAGAGGGGGGG + Intergenic
1130588766 15:85199701-85199723 GAAACTGAGGCTCAGAGGGGGGG - Intergenic
1130600825 15:85271868-85271890 GAAACGGAGGCCCAGAGAAGGGG + Intergenic
1130682620 15:86009973-86009995 GAAGCTGTTGCCCACAGAGGTGG + Intergenic
1130705685 15:86230981-86231003 GAAACTGAGGACCAGAGAGAGGG + Intronic
1130854428 15:87828978-87829000 GAAGCAGATGCCCAGAGAGGAGG + Intergenic
1130983838 15:88831717-88831739 GAAACTGAGGCCCAAGGAGGAGG - Intronic
1131068625 15:89450017-89450039 AAAGCGGAGGCCCAGAGAGCAGG + Intergenic
1131487516 15:92834014-92834036 GAAGGAGAGGGAGAGAGAGGGGG - Intergenic
1131980989 15:97994467-97994489 GAAGCAGAGGTCCAGAGGGGTGG + Intergenic
1132265651 15:100468280-100468302 AAAACTGAGGCACAGAGAGGTGG + Intronic
1132356257 15:101173617-101173639 GGATGTGAGGGCCAGGGAGGAGG - Intergenic
1132573749 16:655530-655552 GAAGGTGAGGCCCTCAGGGAAGG - Intronic
1132643479 16:988404-988426 GAGGGGGACCCCCAGAGAGGAGG - Intergenic
1132648205 16:1008726-1008748 GAAGTTGAGGTCCAGAGAGATGG + Intergenic
1132692535 16:1188074-1188096 GAAGCTGAGGCTTAGAAAGGGGG + Intronic
1132896876 16:2233413-2233435 GCAGGGGAGGCAGAGAGAGGAGG - Intronic
1132928908 16:2448653-2448675 AAAGGGGAGGCCCAGGCAGGAGG - Intronic
1133055788 16:3144844-3144866 GAGGGGGAGGCCCAGGGAAGCGG + Intronic
1133210275 16:4259900-4259922 GAATGTGAGGGCCAGAGATCGGG - Intronic
1133211103 16:4263921-4263943 GCAGGGGAGGTCCAGGGAGGGGG - Intronic
1133334109 16:4995584-4995606 AAAACTGAGGCCTAGAGAGGTGG - Intronic
1133743563 16:8670214-8670236 GAGACTGAGGCCCAGAGAGGAGG - Intergenic
1134068523 16:11246049-11246071 GAAACTGAGGACCAGAGATGTGG - Intergenic
1134220008 16:12346441-12346463 GAAACTGAGGCCCAGAGAGGTGG + Intronic
1134226036 16:12390787-12390809 GGAAGTAAGGCCCAGAGAAGTGG + Intronic
1134252200 16:12582310-12582332 GAATCTGAGGCCTAGAGAGGTGG + Intergenic
1134388449 16:13795824-13795846 GAAACTGAGGTTCAGAGAGGTGG - Intergenic
1134464661 16:14464466-14464488 GAAGGTGAGGCCAGGTGTGGTGG + Intronic
1134633994 16:15778488-15778510 GCTGATGAGGCACAGAGAGGTGG + Intronic
1134671124 16:16055856-16055878 GAAGTTGAGGCCCAGTGCGGTGG + Intronic
1134693340 16:16205280-16205302 GAAGCTGAGGCTCTGAGAGATGG + Intronic
1134839259 16:17388506-17388528 GAAGTTGGGGCTCAGGGAGGTGG - Intronic
1134978512 16:18589421-18589443 GAAGCTGAGGCTCTGAGAGATGG - Intergenic
1135398580 16:22149746-22149768 GGAGGTGAGGGGCAGAGAAGGGG - Intronic
1135418593 16:22288637-22288659 CAAGATGGGGCCCAGAGAAGTGG + Exonic
1135486855 16:22873246-22873268 GAAGGTGAGGCTCAGAGAAGTGG - Intronic
1135653974 16:24231660-24231682 GAAACTGAGCCACAGAGAGGTGG + Intergenic
1135946998 16:26873885-26873907 AGAGGAGAGGCCCGGAGAGGAGG + Intergenic
1135992951 16:27228747-27228769 GAGGGTGAGGGCTGGAGAGGTGG - Intronic
1136010210 16:27358698-27358720 GAGAGTGAGGCCCAAGGAGGTGG - Intronic
1136065644 16:27756440-27756462 GCAGCTGAGGCTCAGAGAGATGG + Intronic
1136074380 16:27806795-27806817 GAAATTAAGGCTCAGAGAGGTGG - Intronic
1136144901 16:28310831-28310853 GAAGCAGAGGCCCAGAGCAGTGG + Intronic
1136270752 16:29146896-29146918 GAGGGTGAGGCCAGGAAAGGAGG - Intergenic
1136277688 16:29188570-29188592 GGAGCTGAGGCTCAGAGAGAAGG + Intergenic
1136461892 16:30416634-30416656 GAAGCAGAAGCCCAGTGAGGAGG - Intronic
1136516288 16:30770442-30770464 GAAACTGAGGCTCAGGGAGGTGG + Intronic
1137036599 16:35574370-35574392 AAAGGAGAGGCCCCGAGAGTCGG - Intergenic
1137499052 16:48996534-48996556 GAAGGTGAGAGACAGAGAGAGGG + Intergenic
1137568860 16:49551646-49551668 GAAGCTGGGATCCAGAGAGGAGG + Intronic
1137769888 16:51007698-51007720 GAAGGTGTGGGGCACAGAGGAGG - Intergenic
1137834571 16:51578831-51578853 GAAACTAAGGCCCAGAGAGGGGG + Intergenic
1138191409 16:55016971-55016993 GAAACTGAGGCTCAGAGAGGAGG + Intergenic
1138279003 16:55758480-55758502 GAAACTAAGGCCCAGAGATGGGG - Intergenic
1138289534 16:55835194-55835216 GAAACTAAGGCCCAGAGATGAGG + Intergenic
1138342899 16:56302357-56302379 GAAACTGAGGCACAGAGAGGCGG - Intronic
1138482630 16:57313962-57313984 GAAACTGAGGCACGGAGAGGGGG - Intergenic
1138553468 16:57759366-57759388 GCAGCTGAGGCACAGGGAGGGGG + Intronic
1139205899 16:65028171-65028193 CATGGTGAGGCCCAGACAGTGGG - Intronic
1139325010 16:66145852-66145874 GAGAGTGAGGCCCAGACAAGGGG + Intergenic
1139430004 16:66906040-66906062 AAAGGTGAGGATCAGAGAGGGGG - Intergenic
1139527627 16:67526516-67526538 GAAGGTGAGGGCAGGAGAGGGGG + Intronic
1139601226 16:67988630-67988652 GAAGAAAAGGCCCAGTGAGGTGG + Intronic
1139953594 16:70683242-70683264 GAAACTGAGGCTCAGACAGGGGG - Intronic
1140240203 16:73193276-73193298 AAAACTGAGGCCCAGAGAGGTGG - Intergenic
1140315408 16:73891491-73891513 GAAGGAGAGGGAGAGAGAGGGGG + Intergenic
1140338869 16:74137910-74137932 GAAACTGAGGCTCAGAGAGATGG + Intergenic
1140406207 16:74713371-74713393 GGAGGTGAGGCACTGAGAGGTGG + Exonic
1140743902 16:77964474-77964496 GAAGGTTTGGCTCAGAGAGCAGG - Intronic
1140836394 16:78798077-78798099 GAAGCTGAGGTTCAGAGAGATGG + Intronic
1140967973 16:79985784-79985806 GACGGTAAGGCCCACAGAGCTGG + Intergenic
1141097785 16:81175153-81175175 GAGGTTGAGACCAAGAGAGGAGG - Intergenic
1141151500 16:81567529-81567551 GAAACTGAGGCCCAGAGACGTGG - Intronic
1141166670 16:81665462-81665484 GAATCTGGGACCCAGAGAGGTGG + Intronic
1141267781 16:82512566-82512588 GAAATGGAGGCCCAGAGGGGTGG - Intergenic
1141423095 16:83929955-83929977 GAACATGAGGGCCAGGGAGGAGG - Intronic
1141424119 16:83934501-83934523 GAAGCCGAGGCCGAGACAGGAGG - Intronic
1141491810 16:84378935-84378957 GTAGGTGAGGGCCAGAGGAGTGG - Intronic
1141557450 16:84845527-84845549 GACACTGAGGCCCAGAGAGAAGG + Intronic
1141611523 16:85183762-85183784 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1141714432 16:85718549-85718571 GAAGCAGAGGCCCAAAGAGGGGG - Intronic
1141747949 16:85938601-85938623 CAAGTGGAGGCCCAGAGGGGTGG - Intergenic
1141748983 16:85945777-85945799 TAAGGTGGGGCACAGAGAGATGG - Intergenic
1141750926 16:85957370-85957392 GAAACTGAGGCTCAGAGGGGTGG + Intergenic
1141802932 16:86323354-86323376 GAAACTGAGACCCAGAGAGTTGG + Intergenic
1142074332 16:88108677-88108699 GAGGGTGAGGCCAGGAAAGGAGG - Intronic
1142082063 16:88154612-88154634 GGAGCTGAGGCTCAGAGAGAAGG + Intergenic
1142116327 16:88357996-88358018 GAAACTGAGGCACAGAGAGAGGG + Intergenic
1142128520 16:88421816-88421838 GAAGTTGCAGCCCAGAGAGGTGG - Intergenic
1142170502 16:88619638-88619660 CCAGCTGAGGTCCAGAGAGGCGG - Intronic
1142433718 16:90044190-90044212 TGAGGTTAGGCCCAGAGAGCTGG + Exonic
1142583460 17:955989-956011 GAAACTGAGGCTCAGGGAGGAGG - Intronic
1142673178 17:1496898-1496920 GAAGGTGGGGCACCCAGAGGGGG + Intronic
1142755939 17:2016447-2016469 TAAACTGAGGCCCAGAGATGAGG + Intronic
1142787428 17:2235093-2235115 GCTGGTGAGGCCCAAAGGGGAGG - Intronic
1142856759 17:2734997-2735019 TCAGGTGAGGCCAGGAGAGGCGG - Intergenic
1142903717 17:3028749-3028771 GAAACTGAGGCTCAGAGACGTGG - Intronic
1142967976 17:3592682-3592704 GCACCTGAGGCCCAGAGACGAGG - Intronic
1142991835 17:3736521-3736543 GAAGCTGAGGCCAAGAAACGGGG - Intronic
1143013968 17:3881902-3881924 GAAACTGAGGCACAGAGAAGGGG + Intronic
1143021776 17:3920483-3920505 AGAGGTGAGTGCCAGAGAGGAGG - Intergenic
1143099569 17:4498030-4498052 GAAATGGAGGCCCAGAGAGTGGG + Intergenic
1143611343 17:8019618-8019640 GAGGCTGAGGCACAGAGAGGAGG - Intronic
1143729478 17:8872938-8872960 GAAACTGAGGCCCAGAGACTGGG - Intergenic
1143970755 17:10793580-10793602 AAAAGGGAGGCCCACAGAGGAGG - Intergenic
1144058365 17:11560421-11560443 GAAGGTGAGGCTAAGAGGGTTGG + Exonic
1144145071 17:12389467-12389489 GATGGTGGGGTCCTGAGAGGTGG - Intergenic
1144392052 17:14802792-14802814 GAAGCTGAGGTCCAGAGAAGGGG + Intergenic
1144627407 17:16851227-16851249 GCAGGAGAGGGGCAGAGAGGTGG + Intergenic
1144669338 17:17124098-17124120 GAAACTGAGGCCCAGAGAGGTGG + Intronic
1144759250 17:17698174-17698196 GAAACTGAGGTCCAGGGAGGAGG - Intronic
1144786959 17:17837240-17837262 GAAACAGAGGCCCAGAGAGGGGG - Intergenic
1144879033 17:18421492-18421514 GCAGGAGAGGGGCAGAGAGGTGG - Intergenic
1144949449 17:18986041-18986063 GCACTCGAGGCCCAGAGAGGTGG + Intronic
1144957599 17:19027045-19027067 GACGCAGAGGCCCAGAGAGGTGG - Intronic
1144977557 17:19147471-19147493 GACGCAGAGGCCCAGAGAGGTGG + Intronic
1145153204 17:20522902-20522924 GCAGGAGAGGGGCAGAGAGGTGG + Intergenic
1145250411 17:21294100-21294122 GAAACTGAGGCCCCGAGAAGTGG - Intronic
1145877717 17:28332127-28332149 ACAGGTGAGGCTCAGAGAGGTGG - Exonic
1146127163 17:30238606-30238628 GAAGGAGCGGCCCAGAGGCGGGG - Intergenic
1146644965 17:34571289-34571311 GAATGTGAGGCCCACAGCAGTGG - Intergenic
1146673539 17:34757923-34757945 GAAACTGAGGCCCCGAGAGGAGG - Intergenic
1146818369 17:35963238-35963260 GAAGTTGAGACCCAAAGAAGTGG - Intergenic
1146913180 17:36660999-36661021 GAAAGGGAGGCACAGAGAAGGGG + Intergenic
1146949602 17:36896768-36896790 GAAGCTGAGGTCCAGAGAAGTGG + Intergenic
1147236389 17:39060814-39060836 GAAACTGAGGCTCAGGGAGGTGG - Intergenic
1147276109 17:39317985-39318007 GAAAGTGAGGCCGCGAGCGGTGG - Intronic
1147326686 17:39673018-39673040 GAAGGTGAGCACCAGGCAGGGGG + Intronic
1147357178 17:39907219-39907241 GAAGCCAAGGCCCAGAAAGGGGG + Intronic
1147582956 17:41637115-41637137 GAGGGGGAGGCCCAGGGAGGTGG + Intergenic
1147597127 17:41724454-41724476 GAAGCTGAGGCGCAGTGTGGGGG + Exonic
1147612470 17:41810114-41810136 GCAGGTGAGGTCCAGAAATGGGG + Intronic
1147683772 17:42275154-42275176 GAAACTGAGGCCCAGATAGGTGG - Intronic
1147876993 17:43628732-43628754 GAAACTGAGGCCCAGAGAGAAGG - Intergenic
1147918912 17:43904595-43904617 GAAGGTGCTGCCCAGAAAGTGGG + Intronic
1147955759 17:44133430-44133452 GAAACTGAGGCTCAGATAGGTGG - Intergenic
1148006920 17:44440067-44440089 GAAGTTGAGGCCGGGCGAGGTGG - Intronic
1148073492 17:44922128-44922150 GAATGTGAGGGCCAGCGTGGTGG - Intergenic
1148090548 17:45020374-45020396 GAAGGTGGGGCACAGAAATGTGG - Intergenic
1148178230 17:45585443-45585465 GAAGGGGAGACGCAGGGAGGAGG - Intergenic
1148204625 17:45772082-45772104 AAAGCTGAGGCCCAGACACGGGG - Intergenic
1148355038 17:46969869-46969891 GAAAGTGGGCACCAGAGAGGGGG - Intronic
1148480070 17:47954240-47954262 GAAACTGAGGCCCAGAGAGGTGG - Intronic
1148652681 17:49260861-49260883 GAAACCGAGGCCCAGAGACGGGG + Intergenic
1148738822 17:49880533-49880555 AAAGGAGAGGCCAAGAGAGGCGG - Intergenic
1148792791 17:50183156-50183178 GAAGGCGAGGCCCGGAGGGAAGG - Intergenic
1148833674 17:50453493-50453515 GCAGGTGAGGCCGAGCGCGGTGG - Intronic
1148873940 17:50675597-50675619 GCTGGTCAGGCCCAGGGAGGGGG - Intronic
1148913190 17:50954297-50954319 TAAACTGAGACCCAGAGAGGGGG - Intergenic
1149498684 17:57135255-57135277 CAAACTGAGGCCCAGAGAAGTGG - Intergenic
1149558981 17:57594605-57594627 GAAGGAGATGCCCAAAGAGAGGG + Intronic
1149665616 17:58363093-58363115 GTAGGTGAGGCCCAAAGACGGGG + Intronic
1150408130 17:64919733-64919755 GAAGGGGAGACGCAGGGAGGAGG - Intergenic
1150644354 17:66968690-66968712 GAAGGTGAGGGGAGGAGAGGAGG - Intronic
1150918875 17:69462638-69462660 GCAGGAGAGGCCCAGAAATGAGG - Intronic
1151305637 17:73261248-73261270 GAAAGAGAGGCACAGAGAGACGG - Intronic
1151337779 17:73450235-73450257 GAAACTGAGGCCCAGCAAGGAGG - Intronic
1151342018 17:73477641-73477663 GGCGGGGAGGCTCAGAGAGGAGG + Intronic
1151539979 17:74759874-74759896 GAAACTGAGGCTCAGAGATGTGG - Intronic
1151626418 17:75278692-75278714 GAAGGTGAGGCCAGGCGCGGTGG + Intronic
1151758924 17:76089865-76089887 GCTGGTAAGTCCCAGAGAGGAGG + Intronic
1151786672 17:76278570-76278592 GAAGGGGAGCAGCAGAGAGGTGG + Intronic
1151976057 17:77484044-77484066 GAAGCTAAGGCTCACAGAGGAGG - Intronic
1152035250 17:77868291-77868313 TCAGGTGAGGCCCGGATAGGAGG - Intergenic
1152228453 17:79103273-79103295 GAAGGACAGGCACGGAGAGGAGG + Intronic
1152242074 17:79166021-79166043 GAAACTGAGGCCCAGGGAGCTGG + Intronic
1152288641 17:79426255-79426277 GCAGGCAAGGCCCAGAGGGGAGG + Intronic
1152742071 17:82022807-82022829 GAAGGTGAGGGCCGGAGGGCAGG - Exonic
1152895547 17:82909051-82909073 GAAACTGAGGCACAGAGAGAGGG - Intronic
1153434001 18:5049130-5049152 GAAGTTTGGGCACAGAGAGGAGG - Intergenic
1153476671 18:5505613-5505635 GAAGGTGTGGACCATAGAGGTGG - Intronic
1153627954 18:7039766-7039788 AGAGATGAGGCCCACAGAGGAGG + Intronic
1154102751 18:11491122-11491144 GTTGGTGTGGCCCAGAGAAGGGG - Intergenic
1154241638 18:12658202-12658224 GGAGGTGAGGACCAGGCAGGAGG + Exonic
1154383088 18:13869986-13870008 GATGGTCAGGGCCACAGAGGAGG + Intergenic
1155091431 18:22515206-22515228 GGAGGTCAAGCCCAGTGAGGAGG + Intergenic
1155169275 18:23255127-23255149 GAGTGTGAGGCCCATGGAGGAGG + Intronic
1155284624 18:24274957-24274979 GAAGGAGAAGCCAAAAGAGGCGG + Intronic
1155358064 18:24972940-24972962 GAAGGTGGAGCCAAGAGTGGTGG + Intergenic
1156128498 18:33938174-33938196 AAAACTGCGGCCCAGAGAGGTGG - Intronic
1156304554 18:35865061-35865083 GAAATTGAGGCCTAGAGAGACGG + Intergenic
1156349779 18:36294276-36294298 GAAAGTGAGGGCTAGAGAGAAGG + Intergenic
1157175018 18:45443701-45443723 GAATGAGAGGCAGAGAGAGGAGG + Intronic
1157223165 18:45841358-45841380 TCAGGTGAGGCCCAGAAAGGAGG + Intronic
1157270629 18:46273243-46273265 GAAGGTAAGAACCAGAGAGGTGG - Intergenic
1157339069 18:46763051-46763073 GAAGGGGAGGCCAAGGGAAGGGG - Intergenic
1157938986 18:51905649-51905671 GAAACTGAGGCACAGAGAGATGG - Intergenic
1159059459 18:63499596-63499618 GGAGCTGAGGCACAGAGGGGTGG + Intronic
1159531092 18:69656463-69656485 GAAATGGAGGCACAGAGAGGTGG - Intronic
1159801387 18:72904522-72904544 GAAGATGAGGCAGAGACAGGAGG + Intergenic
1160015859 18:75139870-75139892 GAAAGTGAGAGACAGAGAGGGGG - Intergenic
1160397789 18:78584621-78584643 GAAAGGGAGGCTCAGAGAGGAGG - Intergenic
1160397801 18:78584692-78584714 GACAGGGAGGCTCAGAGAGGAGG - Intergenic
1160662031 19:305780-305802 GAACGAGAGGGCCAGGGAGGAGG + Exonic
1160677497 19:399281-399303 GAAACTGAGGCTCAGAGAGGGGG + Intergenic
1160688115 19:446727-446749 GAAACTGAGGCCCAGAGAGAAGG + Intronic
1160698259 19:494820-494842 GAAACTGAGGCCCAGAGGAGGGG - Intronic
1160719468 19:590900-590922 GAACGTGGGCCCCAGAGAGGCGG + Intronic
1160742768 19:695081-695103 GACGGAGAGACCCAGAGAGCTGG + Intronic
1160750002 19:729395-729417 GAAACTGAGGCCCAGGGAGTGGG - Intronic
1160755620 19:755469-755491 GAAACTGAGGCCCAGAGAGAAGG - Intronic
1160810288 19:1010301-1010323 GAAGGTCAGGCCCAGCCAGCAGG + Exonic
1160867623 19:1262750-1262772 GAAGGGGGCCCCCAGAGAGGGGG - Intronic
1160904808 19:1447070-1447092 GAAACTGAGGCCCATAGCGGCGG + Intronic
1160916832 19:1500775-1500797 GAGTGGGAGGCACAGAGAGGAGG + Intergenic
1160919419 19:1512903-1512925 GAAACTGAGGCCCAGAGGTGCGG - Intronic
1161204783 19:3035378-3035400 GAAACTGAGGCGCAAAGAGGGGG - Intronic
1161245570 19:3249765-3249787 GAAGGTGAGGCCCAGAGAGGGGG + Intronic
1161260673 19:3336102-3336124 GAAACTGAGGCCCAGAGAAAAGG - Intergenic
1161288339 19:3479972-3479994 GAAGGAGGAGCCCAGAGGGGAGG + Intronic
1161342727 19:3751869-3751891 GAAACTGAGGCCCAGAGATAGGG - Intronic
1161379786 19:3958874-3958896 GAAGGTGAAGGCCAGCGTGGAGG + Exonic
1161419475 19:4168495-4168517 GAAACTGAGGCCCAGAGAGAAGG + Intronic
1161454226 19:4362151-4362173 GAGGCTGAGACCCAGAGGGGTGG + Intronic
1161493838 19:4576962-4576984 GAAACTGAGGCTCAGAGAGGGGG + Intergenic
1161495573 19:4584229-4584251 GAAACTGAGGCCCAGCGGGGCGG - Intergenic
1161517033 19:4702313-4702335 GAAACTGAAGCCCAGAGAGTTGG - Intronic
1161527181 19:4763544-4763566 GAAACTGAGTCCCAGAGAGGTGG - Intergenic
1161527964 19:4769166-4769188 GCAGGTGAGGCACACAGAGGGGG + Intergenic
1161624944 19:5320864-5320886 GAAACTGAGGCCCAGAGAGGTGG + Intronic
1161631277 19:5357371-5357393 GAAACTGAGGCCCAGCGAGAGGG - Intergenic
1161703643 19:5807702-5807724 GAAACTAAGGCCCAGAGAGAGGG + Intergenic
1161819414 19:6520350-6520372 GAAACTGAGGCACAGAGAGATGG + Intergenic
1161829085 19:6589900-6589922 GAGGGAGAGGCCCAGAGAAAGGG - Intronic
1161961266 19:7524688-7524710 GAAACTGAGGCTCAGAGAGCTGG + Intronic
1162370018 19:10272947-10272969 GAAATTGAGGCCCAAAGAGGGGG + Intronic
1162444110 19:10712124-10712146 TAAGGTGAGGGCCACAGAAGAGG - Intronic
1162495466 19:11021005-11021027 GAAACTGAGGCCCAGGGAGCTGG + Intronic
1162799498 19:13102983-13103005 GAAGGCGAAGCCCTGAGGGGTGG - Intronic
1163339897 19:16698919-16698941 GAAATTGAGGCTCAGAGAAGGGG - Intergenic
1163510037 19:17728897-17728919 GAAACTGAGCCCCGGAGAGGTGG - Intronic
1163525132 19:17816358-17816380 GAAACTGAGGCCCAGGGAGAGGG - Intergenic
1163537174 19:17883617-17883639 TAAACTGAGGCCCAGAGCGGTGG + Intronic
1163721624 19:18900628-18900650 GAAACTGAGGCTCAGCGAGGCGG - Intronic
1164428603 19:28167111-28167133 TAAATTGAGACCCAGAGAGGTGG + Intergenic
1164546812 19:29172795-29172817 CAAAGTGAAGCCCAGAGAGAGGG + Intergenic
1164645544 19:29856530-29856552 GAAGGGGCGGCTCAGGGAGGGGG + Intergenic
1164675278 19:30096508-30096530 GAAACTGAGGTCCAGGGAGGAGG + Intergenic
1164915896 19:32052246-32052268 GAAACTGAGCCCCAGAGAAGAGG + Intergenic
1165068385 19:33241663-33241685 GTGGGTGAGGCCCGGAGAGCCGG + Intergenic
1165124088 19:33581732-33581754 GAAGGTGAGGCCCTGGCTGGGGG - Intergenic
1165142044 19:33705418-33705440 GAAGGCAAGGGCCAGAGAGTGGG + Intronic
1165315796 19:35054703-35054725 GAAGCTGAGGCTCAGAGAGGTGG - Intronic
1165484659 19:36088435-36088457 GAAGTTGAGGCTCAAAGGGGAGG + Intronic
1165822706 19:38686659-38686681 GCAGGTGGGGCCCACAGAGCGGG - Intronic
1165861310 19:38910976-38910998 GAAGATGAGGTCCAGCCAGGAGG - Exonic
1165896752 19:39145967-39145989 GAAACTGAGGCCAACAGAGGTGG - Intronic
1165898177 19:39155788-39155810 GAAACTGAGGCGCGGAGAGGCGG - Intronic
1165959318 19:39521048-39521070 GAAATGGAGGCTCAGAGAGGTGG - Intergenic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166154370 19:40899875-40899897 GCAGCTGAGGCCCAGTGGGGTGG + Intergenic
1166200368 19:41233705-41233727 GGAACTGAGGCCCAGAGAGGGGG - Intronic
1166500835 19:43340007-43340029 GAAACTGAGGCTCAGAGACGGGG + Intergenic
1166505295 19:43367685-43367707 GAAACTGAGGCTCAGAGACGGGG + Intergenic
1166670086 19:44704351-44704373 GAAACTGAGGCCAGGAGAGGGGG + Intronic
1166676807 19:44746031-44746053 GGAGGTGAGGGTCTGAGAGGAGG - Intergenic
1166712816 19:44948295-44948317 GAAAGTGAGGCCCAAGAAGGGGG + Intronic
1166838662 19:45682916-45682938 GAAGCTGGAGCCCAGAAAGGAGG + Exonic
1166983784 19:46648216-46648238 GAAAGTGACGCCCAGAGAAGGGG + Exonic
1167234040 19:48303110-48303132 CAAGGCGGGGCCCAGAGAGAGGG + Intronic
1167268452 19:48494633-48494655 GAAACAGAGGCTCAGAGAGGTGG - Intronic
1167315604 19:48761242-48761264 GAGGGAGAGTCCCAGAGAGAGGG + Intergenic
1167315658 19:48761496-48761518 GAGGGAGAGTCCCAGAGAGAGGG + Intergenic
1167315711 19:48761754-48761776 GAGGGAGAGTCCCAGAGAGAGGG + Intergenic
1167428292 19:49440931-49440953 GAAGGAGGGGCCCAGAGAGAAGG + Intronic
1167513125 19:49907296-49907318 GGAGGTGAGGCCCAAGGTGGGGG + Intronic
1167621266 19:50562309-50562331 GAAACTGAGGCCCAGAGAGGTGG - Intronic
1167638652 19:50668589-50668611 GAAGGCGAGCCCCAGAAGGGCGG - Exonic
1167668295 19:50835736-50835758 GAAACTGAGGCCCAGACAGGAGG + Intronic
1167707362 19:51089527-51089549 GAAACTGAGGCTGAGAGAGGAGG + Intergenic
1167851469 19:52205696-52205718 GAAGCTGGGACTCAGAGAGGTGG + Intronic
1168101475 19:54143761-54143783 GAGCCTGAGTCCCAGAGAGGTGG + Intronic
1168108385 19:54178560-54178582 GCAACTGAGGCCCCGAGAGGGGG + Intronic
1168128332 19:54299652-54299674 GAAACTGAGGCTCAGAGAAGGGG - Intergenic
1168168510 19:54571598-54571620 GAGTGTGAGGGCCAGTGAGGAGG - Intergenic
1168234529 19:55053724-55053746 GAACGTGTGGCTAAGAGAGGAGG + Intronic
1168351952 19:55680992-55681014 GAAACTGAGGCCCAGAGACGGGG + Intronic
1168469208 19:56627370-56627392 GAAGGTGAGGCCCATAGGTCAGG + Intergenic
925078494 2:1040321-1040343 GCAGGTGAGGGCCAGAGAAGGGG - Intronic
925163250 2:1701567-1701589 GAAGGGGAGCCGCAGAGAAGCGG + Intronic
925252391 2:2451139-2451161 GAAGGTGTCACCCAGTGAGGAGG + Intergenic
925783887 2:7409130-7409152 GAAACTGAGTCCCAGAGAGAAGG + Intergenic
925850304 2:8075299-8075321 GAAGATGAGGCCGGGCGAGGTGG + Intergenic
925966809 2:9074105-9074127 GAAACTGAGGCCCAGGGAAGAGG + Intergenic
926126710 2:10276743-10276765 GAAGGGGAGGCACAGGGTGGCGG - Intergenic
926206172 2:10835526-10835548 GCAGGTGGGGCCCAGGGAGCCGG + Intronic
926694930 2:15764571-15764593 GAAACTGAGGCCCAGAAAGCTGG - Intergenic
926757683 2:16249409-16249431 GAAGGCGAGGCCCTGTGCGGTGG - Intergenic
927125849 2:20012248-20012270 GAAACTGAGGTCCAGAGAAGGGG - Intronic
927149368 2:20186896-20186918 GAAGTTGAGGTTCAGAGAAGGGG - Intergenic
927155787 2:20220421-20220443 GAAGCTGAGGCCTAGGGTGGCGG - Intronic
927197899 2:20560657-20560679 GAAACTGAGGCCCAGAGAGAAGG + Intronic
927351549 2:22123171-22123193 GAAGGTGAGGCATAGAGACGAGG - Intergenic
927507656 2:23624939-23624961 GAAGCAGGGGCTCAGAGAGGTGG + Intronic
927639542 2:24838068-24838090 CAGGGAGAGGCTCAGAGAGGAGG - Intronic
927642671 2:24855370-24855392 GAATGTGCTGCCCTGAGAGGTGG + Intronic
927881037 2:26690265-26690287 GAAACTGAGGCCCAGACAGTAGG - Intergenic
927966251 2:27271055-27271077 GAAAGTGCAGCCCAGAAAGGCGG - Intronic
928171777 2:29009087-29009109 CAAGGTGAAGTTCAGAGAGGTGG + Intronic
928270242 2:29849113-29849135 GAAGGTGATGCTTAGAGAGGTGG - Intronic
928906459 2:36373355-36373377 GAAGGAGAGAACCAGAGAAGTGG + Intronic
929023122 2:37574055-37574077 GAAACTGAGGCCCAGAGAGATGG - Intergenic
929664479 2:43823030-43823052 GATGGTGAGGACCAGCTAGGGGG + Intronic
929736517 2:44555737-44555759 AAAGGTAATGCCCAAAGAGGAGG + Intronic
929814778 2:45221874-45221896 GAAACTGAGGCCCAGAGAAGAGG - Intergenic
929855976 2:45639092-45639114 TAAGGTGAGGCCCACAGAATGGG + Intergenic
930033782 2:47073365-47073387 GAAACTGAGGGCCAGAGAGCTGG + Intronic
930707889 2:54522187-54522209 AAAGGTTAGGCCAAGAGTGGTGG - Intronic
931749229 2:65316426-65316448 GAAGCTGAGGCTTAGAGAGGTGG - Intronic
932141582 2:69283158-69283180 GAAACTGAAGCTCAGAGAGGTGG - Intergenic
932281069 2:70492300-70492322 GAAGGTGGAGCCCAGAGGAGAGG + Intronic
932409107 2:71534807-71534829 GAAGGTCAGACCCAGAGCTGGGG - Intronic
932626531 2:73300864-73300886 GAGGGCCAGGCCCAGAGAAGAGG + Intergenic
932700440 2:73987718-73987740 AAAAGACAGGCCCAGAGAGGGGG - Intronic
932803605 2:74764405-74764427 GGAGATGAGGCACAGAGAGGAGG + Intergenic
933305285 2:80589482-80589504 CAAGGTGAGGCCCAGAGCCAGGG + Exonic
934062464 2:88307917-88307939 GAAACTGAGACTCAGAGAGGAGG + Intergenic
934474953 2:94587606-94587628 GAAACTGAGGCCCAGAGAGAAGG - Intergenic
935180889 2:100690482-100690504 GAAACTGAGGCACAGAGAGAGGG + Intergenic
935663882 2:105493673-105493695 GAGGATGAGGCTGAGAGAGGAGG + Intergenic
935880514 2:107560134-107560156 GAAGGTTAGCCCCAGTGAAGTGG - Intergenic
935923954 2:108047262-108047284 GAAGGAGAGGGACAAAGAGGAGG - Intergenic
936058659 2:109280308-109280330 GAAACTGAGGCCCAGAGAGGGGG + Intronic
936919114 2:117669710-117669732 GAAGGCAAGACCCAGAGGGGAGG - Intergenic
937216364 2:120316090-120316112 GAAACTGAGGCCCTGTGAGGTGG + Intergenic
937900674 2:127016686-127016708 GAGAATGAGGGCCAGAGAGGAGG - Intergenic
937957172 2:127427940-127427962 GGCAGTGAGACCCAGAGAGGAGG - Intronic
938690119 2:133779979-133780001 GAAGGTGAGGGGGAGGGAGGGGG + Intergenic
939214290 2:139216114-139216136 GAAACTGAGGCTTAGAGAGGAGG - Intergenic
941621846 2:167787783-167787805 AAAGGTCAGGAGCAGAGAGGAGG + Intergenic
941855500 2:170226725-170226747 GCATGTGAGGCCCAGAGCAGAGG + Intronic
942141024 2:172977664-172977686 TGAGGTGAGTCCCAGGGAGGAGG - Intronic
942525810 2:176851261-176851283 GTAGGTGAGGCCCAGAGCCTTGG - Intergenic
943650981 2:190457254-190457276 GAAGGAGAGGGCCACAGGGGTGG - Intronic
944478262 2:200128601-200128623 GAGGGTCAGGTCAAGAGAGGAGG + Intergenic
944498357 2:200331641-200331663 GAAATTGAGGCACAGAGAGGGGG - Intronic
945891508 2:215435921-215435943 GAAGGTGGGGGCCAGAGGGTGGG + Exonic
946042692 2:216796026-216796048 GAAGATGTGGCCAAGAGTGGAGG + Intergenic
946069328 2:217017965-217017987 GAAGATGAGGTTGAGAGAGGGGG + Intergenic
946194185 2:218023312-218023334 GAAGTTGAGGCCCAGGAAGGTGG - Intergenic
946333119 2:219021539-219021561 GAAGCTGAGGCTCAGAGGTGGGG + Intronic
946471098 2:219961909-219961931 GAAACTGAGACCCAGAGAGAAGG - Intergenic
946951142 2:224876716-224876738 GAAGGTGAGTTTCAGAAAGGAGG - Intronic
947107398 2:226681775-226681797 CAATGTGAGGCCAACAGAGGAGG + Intergenic
947353771 2:229271820-229271842 GAAGGTAAGCTCCAGAGAGAAGG - Intergenic
947752156 2:232538803-232538825 GAAAGGGAAGCCCAGTGAGGGGG + Intergenic
947752180 2:232538883-232538905 GAAAGGGAAGCCCAGTGAGGGGG + Intergenic
947752205 2:232538963-232538985 GAGGGGGAGGCCGAGTGAGGGGG + Intergenic
947752210 2:232538979-232539001 GAGGGGGATGCCCAGTGAGGGGG + Intergenic
948136894 2:235643087-235643109 GAAACTGAGGCTCAGAGAGGGGG + Intronic
948483510 2:238265073-238265095 GAGGGGGAGACCCAGAGAGAGGG + Intronic
948570116 2:238912572-238912594 GGCGGTGATGCCCGGAGAGGCGG - Intergenic
948775292 2:240284870-240284892 GAAACTGAGGCCCAGATATGAGG + Intergenic
948844709 2:240677501-240677523 GGAGGGCAGGCCCAGGGAGGCGG + Intronic
948849151 2:240697378-240697400 GGAGGGCAGGCCCAGGGAGGCGG - Intronic
948884562 2:240876265-240876287 GTAAGTGAGGCCCAGTGAGTGGG + Intronic
1168760975 20:349254-349276 GAAACTGAGACCCAGAAAGGTGG + Exonic
1168769239 20:404085-404107 GAAACTGAGGCCCAGATAGGGGG + Intergenic
1168891404 20:1297263-1297285 CAGGGCCAGGCCCAGAGAGGAGG - Intronic
1168936888 20:1673353-1673375 TAGGATGAGGCTCAGAGAGGAGG + Intergenic
1168951116 20:1802982-1803004 GAAGCTGAGGCCTCCAGAGGCGG + Intergenic
1168953871 20:1820723-1820745 GAAACTGAGGCTCAGAGAGGGGG + Intergenic
1168972531 20:1940390-1940412 GAAAGTGAGGCCCCAGGAGGAGG - Intronic
1168973008 20:1943696-1943718 AAAATTGAGGCTCAGAGAGGTGG + Intergenic
1169270486 20:4195542-4195564 GAAGGAGAGGCCCAGGAAGGTGG - Intergenic
1169333967 20:4739866-4739888 GAAGGTGAGGCCGGGTGCGGTGG - Intronic
1169356658 20:4912627-4912649 TAAGGTGAGAACCATAGAGGAGG - Intronic
1169678391 20:8181005-8181027 GATTGGGAGGCCGAGAGAGGCGG + Intronic
1170722835 20:18899576-18899598 GAAACTGATGCTCAGAGAGGTGG + Intergenic
1170823368 20:19772785-19772807 GAAACTGAGGCACAGAGAGATGG + Intergenic
1170824680 20:19783531-19783553 GGAGGTGAGGCCCTGAGCTGGGG + Intergenic
1171028738 20:21656739-21656761 GAAGCTCAGTCCCAGAGTGGTGG - Intergenic
1171192641 20:23170186-23170208 GAATGTAAGACCCAGAAAGGGGG - Intergenic
1171309474 20:24134935-24134957 GAAAGGGAGGCCCTGAGAGCCGG - Intergenic
1171781470 20:29422573-29422595 GCAGGTGGGGCCTGGAGAGGAGG - Intergenic
1172019626 20:31904867-31904889 GAAGCTGAGGCCCAGAGAAGAGG + Intronic
1172097650 20:32468109-32468131 GAAGCTGTGGCCCAGAGTTGGGG + Intronic
1172178141 20:32984943-32984965 GAAACTGAGGCTCAGAGAGTAGG - Intronic
1172182844 20:33014100-33014122 GACACTGAGGCTCAGAGAGGGGG + Intronic
1172188210 20:33044704-33044726 GAGATTGAGGCTCAGAGAGGTGG + Intergenic
1172248911 20:33465276-33465298 GAAACTGAGGCCTAGAGTGGAGG - Intergenic
1172318067 20:33971809-33971831 GAAATTGAGGCTCAGAGAGCTGG - Intergenic
1172429139 20:34876007-34876029 GTGGGTGTGGCTCAGAGAGGGGG + Intronic
1172502242 20:35435608-35435630 GCAGATGAGGCACAGAGATGGGG + Intronic
1172502362 20:35436478-35436500 GAAACTGAGGCCCTGAGAGGGGG + Intronic
1172600663 20:36180401-36180423 GAAGCAGGGGCCCAGAGGGGTGG - Intronic
1172631027 20:36378243-36378265 GAAAAAGAGGCTCAGAGAGGTGG - Intronic
1172633331 20:36393364-36393386 GAAGCTGAGGCCCAGCAAAGAGG - Intronic
1172657480 20:36545998-36546020 GAAACTGAGGCCTAGAGGGGCGG + Intronic
1172694004 20:36809233-36809255 GAAACTGATGCCCAGAGAGCTGG - Intronic
1172698620 20:36839088-36839110 GAAACTGAGGCCCAGAGAGGTGG + Intronic
1172767902 20:37360880-37360902 GCAGTGGAGGCACAGAGAGGTGG + Intronic
1172768656 20:37364288-37364310 GAAACTGAAGCACAGAGAGGCGG - Intronic
1172800465 20:37572873-37572895 GAAAATGAGGCACAGAGAGATGG + Intergenic
1172810670 20:37645632-37645654 AAAGCTGAGGCTCAGAGAGAGGG - Intergenic
1172878445 20:38180906-38180928 GAAGGGGAGGAGCAGAGAGAGGG - Intergenic
1172883919 20:38218849-38218871 TAAACTGAGGCCCAGAAAGGGGG - Intronic
1172898813 20:38319272-38319294 GAACCTGAGGCTCAGAGAGTAGG + Intronic
1173116203 20:40245498-40245520 GAAGGTGGGGCAAAGAGCGGTGG + Intergenic
1173185394 20:40836449-40836471 GAAACTCAGGCTCAGAGAGGTGG + Intergenic
1173224455 20:41154119-41154141 GAAAATGAGGCTCAGAGAGATGG + Intronic
1173265897 20:41480289-41480311 GAAGGTATGGCCTAGAGAAGAGG + Intronic
1173525870 20:43732073-43732095 CAAGGGGTGGCCCACAGAGGTGG - Intergenic
1173555192 20:43960938-43960960 GAAACTGAGGCCTAGAAAGGGGG + Intronic
1173614460 20:44393792-44393814 GAAACTGAGGCTCAGAGAGGTGG + Intronic
1173675522 20:44831683-44831705 GAAGCTGAGTCCCAAGGAGGTGG + Intergenic
1173733846 20:45346141-45346163 AAAAGTGAGGCCCAGGGAGAAGG - Intronic
1173841546 20:46160680-46160702 GAAACTGAGGCTCAGAGAGGTGG - Intergenic
1173903130 20:46605605-46605627 GAAACTGAGGCCTAGAGAGGTGG + Intronic
1174193898 20:48759174-48759196 ATAGATGAGGCCCAGAGAGATGG - Intronic
1174195034 20:48766978-48767000 GAAACTGAGGCCCAGAGAGGAGG - Intronic
1174208871 20:48861275-48861297 GAAACTGAGGTCCAGGGAGGTGG - Intergenic
1174272690 20:49381112-49381134 GAAATAGAGGCTCAGAGAGGGGG - Intronic
1174280516 20:49435626-49435648 GAAAGGGAGACTCAGAGAGGTGG - Intronic
1174304884 20:49608137-49608159 CAAGCTGAGGCTCGGAGAGGTGG - Intergenic
1174360654 20:50027201-50027223 GAAACTGAGGCCCAGAGAGGTGG + Intergenic
1174423681 20:50417077-50417099 GACGCTGAGGCTCAGAGAGCTGG + Intergenic
1174423748 20:50417494-50417516 GAAACTGAGGCACAGAGAGAGGG + Intergenic
1174423756 20:50417564-50417586 GAAACTGAGGCACAGAGAGAGGG + Intergenic
1174494114 20:50927681-50927703 TAAGGTGAGGCCAGGTGAGGTGG - Intronic
1174874085 20:54208564-54208586 GAAACTGAGGCCCAGAGATGGGG + Intronic
1175091965 20:56512173-56512195 GAAACTGAGGCCCAGAGAAGTGG + Intronic
1175161733 20:57012880-57012902 AAAACTGAGGCTCAGAGAGGTGG + Intergenic
1175180482 20:57143025-57143047 GAAACTGAGACCCAGAGAGCCGG - Intergenic
1175261884 20:57679877-57679899 AAAGGACAGGGCCAGAGAGGGGG + Intronic
1175263043 20:57686684-57686706 GGCCTTGAGGCCCAGAGAGGGGG - Intronic
1175312234 20:58019909-58019931 GAAACTGAGGCTCAGAGGGGTGG - Intergenic
1175414880 20:58794692-58794714 GACTGTGTAGCCCAGAGAGGGGG + Intergenic
1175420343 20:58828516-58828538 GAAACTGAGGCTTAGAGAGGTGG - Intergenic
1175430863 20:58902123-58902145 GAAACTGAGGCCAAGAGGGGGGG - Intronic
1175531213 20:59675064-59675086 GAAGGGGAGGAAAAGAGAGGGGG - Intronic
1175585015 20:60132319-60132341 CAGGGAGAGGCCCACAGAGGTGG + Intergenic
1175776801 20:61658820-61658842 GTGGGTGAGGCCGAGGGAGGAGG + Intronic
1175965205 20:62656909-62656931 GAAGGTGAGGCAGAGGCAGGCGG - Exonic
1176053872 20:63134633-63134655 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176053878 20:63134651-63134673 GGAGGCAGGGCCCAGAGAGGAGG + Intergenic
1176053895 20:63134686-63134708 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176053904 20:63134704-63134726 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176053944 20:63134793-63134815 GGAGGCAGGGCCCAGAGAGGAGG + Intergenic
1176053993 20:63134899-63134921 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054032 20:63134987-63135009 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054135 20:63135234-63135256 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054141 20:63135252-63135274 GGAGGCAGGGCCCAGAGAGGAGG + Intergenic
1176054158 20:63135287-63135309 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054199 20:63135375-63135397 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054208 20:63135393-63135415 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054255 20:63135499-63135521 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176054288 20:63135570-63135592 GGAGGCGGGGCCCAGAGGGGAGG + Intergenic
1176091335 20:63319859-63319881 GAAGCCGAGGCCCAGCAAGGGGG + Intronic
1176510772 21:7745755-7745777 GAGGGGTAGGTCCAGAGAGGGGG - Intronic
1177579399 21:23000514-23000536 GGATATGAGGCCAAGAGAGGTGG - Intergenic
1177895637 21:26853715-26853737 GAAACTGAGACCCAGAGAGTTGG - Intergenic
1178410584 21:32360319-32360341 AAAGGAGAAGCCCAGAGAGCCGG - Intronic
1178644885 21:34376284-34376306 GAGGGGTAGGTCCAGAGAGGGGG - Intronic
1178755705 21:35347467-35347489 AAAGGTGAGGGGCTGAGAGGGGG - Intronic
1178826629 21:36022727-36022749 TAAACTGAGGCCCAGAGAGCAGG - Intergenic
1179194548 21:39153005-39153027 GAAGAAGATGCCGAGAGAGGGGG - Intergenic
1179321866 21:40300062-40300084 GAAGGAGAGGGCCACAGTGGGGG - Intronic
1179572485 21:42286039-42286061 AAAAGTGAGACCCACAGAGGAGG - Intronic
1180058568 21:45373353-45373375 AAAGGTGGGACCCAGAGAGTGGG + Intergenic
1181063282 22:20292169-20292191 GAAACTGAAGCTCAGAGAGGAGG - Intergenic
1181080096 22:20408129-20408151 GAAGCTGAAGCCCAGGGAGACGG + Exonic
1181422334 22:22810646-22810668 GAAGGAGAGGCAGAGGGAGGAGG - Intronic
1181730429 22:24842341-24842363 GAAACAGAGGCCCAGAGAGGTGG - Intronic
1181773846 22:25145573-25145595 GAATCTGAGGCCCAGGGAAGGGG - Intronic
1181791070 22:25266989-25267011 AAAACTGAGGCCCAGAGAGGTGG + Intergenic
1181826882 22:25524019-25524041 AAAACTGAGGCCCAGAGAGGTGG + Intergenic
1181859070 22:25804441-25804463 GCAGTTGTGGCTCAGAGAGGTGG + Intronic
1181908343 22:26217648-26217670 AAGAGTGAGGCCCAGAGTGGGGG - Intronic
1181986488 22:26803478-26803500 GAAAATGGGGCTCAGAGAGGAGG + Intergenic
1181996135 22:26884166-26884188 GAAACTGAGCCCCAGAAAGGTGG - Intergenic
1182045928 22:27274052-27274074 GGAGGTGGGGGCCAGGGAGGGGG + Intergenic
1182102929 22:27670533-27670555 GAAACTGAGGCTCAGAGAGGAGG + Intergenic
1182274202 22:29174997-29175019 GAAGGTGAGGCTGGGCGAGGTGG - Intergenic
1182299457 22:29329600-29329622 TGAGGTGAGGCCAAGAGATGAGG + Intronic
1182306847 22:29375720-29375742 GAAAGGCAGGCCCAGAGATGGGG - Intronic
1182416510 22:30224726-30224748 GGAACTGAGGCTCAGAGAGGTGG + Intergenic
1182417014 22:30227890-30227912 GAAATGGAGGCCCAGAGAAGTGG - Intergenic
1182428169 22:30285782-30285804 GAGAGTGAGGCCCAGAAATGTGG - Intronic
1182737232 22:32539609-32539631 CAAGGAGTGGGCCAGAGAGGGGG + Intronic
1182766711 22:32762791-32762813 GAAGCTGAGGCTCAGAAAGAAGG - Intronic
1182768445 22:32775729-32775751 GAAACTGAGGCTCTGAGAGGTGG - Intronic
1182830602 22:33302021-33302043 GAAGAAGAGTCCCAGAGGGGTGG + Intronic
1183032393 22:35115976-35115998 GAGAATGAGGCCTAGAGAGGTGG - Intergenic
1183036381 22:35143911-35143933 GAAACTGAGGCCCAGAGAAGGGG - Intergenic
1183074041 22:35415513-35415535 CAAACTGAGGCCCAGAGAAGAGG - Intronic
1183084297 22:35477169-35477191 GAAACTGAGGCCCAGAGAGTGGG + Intergenic
1183164810 22:36139662-36139684 GAAACTGAGGCTCAGAGAGGCGG + Intergenic
1183171091 22:36188786-36188808 GAAACTGAGGCTCAGAGAGATGG + Intergenic
1183180045 22:36253801-36253823 AGAGGTGAGGGCCAGAGACGTGG - Intronic
1183209643 22:36442972-36442994 GAGGGTGGGGCCCAGTGAGCTGG - Intergenic
1183302480 22:37065152-37065174 GAAACTGAGGCTCAGAGAGGCGG - Intergenic
1183332539 22:37229189-37229211 GAGACTGAGGCCCGGAGAGGGGG - Intronic
1183345556 22:37305629-37305651 GAAAGTGAGGCCCAGACAGAAGG - Intronic
1183367517 22:37415030-37415052 GAAACTGAGGCCCAGAAAGGTGG + Intronic
1183388146 22:37526811-37526833 GAAAATGGGGCCCAGAAAGGAGG - Intergenic
1183388176 22:37526930-37526952 GAGACTGAGGCCCAGAGAGAGGG - Intergenic
1183395116 22:37567066-37567088 TCAGCTAAGGCCCAGAGAGGGGG - Intronic
1183467565 22:37987307-37987329 GAAGATGGGCCCCAGAGAGGAGG + Intronic
1183474075 22:38026404-38026426 GAAACTGAGACCCAGAGAGATGG - Intronic
1183505259 22:38205229-38205251 AAAACTGAGGCCCAGAGAGAGGG + Intronic
1183674358 22:39291364-39291386 AAAACTGAGGCCCAGAGAGGGGG - Intergenic
1183723564 22:39576150-39576172 AAAACTGAGGCTCAGAGAGGGGG - Intronic
1183724743 22:39582239-39582261 GAAACTGAGACCCAGAGAGGAGG - Intronic
1184008675 22:41730289-41730311 GAAACTGAGTCCCAGAGAAGAGG - Intronic
1184090262 22:42289565-42289587 GAAACTGAGGCCCTGAAAGGTGG + Intronic
1184104560 22:42359934-42359956 GCAACTGAGGCCCAGAGAGAGGG + Intergenic
1184297218 22:43532421-43532443 GAAACTGAGGCCCAGGGAGGCGG + Intronic
1184336019 22:43853689-43853711 GAAACTGAGGCCCAGAGGAGCGG - Intronic
1184350641 22:43941455-43941477 GAAGCTGCAGCACAGAGAGGTGG - Intronic
1184365602 22:44049160-44049182 GAAACTGAGGCCCTGAGAGAGGG + Intronic
1184547250 22:45179595-45179617 GAAAGTGAGGCCAGGTGAGGTGG + Intronic
1184587948 22:45460488-45460510 GAAGGAGAGGCCCACAGTGGGGG - Intergenic
1184594332 22:45504606-45504628 GAAGCTGAGGGCCTGAGAGAAGG + Intronic
1184604365 22:45563674-45563696 GAAACTGAGGCCCAGAGAGAAGG + Intronic
1184661019 22:45965528-45965550 GAAACTGAGGCCCAGAGAAGGGG + Intronic
1184684919 22:46091910-46091932 GAAGCTGAGGCTCAGAGCCGGGG - Intronic
1184799184 22:46749821-46749843 GAAGGTGATGCTCAGAGAGGGGG + Intergenic
1184879535 22:47296219-47296241 GAAACTGAGGCCCAGAGGGATGG - Intergenic
1184945042 22:47796698-47796720 GCAGGAGAGGCCTAGAGAGGTGG + Intergenic
1185188588 22:49418320-49418342 GAAGTGGAAGGCCAGAGAGGAGG + Intronic
1185231514 22:49686758-49686780 GCAGGTGAGGACCACAGAGCAGG + Intergenic
949315634 3:2751562-2751584 GAAGATAAGGCCTAAAGAGGAGG + Intronic
949773134 3:7600603-7600625 GAAACTGATGCCCAGAGAGGAGG - Intronic
949898797 3:8792868-8792890 GAAGATGTAGCCAAGAGAGGTGG - Intronic
950032367 3:9861547-9861569 GAAGTTGAGCTCCAGAGAAGAGG + Intergenic
950034835 3:9877901-9877923 GAGAGTGAGGCCAAGACAGGTGG - Intronic
950098820 3:10345167-10345189 GGACATGAGGCTCAGAGAGGTGG - Intronic
950106290 3:10391196-10391218 GAAACTGAGGCTCAGAGTGGAGG + Intronic
950128704 3:10527350-10527372 GAAACTGAGGCACAGAGAGATGG + Intronic
950198918 3:11029034-11029056 GAAACTGATGCCCAGAGGGGAGG + Intronic
950207112 3:11089226-11089248 GAAACTGAGGCTCAGAGACGTGG + Intergenic
950396089 3:12735126-12735148 GAAAATGAGGCTCAGAGAGGTGG - Intronic
950434757 3:12972676-12972698 GAAACTGAGGTCCAGAGAGGTGG + Intronic
950554162 3:13685190-13685212 GAAACTGAGGCCCAGAGATGGGG - Intergenic
950556115 3:13696986-13697008 GGAGATGAGGCCCAGATGGGTGG - Intergenic
950568480 3:13785876-13785898 GAAGCTGAGGCCCAGGGAGGGGG + Intergenic
950649667 3:14399480-14399502 GAAACTGAGGCTCAGAGAGCAGG + Intergenic
950657831 3:14448031-14448053 GAAACTGAGGCTCAGAAAGGAGG - Intronic
950659740 3:14459762-14459784 GAAACTGAGGCTCAGAGAGGAGG - Intronic
950702540 3:14760132-14760154 GTGGCTGAGGCCCAGAGAGCAGG + Intronic
950790621 3:15468814-15468836 GAAGCTGAGGGCCAGGGAGGTGG - Intronic
950809051 3:15633672-15633694 GAAACTGAGGCCAGGAGAGGAGG - Intronic
950838024 3:15939378-15939400 GAAACTAAGGCCCAGGGAGGAGG + Intergenic
950858273 3:16125571-16125593 AAAAGTGGGCCCCAGAGAGGAGG - Intergenic
951477737 3:23126360-23126382 GCAGGTAAGGCCCAGCGATGTGG + Intergenic
952769220 3:36982531-36982553 GAAATTGGGCCCCAGAGAGGTGG - Intergenic
952839124 3:37629457-37629479 AAAAGGGAGACCCAGAGAGGAGG - Intronic
952872807 3:37916881-37916903 GAAACTGAGGCCTAGAGAGGAGG + Intronic
952884348 3:38003352-38003374 GGAATTGAGGCCCAGAGAGGAGG + Intronic
952994673 3:38867812-38867834 GGAGGTGAGGCCACCAGAGGAGG + Intronic
952997004 3:38894341-38894363 GCAGGTGTGGCACAGATAGGAGG - Intronic
953073436 3:39546214-39546236 AAAATTGAGGCCTAGAGAGGCGG + Intergenic
953344700 3:42165605-42165627 GAATGTCAGCCCCAGAGAAGGGG + Intronic
953627853 3:44585381-44585403 GAACCTGGGGCCCAGAGAAGAGG + Intronic
953679534 3:45029063-45029085 GAACCTGAGGCTCAGAGAGTGGG + Intronic
953907194 3:46874344-46874366 GAAACTGAGGCCCAGAGATTTGG + Intronic
953979379 3:47406086-47406108 GAAGGGGATGGCCAGGGAGGGGG + Intronic
954416987 3:50398088-50398110 GAAACTGAGGCCCAGAGGCGAGG + Intronic
954437050 3:50502007-50502029 GAGAGAGAGACCCAGAGAGGCGG + Intronic
954664876 3:52246293-52246315 CAAGATGAGGCCCAGAGACTCGG + Exonic
955239465 3:57166116-57166138 GAAACTGAGGCTCAGAGAAGTGG + Intronic
955475747 3:59334135-59334157 GAAACTGAGGCTCAGAGAGAAGG + Intergenic
956148892 3:66220909-66220931 CTAGGGGAGGGCCAGAGAGGAGG - Exonic
956705222 3:71993781-71993803 AGAGGTGAGGCCCAGAAAAGTGG + Intergenic
956765176 3:72478746-72478768 GAAGATCAGCCCCAGAGAGGGGG - Intergenic
956785801 3:72641272-72641294 AAAACTGAGGCCCAGGGAGGCGG + Intergenic
957042175 3:75344148-75344170 GAATGTGAGGAAAAGAGAGGGGG + Intergenic
957207753 3:77219259-77219281 GAAGTCGAGGCCCAGTGCGGTGG - Intronic
959821730 3:110743192-110743214 AAAGGTGATGGCCAGAAAGGTGG + Intergenic
959980303 3:112508449-112508471 GAAGGTGAGGGATAGAGATGGGG + Intergenic
960164401 3:114385378-114385400 GAAAATGAGGCTCAGAGATGCGG - Intronic
960342855 3:116496904-116496926 GAAGGTCCCGCCCAGTGAGGAGG - Intronic
960365532 3:116767013-116767035 AAAGGTGAGGCCCAGGAAGCAGG - Intronic
960483399 3:118221376-118221398 GAATTTGAGGCCAAGAGAGAAGG + Intergenic
960710334 3:120521206-120521228 GAAGCTGTGGCATAGAGAGGTGG + Intergenic
961238894 3:125392796-125392818 GAAACTAAGGCCCAGAAAGGTGG - Intergenic
961379529 3:126487973-126487995 GCAGGGGAGACCCAGAGAGGTGG + Intronic
961381695 3:126499880-126499902 GATGCTGAGGCCCAGCCAGGTGG - Intronic
961434618 3:126908287-126908309 GAGGGTGGGGCCAAGATAGGTGG - Intronic
961475673 3:127144959-127144981 GAAGTTGAGCCTCAGAAAGGGGG - Intergenic
961480041 3:127173668-127173690 GAAACTGAGGCACAGAGAGAGGG - Intergenic
961642432 3:128373102-128373124 CAAGATGAGGCCCTGAGAAGTGG + Intronic
961821736 3:129578763-129578785 AAAGGTGAGGCCCAGAGACAGGG - Intronic
961997513 3:131261585-131261607 GGAAGTGAGACCCAGGGAGGTGG + Intronic
962169734 3:133088258-133088280 GCAGGAAAGGCCCACAGAGGTGG + Intronic
962355089 3:134686826-134686848 GAAACTGAGGCCCAAAGAGATGG + Intronic
962402647 3:135074704-135074726 GAAACTGAGGCCCAGAGGGGAGG - Intronic
962528297 3:136255328-136255350 GAAGGAGAAGCCCACAGAGGAGG + Intronic
962606425 3:137036185-137036207 GACACTGAGGCCCAGAGAGATGG + Intergenic
962752748 3:138445842-138445864 AAAGCTGAGGCTTAGAGAGGTGG + Intronic
962874928 3:139528582-139528604 GAAGTGAAGGCTCAGAGAGGTGG - Intronic
963006522 3:140731491-140731513 GAAACTGAGGCTCAGAGAAGTGG + Intergenic
963496003 3:146061925-146061947 TAAGGTGAGGCATAGAGGGGTGG + Intergenic
964392540 3:156212699-156212721 GAAGGGTAGGCACAGAGGGGAGG + Intronic
964538382 3:157751740-157751762 GAAACTGAGGCTCAGAGAGCTGG + Intergenic
965512969 3:169589499-169589521 GAAACAGAGGCCCTGAGAGGTGG - Intronic
965711859 3:171563587-171563609 GCAGGAGAGGCCCAGAGGGAGGG - Intergenic
966109755 3:176385187-176385209 GAAATTGAGGCCCAGAGAAGTGG + Intergenic
966605938 3:181821763-181821785 GAAGATGAGGCCAAGAGTGTAGG + Intergenic
966642943 3:182210619-182210641 AAAGGTGAGAACCAGAGAGAAGG + Intergenic
967067739 3:185935520-185935542 AAAGGTGGGGCACAGAGGGGTGG + Intronic
967139277 3:186540373-186540395 GAAGCTGAAGCTCAGAGAGGTGG - Intronic
967259423 3:187627294-187627316 GAAATTGAGGCCCAGAAGGGAGG + Intergenic
967316372 3:188154635-188154657 GCAGCTGAGGCCCAGAGAGAAGG + Intronic
967679039 3:192338324-192338346 AAAGGGGAGGCCGAGACAGGTGG - Intronic
967811714 3:193766285-193766307 GATGATGAAGCCAAGAGAGGTGG + Intergenic
967883360 3:194316945-194316967 GAAACTGAGGCCCAGAGAAGGGG + Intergenic
968007232 3:195251344-195251366 GAAGGCGGGGCCCAGCCAGGTGG + Intronic
968270011 3:197396207-197396229 GAAGGTGAGGCCGGGCGCGGTGG + Intergenic
968641680 4:1717936-1717958 GAAGGGGAGGCCAAGAGTGCAGG + Intronic
968813428 4:2810149-2810171 GAAGCTAAGGCCCAGAGAGGAGG + Intronic
968982004 4:3855335-3855357 GAAACTGAGGCCCAGGGAGCTGG + Intergenic
969118610 4:4890088-4890110 GAAACTGAGGCTCAGAGAAGTGG - Intergenic
969190136 4:5511853-5511875 GAAACTGAGGCACAGAGATGAGG + Intergenic
969276102 4:6136949-6136971 GAAACTGAGGCTCAGGGAGGTGG + Intronic
969410633 4:7025716-7025738 CAAAGGGAGGCCCAGAGAGGAGG + Intronic
969457321 4:7307468-7307490 GAAACAGAGGCTCAGAGAGGAGG + Intronic
969457587 4:7308934-7308956 GTAGGAGAGGGCCAGAGAGCAGG - Intronic
969659795 4:8519906-8519928 GAAACTGAGGCCCAGAGAAAAGG - Intergenic
969722099 4:8897829-8897851 GACGCAGAGTCCCAGAGAGGTGG + Intergenic
969725341 4:8915142-8915164 GAAGCTGAGGCCCAGAGCACTGG - Intergenic
969865464 4:10074162-10074184 GAAGGGAAGCCCCAGAGAAGGGG - Intergenic
970359965 4:15299295-15299317 GAAAATGAGGTTCAGAGAGGTGG - Intergenic
971151052 4:24031915-24031937 GAAGCTGAAGCCCAGAGAGGGGG + Intergenic
972200826 4:36713085-36713107 TATGGAGAGGCCCAGAGAGCAGG - Intergenic
972342335 4:38163081-38163103 GAAACTGAGGCCCAGAGATATGG - Intergenic
972687475 4:41364971-41364993 GGTGGTGAGGCCAAGAGAAGCGG - Intronic
972880836 4:43419553-43419575 GAAGGGAGGGTCCAGAGAGGAGG - Intergenic
973626675 4:52779409-52779431 GAAGGTAAGGCCCAGAGAGGTGG - Intergenic
973766753 4:54169931-54169953 GAGGGTGAGGCCAAGACAGGCGG - Intronic
975461719 4:74661105-74661127 GAAAGTAAGGCACAGAGAAGTGG - Intergenic
975816792 4:78225395-78225417 GAACCAGAGGCCCAGGGAGGCGG + Intronic
975892519 4:79046589-79046611 GAAAGGGAGGCCCTGAGAGCTGG + Intergenic
976541948 4:86288094-86288116 GAAGCTGAGGTCCAGAGAGGTGG - Intronic
977361929 4:96016242-96016264 GCAGGTGATAACCAGAGAGGTGG + Intergenic
978194284 4:105952922-105952944 GAAGGGGAGGCCGAGGCAGGTGG + Intronic
978635646 4:110802460-110802482 GAAGGTGGGGCAGAGGGAGGAGG + Intergenic
979152776 4:117341492-117341514 GGAGGTCAGACCCAGTGAGGAGG + Intergenic
979533975 4:121798782-121798804 GAAGGTGAGGCCAGGTGCGGTGG + Intergenic
980880010 4:138700505-138700527 GTGACTGAGGCCCAGAGAGGTGG - Intergenic
980991346 4:139741037-139741059 GATGCTGAGGCTCTGAGAGGAGG + Intronic
981266256 4:142787261-142787283 GGAGGTGAGGCCTAGTGAGAGGG + Intronic
981578923 4:146232851-146232873 GAAGATGAGGCTCAGAGACCTGG - Intergenic
981922003 4:150096073-150096095 GAGGGTGAGGCCCAGACATGGGG + Intronic
982073218 4:151713887-151713909 GAAACTGAGGCTTAGAGAGGTGG - Intronic
982560131 4:156919595-156919617 GAAGCTGAGGACCAGAGAGATGG + Intronic
983473704 4:168188468-168188490 AATGGTGAGAACCAGAGAGGCGG + Intergenic
984652038 4:182280738-182280760 GTAGATGATGCCCAGAGAAGTGG - Intronic
984702988 4:182830258-182830280 GCAGGTGAAAGCCAGAGAGGGGG - Intergenic
984750161 4:183264548-183264570 GAAGGGGAGACCAAAAGAGGTGG + Intronic
985105335 4:186493859-186493881 GAAGGAAAGGCCCAGAAAGGAGG - Intronic
985511758 5:317651-317673 GAAGGAGAGGCCCCCAGAGATGG - Intronic
985872670 5:2569808-2569830 GAAGCTGAGGAGCAGAGATGAGG + Intergenic
985976036 5:3419822-3419844 GAAGGAGAGGTCCAGTGAGGAGG + Intergenic
986649646 5:9950299-9950321 GAAGAGGAGACCAAGAGAGGAGG + Intergenic
986709233 5:10476012-10476034 GAAGGTGAAGAGCAGGGAGGAGG + Intergenic
986711391 5:10490559-10490581 GCAAGTGAGGGCCAGAGAGATGG - Intergenic
986809507 5:11340802-11340824 GAAACTGAGGCTCAGAGAGGTGG - Intronic
987134905 5:14891393-14891415 GAAGATGAGGCCAGGAGAGGTGG - Intergenic
987138964 5:14926348-14926370 GGAGTTGAGGCCCAGAGAGAAGG + Intergenic
987149094 5:15020848-15020870 GAAGGAGAAGCAGAGAGAGGAGG + Intergenic
987707603 5:21475337-21475359 GAAGTTGAGGCCAGGAGTGGTGG - Intergenic
988043155 5:25912989-25913011 CAAGGTCAGGCACAGAGTGGGGG - Intergenic
989100148 5:37815540-37815562 GAAGATGAGGACCAAGGAGGCGG - Intronic
990319972 5:54620327-54620349 GAAGGAGAGTCACATAGAGGAGG + Intergenic
990451121 5:55932578-55932600 GAAAATGAGGTCCAGAGAAGAGG - Intergenic
990637014 5:57739838-57739860 GAAGCAGAGGCCCAGAGGGAGGG - Intergenic
991425941 5:66491874-66491896 GAGGTTGAGGCGGAGAGAGGAGG + Intergenic
991476542 5:67026853-67026875 TAAGGTGAGGCCCAAAGATAAGG - Intronic
992428772 5:76686794-76686816 GAAGGTGGGGCCAGGAGTGGTGG - Intronic
995287724 5:110410776-110410798 GAAATTGAGGTACAGAGAGGTGG + Intronic
995568170 5:113453257-113453279 CAAGCTGGGGCCCAGAGAAGTGG - Intronic
995802765 5:116017257-116017279 TAAGTTGAGGCTCAGAGAGAAGG + Intronic
996223455 5:120961047-120961069 GGAAGTGAAGCACAGAGAGGAGG - Intergenic
996398239 5:123034448-123034470 GAAGATGGAGCCAAGAGAGGAGG - Intronic
997725225 5:136114501-136114523 GTAGGTGAGGAGCAGAGAGTAGG - Intergenic
997883581 5:137611856-137611878 GGAGGTGAGGCCCAGAACGAGGG + Intergenic
997886730 5:137637118-137637140 AAAGTTGAGACTCAGAGAGGTGG - Intronic
998049484 5:139020073-139020095 GGAGGTGAGACCAAGGGAGGTGG + Intronic
998092756 5:139380744-139380766 AAAGGGGAGGCCCAGAGACCTGG - Intronic
998141267 5:139700916-139700938 GAGGGTGGGGCCAAAAGAGGAGG - Intergenic
998143027 5:139710416-139710438 GAAGCTGAGGCGCAGAGAGGTGG + Intergenic
998206416 5:140159815-140159837 GAAGCTGAGGCTCAGAAAGGTGG - Intergenic
998690606 5:144583622-144583644 GAAGGTGTGGCCCAGAGCCAGGG - Intergenic
998875709 5:146596916-146596938 GAAGGAAAGGTTCAGAGAGGAGG - Intronic
999191341 5:149749762-149749784 GAAACTCAGGGCCAGAGAGGGGG - Intronic
999250151 5:150177734-150177756 GAAAATGAGGCTCAGAGAGGTGG + Intronic
999260082 5:150232881-150232903 GAAACTGAGGCCCAGTGAGGGGG + Intronic
999317653 5:150594560-150594582 GAAACTGAGGCCCAGGGAGAGGG - Intergenic
999389981 5:151182838-151182860 GAAGGTGAGTGGTAGAGAGGGGG - Exonic
999508103 5:152219171-152219193 GAAACTGAGGCCCAGCAAGGGGG + Intergenic
999665094 5:153904574-153904596 CAAGTGGAGGCCCAGAGATGGGG - Intergenic
999762502 5:154713259-154713281 GAATGTGAGGTTCAGAGAGCTGG - Intronic
999931263 5:156435206-156435228 GAAAATGAGGCACAGAAAGGCGG + Intronic
999953947 5:156680190-156680212 GAAACCGAGGCCTAGAGAGGTGG + Intronic
999976127 5:156913815-156913837 GAAACTGAGGCTCAGAAAGGGGG - Intergenic
999983999 5:156985137-156985159 GAAGGTGTCTCCCAGTGAGGAGG - Intergenic
1001017672 5:168156128-168156150 CAGGCTGAGGCTCAGAGAGGTGG + Intronic
1001545118 5:172566180-172566202 GAAGGTGGGGCCAACAGAGCTGG + Intergenic
1001595849 5:172898321-172898343 GAAATTGAGGCCCAGGGAGGTGG + Intronic
1001600259 5:172923826-172923848 GAGCCTGAGGCCCAGAGAGATGG + Intronic
1001608723 5:172983045-172983067 GAAACTGAGGCCCAGGGAAGAGG - Intergenic
1001640134 5:173238132-173238154 CAAAGTGCGGCGCAGAGAGGCGG - Intergenic
1001699366 5:173695704-173695726 GAAACTGAGGCCCGGAGGGGTGG + Intergenic
1001744948 5:174085286-174085308 GAGACTGAGGCTCAGAGAGGTGG + Intronic
1001772634 5:174307699-174307721 GAAACTGAGGCTCAAAGAGGTGG + Intergenic
1001824249 5:174732968-174732990 GAAACTGAGGCACAAAGAGGTGG + Intergenic
1001870638 5:175151293-175151315 GAAGCTGAGTCTCAGAGAAGGGG + Intergenic
1001954145 5:175836888-175836910 GAACATGAGGCCCAGAGTGCAGG + Intronic
1001965630 5:175908099-175908121 GAAACTGAGGCTCAGGGAGGTGG - Intergenic
1002026628 5:176400385-176400407 GAAACTGAGGCCCAGAGACATGG + Intronic
1002251318 5:177931096-177931118 GAAACTGAGGCTCAGGGAGGTGG + Intergenic
1002324181 5:178394714-178394736 GAAACTGAGGCCCAGAGAGATGG + Intronic
1002529232 5:179834071-179834093 GCAGGTGTGACACAGAGAGGGGG + Intronic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1002851673 6:1002452-1002474 GAAGGGGAGACCCAAAGATGGGG + Intergenic
1003005824 6:2380572-2380594 GAGGGCGAGGCCCAGTGAGGTGG + Intergenic
1003078974 6:3005833-3005855 GAGGTTGAGGCACAGAGGGGTGG + Intronic
1003081698 6:3026500-3026522 GAAAGTGAGGCCCGAAGAGGTGG - Intergenic
1003184072 6:3815361-3815383 GGAGGTGAGGCCAAGGGAGGTGG + Intergenic
1003265063 6:4558473-4558495 GAAAGTGAGGCTCAGAGAGCTGG + Intergenic
1003307748 6:4944967-4944989 GAACGTCAGGCCCAGACTGGGGG + Intronic
1003382335 6:5636669-5636691 GAAGGCGAGGCACAGAAATGGGG - Intronic
1003869654 6:10391369-10391391 GCAGGTGGGACCCAGTGAGGGGG + Intergenic
1003882863 6:10494156-10494178 GAAGGTGAGGCCCTGGGAGTTGG - Intronic
1004312494 6:14557754-14557776 GAAACTGTGGCCCAGAAAGGCGG - Intergenic
1004594474 6:17086206-17086228 GAAGATGAAGCCCAGGCAGGGGG - Intergenic
1004643646 6:17539304-17539326 GAAGGCCAGGCCCAGAGGAGAGG - Exonic
1005033000 6:21528906-21528928 GAAGATGAGTCCCAGAGAAGGGG - Intergenic
1005586943 6:27286367-27286389 GAAGGTGATGACAAAAGAGGTGG - Intronic
1005989293 6:30893201-30893223 GAGGGGGAGGCCCAGGGAGAAGG - Intronic
1005990401 6:30898604-30898626 GAAGGTCAGGACCAGAAAGTGGG + Intronic
1006152680 6:31997761-31997783 GAAGGTGAGGGCCAGGGAAGGGG + Exonic
1006158988 6:32030498-32030520 GAAGGTGAGGGCCAGGGAAGGGG + Exonic
1006621989 6:35371808-35371830 CAAGGCCAGGCCCAGAGAGGAGG - Intronic
1006778668 6:36616925-36616947 GAGCCTGAGGCCCAGGGAGGAGG + Intergenic
1006802744 6:36769725-36769747 GAAGCTGAGGCTCAGACGGGAGG - Intronic
1006831181 6:36969194-36969216 GTAGGAGAGCCCTAGAGAGGAGG + Intronic
1006994938 6:38250783-38250805 GAAGTTTAGGCCGAGCGAGGTGG + Intronic
1007105022 6:39277851-39277873 GAAATTGAAGCCCAGAAAGGTGG - Intergenic
1007126128 6:39427105-39427127 GAAGCTGAGGCTTAGAGATGAGG + Intronic
1007389375 6:41541456-41541478 GAAGGAGAGGCACAGTGGGGAGG + Intergenic
1007417117 6:41698186-41698208 GAAACACAGGCCCAGAGAGGTGG + Intronic
1007451853 6:41946134-41946156 GAAACTGAGGCACAGAGAGGTGG - Intronic
1007586111 6:42990641-42990663 GAAGTTGAGGACCACAGAAGAGG + Intronic
1007714846 6:43849886-43849908 GAAAGTGAGGCCCAGAGGGGAGG + Intergenic
1008294651 6:49760928-49760950 GAAGGCAAAGCCCAGGGAGGAGG - Intergenic
1008441842 6:51540635-51540657 AAATTTGAGCCCCAGAGAGGTGG - Intergenic
1008509409 6:52262306-52262328 GAAACTGAGGCACAGAGTGGGGG - Intergenic
1008610804 6:53183081-53183103 GAAGGTGGGTGCCAGAGAGGGGG + Intergenic
1009734627 6:67661205-67661227 GAAAGTGAGGCACAGAATGGGGG + Intergenic
1010119979 6:72364059-72364081 AAAGGAAAGGCCCAGAGTGGAGG - Intronic
1010357717 6:74953923-74953945 GAAGGTGGGGCCCAGAAAGCCGG + Intergenic
1010933865 6:81836861-81836883 GAAACTGAGGGGCAGAGAGGTGG - Intergenic
1011287042 6:85735991-85736013 GAAGGTCAGCCCCAGGGAGCTGG + Intergenic
1012349145 6:98229920-98229942 AAAGATGAGGCCCAGAGAGGAGG - Intergenic
1012914627 6:105156352-105156374 GAAAGTGGGGTCAAGAGAGGGGG - Intergenic
1013119549 6:107129402-107129424 AAAGGAGAGGCCCAGAGTGCGGG + Intergenic
1013368943 6:109454294-109454316 GAAGGGGAGGCGAAGAGAGCAGG + Intronic
1013434111 6:110084365-110084387 AAAGGAAAGGCCCAGGGAGGAGG - Intergenic
1014051648 6:116962265-116962287 GAAGGTGGGGCCCAGTGGGGAGG + Intergenic
1014115158 6:117662005-117662027 TAAGGTGAGAAGCAGAGAGGTGG + Intergenic
1014116890 6:117676082-117676104 CAAGGTGAGGCCCGGTGCGGTGG + Exonic
1014264381 6:119258908-119258930 GAAACTGAGGCACAGAAAGGAGG - Intronic
1015518802 6:134111562-134111584 GAAGCTGAGGCCAAGGCAGGAGG - Intergenic
1015822883 6:137281952-137281974 CAAGGTGAAGCCCAGACAGGGGG + Intergenic
1016386285 6:143533916-143533938 GAATGTGTGCCCCAGAGAGAAGG + Intergenic
1016967414 6:149731798-149731820 GAAGATGATGCCTAGAGATGGGG - Intronic
1017536147 6:155349701-155349723 GAAGGTCCTGCCCAGTGAGGAGG + Intergenic
1017905851 6:158757131-158757153 GAAGGTGGGGTCCAGAGATGGGG + Intronic
1018429625 6:163713140-163713162 GGAGGGGAGGAACAGAGAGGTGG - Intergenic
1018699486 6:166415524-166415546 GTTGGTGAGGCCCTGTGAGGCGG + Intronic
1018830049 6:167435209-167435231 GCTGGTGAGCCCCAGAGCGGAGG + Intergenic
1019300767 7:302397-302419 GAGACTGAGGCCTAGAGAGGAGG + Intergenic
1019350890 7:553474-553496 GAAGCTGAGGCCCAGGAAGGTGG + Intronic
1019474915 7:1239755-1239777 GGAGGAGAGGCAGAGAGAGGGGG + Intergenic
1019516116 7:1440904-1440926 GAAGTTGAGGCCCAGAGGCAGGG - Intronic
1019552749 7:1611278-1611300 GAAACAGAGGCCCACAGAGGTGG + Intergenic
1019558072 7:1642351-1642373 GAAACTGAGGCCCAGAGAGAAGG - Intergenic
1019703880 7:2488268-2488290 GAAACTGAGGCTCAGAGAGACGG + Intergenic
1019937526 7:4266128-4266150 GAAGGAGAGGGCCAGCGTGGTGG - Exonic
1019960144 7:4452213-4452235 GAATGTGGGCCCCAGAGGGGAGG + Intergenic
1020111898 7:5452175-5452197 GAGACTGAGGCCCCGAGAGGTGG - Intronic
1020288769 7:6706618-6706640 GACGGTGAGCCCCAGGGAGACGG - Exonic
1020292126 7:6730116-6730138 TACGGTGAGTCCCAGGGAGGCGG + Intergenic
1021173435 7:17422340-17422362 GAAGGGGAGGCCCAGAGCACAGG - Intergenic
1022220885 7:28312380-28312402 GAGGGGGAGGCACAGAGTGGTGG + Intronic
1022276786 7:28863080-28863102 GAAAGTGAGGCCCAGCCGGGCGG - Intergenic
1022340261 7:29460885-29460907 GAAACTGAGGCCCAGAGAAGCGG - Intronic
1022493422 7:30838017-30838039 AAAGGTCTGACCCAGAGAGGGGG + Intronic
1023318334 7:38965303-38965325 GAAAGTGAAGTGCAGAGAGGTGG - Intergenic
1023743861 7:43303993-43304015 GAAGGCAATTCCCAGAGAGGTGG + Intronic
1023775786 7:43605567-43605589 GCAGGTGAGTACCAGAGAGGAGG - Intronic
1023830586 7:44036863-44036885 GAGACTGAGGCCCAGAGATGGGG - Intergenic
1024085854 7:45890714-45890736 GAAGGTGAGGCCCAGCAGGTGGG + Exonic
1024161652 7:46682265-46682287 CAATGTGAGGGCCAGTGAGGAGG + Intronic
1024217508 7:47259864-47259886 GAAGGTGAGAGGGAGAGAGGGGG - Intergenic
1024233149 7:47378035-47378057 GACAGTGAGGCACAGAAAGGCGG - Intronic
1024284451 7:47744965-47744987 GAAGCTGAGTCTCAGGGAGGAGG + Intronic
1024651616 7:51408313-51408335 GAAATGGAGGCCCAGAGTGGTGG + Intergenic
1024667565 7:51561993-51562015 GAGGGTGAGGCTCTGGGAGGAGG + Intergenic
1024995630 7:55271400-55271422 CAAGGAGAGGCCAGGAGAGGTGG - Intergenic
1025247377 7:57327590-57327612 GAAACTGAGGCACAGAGAGAGGG - Intergenic
1025247452 7:57328007-57328029 GATGCTGAGGCTCAGAGAGCTGG - Intergenic
1025605633 7:63038248-63038270 GAAGGTGGGGTGAAGAGAGGTGG + Intergenic
1026253519 7:68691095-68691117 GAAGGGGAGGGGAAGAGAGGGGG + Intergenic
1026465612 7:70651296-70651318 GAGGCTGAGCACCAGAGAGGGGG - Intronic
1026682433 7:72477317-72477339 GAAGGTGAGGGACAGAGAGAAGG + Intergenic
1026727302 7:72879677-72879699 TACGGTGAGCCCCAGGGAGGCGG + Exonic
1026736863 7:72954524-72954546 GGAGGTGGGGCCCGGCGAGGAGG - Intergenic
1026787082 7:73308597-73308619 GGAGGTGGGGCCCGGCGAGGAGG - Intronic
1026794913 7:73359850-73359872 GAAGGTGAGGCCCTGGTAGGTGG - Intergenic
1026846259 7:73700591-73700613 GAAGGTGACGGCCTGGGAGGGGG + Intronic
1026888471 7:73968343-73968365 GAAAGGGAGGCCTGGAGAGGAGG - Intergenic
1026985889 7:74555090-74555112 TAGACTGAGGCCCAGAGAGGAGG + Intronic
1027106871 7:75410539-75410561 GGAGGTGGGGCCCGGCGAGGAGG + Intronic
1027121848 7:75527752-75527774 TATGGTGAGCCCCAGGGAGGCGG - Intergenic
1027275273 7:76549653-76549675 TACGGTGAGCCCCAGGGAGGCGG + Intergenic
1027426135 7:78062916-78062938 GAAGGACAGGATCAGAGAGGAGG - Intronic
1028400296 7:90418479-90418501 GAAAGTGAGGTCAAGAAAGGGGG - Intronic
1028589705 7:92482072-92482094 TAAGGTGAGAAGCAGAGAGGTGG + Intergenic
1029447409 7:100621539-100621561 GAAGGGGAGGCCTAGCGTGGTGG - Intronic
1029548318 7:101222913-101222935 GAAACTGAGGCACAGAAAGGGGG - Intronic
1029629792 7:101743255-101743277 GAAACTGAGGCTCAGAGAAGCGG + Intergenic
1029656857 7:101931511-101931533 GAAACTGAGGCCCAGAGAGGAGG + Intronic
1029720984 7:102364203-102364225 TACGGTGAGCCCCAGGGAGGCGG + Exonic
1029740916 7:102491177-102491199 GAGACTGAGGCCCAGAGATGGGG - Intronic
1029758910 7:102590350-102590372 GAGACTGAGGCCCAGAGATGGGG - Intronic
1030123919 7:106136881-106136903 GTAGGTAAGTCTCAGAGAGGTGG + Intergenic
1030515613 7:110534248-110534270 GAAGGTGAGGCCCAGGGCAAGGG - Intergenic
1030845675 7:114406997-114407019 GAAGGAGAGAACCAGACAGGAGG + Intronic
1031120575 7:117716939-117716961 GAAGGTGGGGCGCAGAGAGCAGG - Intronic
1031912003 7:127527522-127527544 AAAGGTGAGTCACAGAGAAGGGG - Intergenic
1032085702 7:128882444-128882466 GAAACTGAGGCTCAGAGAGGTGG - Intronic
1032303794 7:130713789-130713811 TAAGGGGAGGCCCAGCGTGGTGG - Intergenic
1032533622 7:132642568-132642590 GAAGTTGAGGGCGAGGGAGGGGG + Intronic
1032805264 7:135347887-135347909 GCAGGTGAAGCCCAGAGATTTGG - Intergenic
1033266789 7:139894025-139894047 GAAGCTGAGGGCCAGGGGGGAGG + Intronic
1033656958 7:143381221-143381243 CAAGGAGCGGCCCGGAGAGGGGG - Exonic
1034210221 7:149356954-149356976 GAAGATGAAGCCCAGAGGGAAGG + Intergenic
1034270097 7:149799591-149799613 AAAGCTGAGGCCCAGGCAGGTGG + Intergenic
1034383314 7:150718031-150718053 GATGGTGAGGCACAGACAGATGG + Intronic
1034550544 7:151817759-151817781 GAAATTGAGGCCCAGAGAAGTGG + Intronic
1034693748 7:153035578-153035600 GAAAGTGAGGCCCAGCAAGGTGG - Intergenic
1034885356 7:154794534-154794556 GCAGCTGATGCTCAGAGAGGAGG + Intronic
1035254022 7:157614718-157614740 GAAGGTGAGGTCCTGAGGGGGGG + Intronic
1035369676 7:158372043-158372065 GAAGGTGTGGCCCTGCGAGGGGG - Intronic
1035387744 7:158485422-158485444 GCAGGAGAGGCGCAGAGGGGTGG - Intronic
1035389641 7:158496489-158496511 GAAGGTGGGGCGCAGGGAAGGGG - Intronic
1035541280 8:440403-440425 GAAAATGGGGCCCAGAGAGATGG + Intronic
1035662517 8:1358877-1358899 GAGGGTGAGGTCCAGAGACTCGG + Intergenic
1035966540 8:4198275-4198297 GAAGGTAAACCCCAGAGAAGTGG + Intronic
1036219288 8:6907783-6907805 GCAGAGGAGGCCCAGAGAGGGGG + Intergenic
1036797190 8:11764783-11764805 GTGTGTGAGGCCCAGAGAGAGGG - Intergenic
1037030801 8:14102357-14102379 GGAGGTGAGTCCCAGAAAGTTGG - Exonic
1037713027 8:21370677-21370699 GAAACTGAAGTCCAGAGAGGTGG - Intergenic
1037765587 8:21770500-21770522 GAAACTGAGGCCCAGAGGGAAGG - Intronic
1037819370 8:22128356-22128378 GCAGGGGAGGCCTAGAGAGATGG + Intronic
1038012689 8:23487371-23487393 GAAGGTGAGGCAGACAGAGGAGG - Intergenic
1038015113 8:23508229-23508251 GAAATGGCGGCCCAGAGAGGTGG + Intergenic
1038439226 8:27560070-27560092 GAAGATGAGGCACAGGGAGGAGG - Intergenic
1038761031 8:30384458-30384480 GGAGGAGAGGCGCGGAGAGGAGG + Intronic
1039405107 8:37305993-37306015 GAAGCTGAAACCAAGAGAGGTGG - Intergenic
1039542263 8:38382060-38382082 GAAGGGGAGGCCGAGGGACGGGG + Exonic
1039889439 8:41674122-41674144 GAGGCTGAGGCCCCGAGCGGAGG - Intronic
1039889445 8:41674141-41674163 GGAGCTGAGGCCCCGAGCGGAGG - Intronic
1040020371 8:42735696-42735718 GAAGGGGAGGTGCAGAGAGTGGG - Intronic
1040579949 8:48689547-48689569 GCAGGGGCTGCCCAGAGAGGGGG - Intergenic
1040886136 8:52265948-52265970 GGAGGTGACGCCAGGAGAGGAGG + Intronic
1041782073 8:61587933-61587955 AAAGCTGAGGCCCAGAGTGCTGG - Intronic
1042189970 8:66176983-66177005 GAAGGTGAGATCCAGGGAGATGG + Exonic
1042845774 8:73168303-73168325 GAAACTGAGGCCCAGAGAGGGGG + Intergenic
1043790074 8:84454617-84454639 GAAGGAGAGCACCAAAGAGGTGG - Intronic
1044557361 8:93578373-93578395 GAAACTGAGGCACAGAGAGTAGG - Intergenic
1044730329 8:95224061-95224083 GAGGGTTAGGAGCAGAGAGGAGG - Intergenic
1044923720 8:97191330-97191352 GAAACTGAGGCTCAGAGTGGTGG - Intergenic
1045361599 8:101438263-101438285 AAAACTGAGGCCTAGAGAGGAGG + Intergenic
1046001406 8:108424793-108424815 GAGGGGGAGGCCAAGACAGGCGG - Intronic
1046388059 8:113529185-113529207 GGAGGTGGGACCCAGTGAGGAGG - Intergenic
1047096100 8:121627618-121627640 GAAACTGAGACTCAGAGAGGTGG + Intronic
1047229495 8:122984298-122984320 GAAGGACAGCACCAGAGAGGTGG + Intergenic
1047429177 8:124775999-124776021 GATGCAGTGGCCCAGAGAGGAGG + Intergenic
1047438039 8:124851539-124851561 GAAACTGAGGCCCAGAGGAGAGG - Intergenic
1047731706 8:127734150-127734172 GCGGGTGCTGCCCAGAGAGGGGG + Intergenic
1048257026 8:132912883-132912905 GGAACTGAGGCCCAGAGAAGGGG - Intronic
1048268172 8:133005610-133005632 GAAACTGAGGCTCAGAGAAGGGG + Intronic
1048320994 8:133400067-133400089 GGAGATGAGGCACAGACAGGTGG - Intergenic
1048351042 8:133616798-133616820 GAAAGAGAGGCCTAGAGAGCTGG + Intergenic
1048454653 8:134566880-134566902 AATAGAGAGGCCCAGAGAGGTGG - Intronic
1048458529 8:134600878-134600900 GATGTTAGGGCCCAGAGAGGAGG + Intronic
1048459178 8:134605835-134605857 GAAGGTGAGCTCCAGAGGGCAGG - Intronic
1049310436 8:141931256-141931278 GAAGGAGAGGCCTGGGGAGGAGG + Intergenic
1049310476 8:141931351-141931373 GAGGGGGAGGCCTAGGGAGGAGG + Intergenic
1049398431 8:142412679-142412701 GAAAGTGAGGTCCAGGGAGGTGG - Intergenic
1049419989 8:142512155-142512177 GAGACTGAGGCCCAGAGAGAGGG + Intronic
1049558493 8:143295841-143295863 GAGGGAGAGGGCCACAGAGGGGG + Exonic
1049572795 8:143377555-143377577 GAAACTGAGGCCCAGAGGGAGGG + Intronic
1049818369 8:144619049-144619071 GCAGGACAGGCCCAGAGAGCAGG + Intergenic
1050601726 9:7259696-7259718 GGAGGAGAGCCCCAGAGAAGTGG + Intergenic
1050772140 9:9215605-9215627 GGAGCTGAGGCACAGTGAGGTGG + Intronic
1051059230 9:13027110-13027132 CTAGGTGGGGCCCAGTGAGGTGG - Intergenic
1051342688 9:16126585-16126607 AAAATTGAGGCCCAGAGAAGTGG - Intergenic
1051801631 9:20940743-20940765 GAATGTGAGTCTCAGATAGGAGG + Intronic
1052630901 9:31037236-31037258 GAAGGAGAGGCCCAGATAGAGGG - Intergenic
1052778851 9:32760072-32760094 GAAACTGAGGCCTGGAGAGGTGG - Intergenic
1052855099 9:33402154-33402176 GAAACTGAGGCCCAGAGAGAGGG + Intronic
1052969814 9:34370625-34370647 GAAGGTGGGGCCTAGGGAGGGGG - Exonic
1053292487 9:36890527-36890549 GAAACCAAGGCCCAGAGAGGGGG - Intronic
1053309389 9:37006782-37006804 GCACTTGAAGCCCAGAGAGGGGG - Intronic
1053348572 9:37396221-37396243 ACAGGTGAGGCCCAAAGAGAAGG + Intergenic
1053382233 9:37658387-37658409 GGATCTGAGTCCCAGAGAGGGGG - Intronic
1053382682 9:37661687-37661709 GAAACTGAGGCCCAGACAAGGGG - Intronic
1053467140 9:38316809-38316831 GAAACTGAGGGTCAGAGAGGAGG - Intergenic
1053683120 9:40498495-40498517 GAAACTGAGGCCCAGAGAGAAGG + Intergenic
1053933100 9:43126811-43126833 GAAACTGAGGCCCAGAGAGAAGG + Intergenic
1054280594 9:63126433-63126455 GAAACTGAGGCCCAGAGAGAAGG - Intergenic
1054296220 9:63333993-63334015 GAAACTGAGGCCCAGAGAGAAGG + Intergenic
1054394236 9:64638498-64638520 GAAACTGAGGCCCAGAGAGAAGG + Intergenic
1054428886 9:65143697-65143719 GAAACTGAGGCCCAGAGAGAAGG + Intergenic
1054501493 9:65877838-65877860 GAAACTGAGGCCCAGAGAGAAGG - Intronic
1054812408 9:69445477-69445499 GGAGGGGAAGCCCAGAGAAGAGG + Intronic
1054875177 9:70088466-70088488 GAAGCTAAGGCCCAGAGAGGAGG - Intronic
1055513144 9:77014725-77014747 GAAACTGAGGCTCAGAGAAGAGG + Intergenic
1056711492 9:88995421-88995443 GAGGGTGAGCCAGAGAGAGGAGG - Exonic
1056761368 9:89417785-89417807 GGAGGAGAGGCCGAGAGAGCAGG + Intronic
1056839145 9:89984127-89984149 GAAGGTGAGGTTGAGACAGGAGG - Intergenic
1057294030 9:93825093-93825115 GCAGGTGGGGGGCAGAGAGGTGG - Intergenic
1057388614 9:94625294-94625316 GAAGCTGAGGGCCACAGAAGGGG + Intronic
1057900310 9:98943514-98943536 GAGACTGAGGCTCAGAGAGGTGG - Intronic
1057940113 9:99274450-99274472 AAAGCTGAGGCCCAGGGAGTAGG + Intergenic
1058446654 9:105061085-105061107 GAATGTGAGGTTCAGAGAGCAGG - Intergenic
1058506743 9:105674145-105674167 GAAGGTGTGGCCATGGGAGGGGG + Intergenic
1058514081 9:105751868-105751890 GAAGGTCCTGCCCAGTGAGGAGG - Intronic
1058535636 9:105957274-105957296 AAAAGTGAGGCACAGAGAGGGGG - Intergenic
1058541940 9:106020716-106020738 ACAGATGAGGCCCAGAGAGGAGG - Intergenic
1058759858 9:108120078-108120100 AAAACTGAGGCCCAGAGAGAGGG + Intergenic
1059312920 9:113400976-113400998 GAGGGTGAACCCCAGAGAAGAGG + Intronic
1059391388 9:114001760-114001782 GAAACTGAGGCCCAGAGATGGGG + Intronic
1059415893 9:114162325-114162347 GAGACTGAGGCCCAGAGAAGGGG + Intronic
1059420774 9:114190610-114190632 GTGGCTGAGGCCCAGAGATGGGG - Intronic
1059428833 9:114237775-114237797 GAAACTGAGGCCCAGGGATGGGG + Intronic
1059443565 9:114324518-114324540 GAAAATGAGGCCCAGAGAGGAGG - Intronic
1059444756 9:114331293-114331315 GAAAATGAGGCCCAGAGAGGAGG - Intronic
1059445873 9:114337417-114337439 GAAACTGAGACCCAGAGAGTAGG - Intronic
1059455442 9:114397729-114397751 GAGAATGAGGTCCAGAGAGGGGG - Intergenic
1059456631 9:114403907-114403929 GAACGAGAGGCCCACAGATGGGG - Exonic
1059462584 9:114443498-114443520 GAAGGAGGGAACCAGAGAGGTGG - Intronic
1059465215 9:114465031-114465053 GAAAGGGAAGCCCAGACAGGTGG + Intronic
1059507107 9:114809349-114809371 GAAGGTGATGGGCGGAGAGGTGG + Intergenic
1059508399 9:114820537-114820559 GATGGTGAGGGCAAGAGGGGAGG - Intergenic
1059653537 9:116336775-116336797 GAAACTGAGGCCCAGAGAAGGGG - Intronic
1060025489 9:120167368-120167390 GAAAATGAGGCTCAGAGAGAAGG - Intergenic
1060193869 9:121610440-121610462 GAAACTGAGTCCCAGAGAGGAGG + Intronic
1060280900 9:122214647-122214669 GAAACTGAGGCTCAGAGAGAAGG + Intronic
1060375573 9:123113081-123113103 GGAAGAGAGGCCCAGAGAGTTGG - Intronic
1060471091 9:123948806-123948828 GAAACTGAGACCCAGAGATGAGG + Intergenic
1060546443 9:124464433-124464455 GAAACTGAGGCTCAGAAAGGAGG - Intronic
1060608591 9:124940724-124940746 GAAACTGAGCCCTAGAGAGGAGG + Intronic
1060789006 9:126473185-126473207 GCAAGTAAGGCTCAGAGAGGTGG + Intronic
1060810474 9:126609231-126609253 GAAGCTGAGGTGCAGAGAGTAGG + Intergenic
1060971597 9:127741594-127741616 GAAACTGAGGCCCAGAGAAGGGG + Intronic
1060974499 9:127756445-127756467 ACAACTGAGGCCCAGAGAGGTGG - Intronic
1061010542 9:127951941-127951963 GAAACTGAGGCCCTGAGAAGTGG - Intronic
1061017237 9:127988951-127988973 GAAACTGAGGCCCAGAGAAATGG - Intergenic
1061131752 9:128712488-128712510 GAAACTGAGGCCCAGGGAGCAGG + Intronic
1061195745 9:129106295-129106317 AAAACTAAGGCCCAGAGAGGTGG - Intronic
1061211384 9:129195407-129195429 GAAACTGAGGCCCAGAGAGGGGG + Intergenic
1061298023 9:129687450-129687472 GAAACTGAGGCACAGAGAGGAGG + Intronic
1061316465 9:129799386-129799408 GAAACTGAGTCCCAGAAAGGTGG + Intergenic
1061489247 9:130936178-130936200 GAAGCCCAGGCCCAGAGAGGAGG + Intronic
1061500346 9:130998180-130998202 GAAGGAGGGGCTCAGAGTGGGGG - Intergenic
1061515621 9:131088290-131088312 GGATCTGAGGCTCAGAGAGGTGG - Intronic
1061620607 9:131809081-131809103 GAAAATCAGGCTCAGAGAGGTGG - Intergenic
1061665024 9:132155667-132155689 GGAACTGAGGCCCAGAGAGGTGG + Intergenic
1061669165 9:132179026-132179048 GAAACTGAGGCCCAGAGGGTTGG + Intronic
1061809761 9:133155414-133155436 GAAAGGGAGGCCCAGAGATGGGG - Intronic
1061883301 9:133578642-133578664 AAGGGTGAGACCCAGGGAGGGGG + Exonic
1061900149 9:133668619-133668641 GAAGGTGAGGGAGAGGGAGGGGG - Intronic
1061900197 9:133668739-133668761 GAAGGTGAGGGAGAGGGAGGGGG - Intronic
1061931174 9:133833927-133833949 GAAGCTGTGGGGCAGAGAGGGGG - Intronic
1062026345 9:134342443-134342465 GAAACTGAGGCACAGAGAGCAGG + Intronic
1062044680 9:134419546-134419568 CAAACTGAGGTCCAGAGAGGGGG + Intronic
1062055732 9:134468935-134468957 GAAACTGAGGCCCAGAGACAGGG - Intergenic
1062074091 9:134575097-134575119 GAAGGTTCAGCCCAGAAAGGTGG + Intergenic
1062076418 9:134592454-134592476 AAAGGGGAGGCCCTGGGAGGGGG - Intergenic
1062196894 9:135279406-135279428 GAAGCTGAGGCTCAGAGAGGTGG + Intergenic
1062283765 9:135763884-135763906 GAAGCTGAGGCTCAGAGTGGGGG + Intronic
1062353917 9:136152970-136152992 GAAGCTGAGGCCCAGCGACGAGG - Intergenic
1062716264 9:138011723-138011745 GAACTTCAAGCCCAGAGAGGAGG - Intronic
1203654182 Un_KI270752v1:7613-7635 GAATGTAAGGTCAAGAGAGGGGG + Intergenic
1186001955 X:5022428-5022450 GAGGGGGAGACACAGAGAGGAGG - Intergenic
1187397063 X:18927967-18927989 GAAGGTCAGGCACAGAGTAGGGG - Intronic
1188667004 X:32836317-32836339 GAAGTTGAGGCCGAGCGTGGTGG - Intronic
1189234767 X:39478463-39478485 GAGGCAGAGGCCCAGAGAGGTGG - Intergenic
1189292415 X:39895652-39895674 GAAGGTGGAGCCCAAAGAGAAGG + Intergenic
1189351874 X:40281587-40281609 GAAACTGAGGCCCAGAGAGGTGG - Intergenic
1189395513 X:40619162-40619184 GAAGGAGAGGCCAGGAGAGGTGG + Intergenic
1189714543 X:43852102-43852124 GAAAGTGAGTCCCAGAAAGGTGG - Intronic
1190055178 X:47177306-47177328 GAAGCTGAGGCTCAGAGAGGTGG + Intronic
1190309793 X:49109054-49109076 GTAAGAGAGGGCCAGAGAGGGGG - Intergenic
1190633375 X:52411109-52411131 GAAGGTGGGCCACAGAGTGGAGG - Intergenic
1190829084 X:54044358-54044380 GAAGTTGAGGCGGAGAGGGGAGG + Intronic
1190903968 X:54707873-54707895 GAACTTGTGGCCCAGAGAGAGGG + Intergenic
1190944248 X:55075316-55075338 GAAGGTGGGCCACAGAGGGGAGG + Intronic
1190945501 X:55089295-55089317 GAAGGTGGGCCGCAGAGGGGAGG + Intronic
1191786432 X:64921593-64921615 GAAAATGAGGCCCAGAGAGAAGG + Intronic
1191860840 X:65665757-65665779 GAAACTCAAGCCCAGAGAGGGGG + Intronic
1191870571 X:65741645-65741667 CAAGGTCAGGCACAGAGTGGGGG - Exonic
1192149399 X:68702700-68702722 GAAACTGAGGCCCAGAGATATGG - Intronic
1192209708 X:69120019-69120041 GAAACTGAGCCCCAGAGAAGGGG + Intergenic
1192212965 X:69139427-69139449 GAAACTGAGGCCCAGAGAGGGGG + Intergenic
1192698421 X:73443167-73443189 GAAACTGAGGCTGAGAGAGGTGG + Intergenic
1192698618 X:73444963-73444985 GAAACTGAGGCTCAGAGAGGTGG - Intergenic
1192834860 X:74788492-74788514 GAATATGAGGCCAAGAGAGTTGG + Intronic
1194348504 X:92796012-92796034 GAAGGAGAGGGCGAGGGAGGGGG + Intergenic
1195280694 X:103330140-103330162 GAAAGTGGGGACCAGAGATGGGG + Intergenic
1195321804 X:103727047-103727069 GAAACTGAGGCCTAGAGATGGGG - Intronic
1195698540 X:107684659-107684681 GAAACTGAGGCCCAGAGAAGGGG + Intergenic
1195858546 X:109356677-109356699 GATAATAAGGCCCAGAGAGGGGG - Intergenic
1195884097 X:109622472-109622494 GAAGGTGAGGGCCAGGGATTGGG - Intergenic
1197149357 X:123203368-123203390 AAAGGTGAGGCCTAAAGAGGGGG - Intronic
1197661572 X:129179255-129179277 GAAGCTGAGGCCTAGAAAGGGGG + Intergenic
1198216834 X:134563127-134563149 GAAACTGAGGCTCAGAGAAGTGG - Intergenic
1198687089 X:139238249-139238271 GAAGGTCATGCCCAGTGAGGAGG - Intergenic
1199601702 X:149544994-149545016 GAAGGTGGCACCCAGAGGGGTGG + Intronic
1199648673 X:149934489-149934511 GAAGGTGGCACCCAGAGGGGTGG - Intronic
1199858844 X:151781513-151781535 GAAGGCGGGAACCAGAGAGGAGG + Intergenic
1199950376 X:152701368-152701390 GTAGGAGAGGCCCAGGCAGGTGG - Exonic
1199959303 X:152767093-152767115 GTAGGAGAGGCCCAGGCAGGTGG + Exonic
1200079056 X:153566550-153566572 GAGGCTGAGGCCCAGGGAGTGGG - Intronic
1200123186 X:153800814-153800836 GGGGGTGAGGCCCTGAGGGGTGG + Intergenic
1202379071 Y:24260681-24260703 GCAGCTGAGGCTCAGAGAGGTGG + Intergenic
1202491711 Y:25409440-25409462 GCAGCTGAGGCTCAGAGAGGTGG - Intergenic