ID: 1161249023

View in Genome Browser
Species Human (GRCh38)
Location 19:3270665-3270687
Sequence CGGTGGGTAAGGCGGGCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161249011_1161249023 1 Left 1161249011 19:3270641-3270663 CCAGCCTGGCGCGCGTCTCCAGG 0: 1
1: 0
2: 0
3: 16
4: 133
Right 1161249023 19:3270665-3270687 CGGTGGGTAAGGCGGGCGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 127
1161249008_1161249023 30 Left 1161249008 19:3270612-3270634 CCGGGCGGGCGGGCGGCGGCACG 0: 1
1: 0
2: 6
3: 55
4: 2071
Right 1161249023 19:3270665-3270687 CGGTGGGTAAGGCGGGCGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 127
1161249013_1161249023 -3 Left 1161249013 19:3270645-3270667 CCTGGCGCGCGTCTCCAGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 114
Right 1161249023 19:3270665-3270687 CGGTGGGTAAGGCGGGCGCCGGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161249023 Original CRISPR CGGTGGGTAAGGCGGGCGCC GGG Intronic
900169487 1:1259674-1259696 CAGTGCGTAGGGCGGGCGTCTGG - Intronic
900172107 1:1274157-1274179 CGGAGGACAAGGCGGGAGCCGGG - Intergenic
900192494 1:1357360-1357382 CAGTGCGTAGGGCGGGCGTCTGG - Intronic
900206979 1:1435820-1435842 CGGTGAGTGCGGCGGGCGGCCGG + Exonic
900481244 1:2900459-2900481 AGGAGGGTAAAGCGGGCTCCGGG + Intergenic
901445033 1:9303014-9303036 CGGGGGGTAAGGCTGCCACCTGG + Intronic
903614665 1:24643232-24643254 CGGAGGGAAAGCCGAGCGCCGGG - Exonic
903660534 1:24974607-24974629 CGCTTGGTAAGGAGGGAGCCAGG - Intergenic
920065926 1:203269688-203269710 GGGTGGGGAAGGAGGGAGCCAGG + Intronic
922551708 1:226498884-226498906 TGGTGTGTAAGGCATGCGCCTGG + Intergenic
1063664191 10:8051810-8051832 AGGCGGGTCAGGCCGGCGCCTGG + Intergenic
1065025178 10:21534363-21534385 CGGCCGCTAACGCGGGCGCCCGG - Exonic
1067336756 10:45373361-45373383 GGCTGGGAGAGGCGGGCGCCAGG + Intergenic
1073122682 10:101131988-101132010 CGGTGGGCAAGCCGGTGGCCAGG - Exonic
1075054578 10:119207782-119207804 CGGTAGGCAAGGCGGGCTGCTGG + Exonic
1075207071 10:120457166-120457188 CGGGGGCGGAGGCGGGCGCCGGG - Exonic
1078845381 11:15114867-15114889 CGGGGGGTGGGGCGGGGGCCAGG + Intronic
1086700583 11:89896817-89896839 GGGTAGGTCAGGCGGGCGCTGGG + Intergenic
1086705586 11:89947709-89947731 GGGTAGGTCAGGCGGGCGCTGGG - Intergenic
1087381595 11:97409992-97410014 GGGTGGGTAAGCCTGGCACCTGG - Intergenic
1090699141 11:129279129-129279151 GGCTCGGTAAGGCGGGCGCGCGG - Intronic
1090904415 11:131062659-131062681 GGCTGGGAAAGGCGGGAGCCAGG + Intergenic
1095687301 12:45050723-45050745 CGGTGGCCAGGGCGGTCGCCGGG + Exonic
1096788643 12:54031845-54031867 GGGTGGGCAGGGCAGGCGCCTGG - Intronic
1097065264 12:56315975-56315997 AGCTGGGTCAGGCGGTCGCCGGG - Exonic
1097245329 12:57604868-57604890 CGGTGGGTGTGGGGGGCGCCGGG - Intronic
1103448789 12:121013187-121013209 AGGTGGGTAATGTGGGGGCCTGG + Intronic
1103708845 12:122896048-122896070 ACGTGGGGATGGCGGGCGCCGGG - Exonic
1103925740 12:124422626-124422648 CAGTGGGGATGGCAGGCGCCTGG - Intronic
1104875148 12:132028713-132028735 CGGTGGGCACGGTGGGCACCCGG + Intronic
1104904543 12:132206176-132206198 GGGTGGGCAAGGCAGGCGTCAGG - Intronic
1108643655 13:52406198-52406220 GCGTGGGGAGGGCGGGCGCCGGG + Intronic
1113510869 13:110853831-110853853 CAGGGGGTAAGGAGGGCGCCTGG + Intergenic
1118339158 14:64880050-64880072 GGGTGGGGAAGGCGGGGGCTGGG - Intergenic
1119759625 14:77141428-77141450 CCGCGGGCGAGGCGGGCGCCAGG - Intronic
1122540101 14:102493333-102493355 GAGTGGGGAAGGCGGGAGCCTGG + Intronic
1123690619 15:22835767-22835789 CGCTGGGGAAGGGGGGCGCGGGG + Intergenic
1123909882 15:24955855-24955877 CGGTGGGCATGGCGGCCGCGGGG + Intronic
1126849621 15:52789257-52789279 CGGTGGGCATGGCGGCCCCCGGG + Exonic
1127606605 15:60592773-60592795 GCGAGGGGAAGGCGGGCGCCCGG - Intronic
1131472939 15:92711780-92711802 CGGCGGGGAAGGCGCGTGCCGGG - Intronic
1132376633 15:101332421-101332443 CGGTGGGTAAATCTGGTGCCAGG + Intronic
1132644027 16:990679-990701 CCATGGGGAAGGCGGGGGCCGGG - Intergenic
1133128885 16:3664242-3664264 CGGTGGGTGGGGCGGGCTCCGGG - Exonic
1135572203 16:23557775-23557797 CGGCGGGGGTGGCGGGCGCCGGG + Intronic
1138454040 16:57110945-57110967 CGGTGGGTAAGGGGGTGGCTAGG + Intronic
1141946969 16:87317301-87317323 AGGAGGGAAAGGCGGGAGCCAGG - Exonic
1142177232 16:88650852-88650874 GGGTGGGGAAGTGGGGCGCCAGG - Intronic
1143452049 17:7042300-7042322 CGATGGGGGATGCGGGCGCCCGG - Exonic
1143552934 17:7642348-7642370 TGGTGGGAAAGGTGGGCTCCAGG + Intergenic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1148740427 17:49889765-49889787 CGGTGGGTGGGGTTGGCGCCTGG - Intergenic
1150060573 17:62065345-62065367 GGGTGGGGAGGGCGGGCGCCCGG - Intergenic
1150810564 17:68353590-68353612 CGGTGGGTAAGAAGGGCAGCAGG - Intronic
1151389665 17:73777508-73777530 GGGTGGGTAGGGCGGGCAGCTGG - Intergenic
1152794912 17:82302027-82302049 GTGTGGGAAAGGCAGGCGCCTGG + Intergenic
1160724181 19:610400-610422 CGGGAGGTGAGGCGGGCGCCGGG + Exonic
1160991680 19:1862873-1862895 CGGTGGGTGGGGCGCGCGCGGGG - Intronic
1161249023 19:3270665-3270687 CGGTGGGTAAGGCGGGCGCCGGG + Intronic
1161688948 19:5719821-5719843 CGGGGGGCAGCGCGGGCGCCGGG - Exonic
1162575472 19:11496492-11496514 GGGTGGTTAGGGCGGGAGCCTGG - Intronic
1165246387 19:34500636-34500658 CGGGGGGGAGGGCGGGGGCCAGG - Exonic
1165493920 19:36141053-36141075 CGGCGGGGGAGGCGGGGGCCTGG + Exonic
1166762573 19:45234329-45234351 CGGCGGGGTAGGCGGGCGCCAGG + Intronic
1167125498 19:47545714-47545736 CGGTGGGGCAGGAGGGAGCCGGG + Exonic
1167258064 19:48442889-48442911 CGGCGGGGACAGCGGGCGCCCGG - Exonic
1167376415 19:49114554-49114576 GGGTGGGCGGGGCGGGCGCCGGG + Intronic
929777381 2:44937725-44937747 CGGAGGCTAAGGCGGGGGGCGGG + Intergenic
932801733 2:74747516-74747538 CTGTGGGTAAGGGGAGGGCCAGG - Intergenic
934867624 2:97827220-97827242 CGGCGGGGAAGGCGCGTGCCAGG - Intronic
935223807 2:101036501-101036523 GGGTGGGTAAGGGGGACGCTGGG + Intronic
935645303 2:105329604-105329626 CGGTGAGTGAGGAGGGCGGCGGG - Exonic
939619939 2:144406637-144406659 TGGAGAGTAAGGCGGGAGCCAGG + Intronic
942454876 2:176130618-176130640 CGGTAGGGAAGGCCGGGGCCAGG + Exonic
946248502 2:218400032-218400054 CGGGGGGGAGGCCGGGCGCCCGG + Exonic
946375810 2:219308498-219308520 GGGTGGGGAAAGAGGGCGCCAGG + Intronic
948164366 2:235850048-235850070 GGGTGGGAAAGGCAGGTGCCAGG - Intronic
1169065402 20:2692363-2692385 CGGAGAGTACGGCGGGTGCCGGG + Intergenic
1170924687 20:20712358-20712380 TGCTGGGTGAGGCGCGCGCCGGG - Exonic
1175107392 20:56625288-56625310 CGCTGGGTGGGACGGGCGCCTGG + Intergenic
1175243032 20:57563603-57563625 CGCTGGGAAATGCGGCCGCCAGG - Exonic
1179213683 21:39348923-39348945 CGGCGGGGAAGGCGCGTGCCGGG + Exonic
1179727227 21:43347304-43347326 TGGTGGGAAAGGCGGGCCCTGGG - Intergenic
1184113008 22:42406169-42406191 CGGGGGGTGAGGCGCGAGCCGGG - Intronic
1184789460 22:46690413-46690435 CGCCGGGGAAGGTGGGCGCCGGG - Intronic
1185047154 22:48534282-48534304 CGGTGGGTAAGGCAGGTGAGGGG + Intronic
1185292546 22:50034545-50034567 TGGTGGGTGAGGCGGGGCCCAGG - Intronic
954717456 3:52533723-52533745 CGGTGGGCATGGCGGGTGCGGGG - Exonic
957792594 3:84959491-84959513 CGGTGGGTCCGGCGGGCGCCGGG + Intronic
963503873 3:146161104-146161126 CGGCGGGCAAGGCGCGCGGCCGG + Exonic
968815167 4:2818216-2818238 CGGCGGGCATGGCGGGCTCCGGG + Exonic
969457737 4:7309796-7309818 CGGTGGGTTACGCGGGCCTCAGG - Intronic
998474577 5:142409437-142409459 CTGTGGGGAAGGCGGGGACCAGG + Intergenic
999737929 5:154526652-154526674 CGGTGGGGCAGGAGGGGGCCAGG - Intergenic
1001513586 5:172339683-172339705 CGGTGCGTCAGGCAGGGGCCGGG + Exonic
1002715275 5:181223384-181223406 CGGGGGGTAGGGGGAGCGCCTGG - Exonic
1003226514 6:4210934-4210956 CAGTGGGTGAGGCGGGGGGCGGG - Intergenic
1017073864 6:150600200-150600222 CGGTGGGGACAGAGGGCGCCGGG + Intronic
1017073877 6:150600232-150600254 CGGTGGGGACGGAGGGCGCTGGG + Intronic
1019407105 7:889558-889580 AGGTGGGAGAGGCAGGCGCCTGG + Intronic
1019772857 7:2894793-2894815 AGGTGGGTGAGGCGGGGGCGTGG - Intergenic
1020252784 7:6483473-6483495 CGGGAGGTGGGGCGGGCGCCGGG - Intronic
1021716955 7:23469665-23469687 CGCTGGCTAAGGGGGGCGCGGGG - Intronic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1022447126 7:30479746-30479768 TGGTGGGCAAGGCGGGGGCCGGG - Intergenic
1022485197 7:30772164-30772186 CGGTGGGGAAGGAGCTCGCCGGG + Intronic
1023830941 7:44038786-44038808 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1026565054 7:71482946-71482968 CGGTGGGTAAGGCGAGTGATGGG + Intronic
1026672644 7:72403252-72403274 AGGTGGGGAAGTCGGGGGCCTGG + Exonic
1026913382 7:74105852-74105874 CTGTGGGTAAGGCAGGGGTCAGG - Intronic
1029403455 7:100359094-100359116 CGGTGGGCAAGGCAGGTGTCAGG - Intronic
1029406030 7:100374448-100374470 CGGTGGGCAAAGCGGGTGCCAGG - Intronic
1029741275 7:102493095-102493117 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029759265 7:102592264-102592286 AGGTGGGTAAGGAGGGAGGCCGG - Exonic
1029776634 7:102688174-102688196 AGGTGGGTAAGGAGGGAGGCCGG - Intergenic
1030598035 7:111562443-111562465 GGGTGCGGAGGGCGGGCGCCCGG - Intronic
1032079161 7:128850051-128850073 CAGTGTGTGGGGCGGGCGCCGGG - Exonic
1032257776 7:130311013-130311035 AGGAGGGTCAGGCGGGCCCCAGG - Intronic
1034967973 7:155403264-155403286 TGGTGGGTGAGGAGGGAGCCGGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1036209196 8:6828389-6828411 TGCTTGGTAAGGCGGGGGCCAGG + Intronic
1036359164 8:8065487-8065509 CGGTGGGTCCGCCGGGCGCGGGG - Intergenic
1039400594 8:37265889-37265911 AGGTGGGTAAGGTGTGGGCCTGG - Intergenic
1040604794 8:48921271-48921293 CAGCGGGTCTGGCGGGCGCCCGG + Exonic
1046514460 8:115240583-115240605 CAGTGTGTAAGGGGGGAGCCAGG + Intergenic
1049474286 8:142789585-142789607 CGGTGGACAAGGCGGGGCCCTGG + Intergenic
1049664278 8:143836076-143836098 CCGTGGGGAAGGCGGGAGCGTGG - Intronic
1051366739 9:16326631-16326653 CGGTGGGGAAGGAGGGTGGCTGG + Intergenic
1053484529 9:38442041-38442063 CGGTGGCTCAGGAGGGCACCTGG + Intergenic
1059191769 9:112333658-112333680 GGGTGGGGAAGGCGGGGGCGCGG - Intronic
1061047805 9:128176523-128176545 CAGTGGGCAAGGCTGGGGCCTGG + Intronic
1061594794 9:131621810-131621832 TGGGGGGTAGGGCGGGCGGCGGG + Exonic
1062450642 9:136614370-136614392 GGGTGGGGAAGGCGGGAGCCGGG - Intergenic
1062507691 9:136886536-136886558 CGTTGGGTGAGGCGAGCGCGGGG + Exonic
1192260565 X:69504100-69504122 TGGAGAGGAAGGCGGGCGCCCGG + Intergenic
1192433657 X:71129137-71129159 CGGCAGGTAAGCCGGGCCCCTGG - Exonic