ID: 1161249978

View in Genome Browser
Species Human (GRCh38)
Location 19:3275385-3275407
Sequence TGATGGTCCCCGCACTTTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161249978_1161249980 -5 Left 1161249978 19:3275385-3275407 CCGTGAAAGTGCGGGGACCATCA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1161249980 19:3275403-3275425 CATCAGTGCCCACCTCCGCCTGG 0: 1
1: 0
2: 3
3: 66
4: 1882
1161249978_1161249981 -1 Left 1161249978 19:3275385-3275407 CCGTGAAAGTGCGGGGACCATCA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1161249981 19:3275407-3275429 AGTGCCCACCTCCGCCTGGCAGG 0: 1
1: 1
2: 1
3: 13
4: 205
1161249978_1161249986 6 Left 1161249978 19:3275385-3275407 CCGTGAAAGTGCGGGGACCATCA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1161249986 19:3275414-3275436 ACCTCCGCCTGGCAGGTCCGGGG No data
1161249978_1161249984 4 Left 1161249978 19:3275385-3275407 CCGTGAAAGTGCGGGGACCATCA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1161249984 19:3275412-3275434 CCACCTCCGCCTGGCAGGTCCGG 0: 1
1: 0
2: 2
3: 30
4: 317
1161249978_1161249985 5 Left 1161249978 19:3275385-3275407 CCGTGAAAGTGCGGGGACCATCA 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1161249985 19:3275413-3275435 CACCTCCGCCTGGCAGGTCCGGG 0: 1
1: 0
2: 5
3: 83
4: 1668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161249978 Original CRISPR TGATGGTCCCCGCACTTTCA CGG (reversed) Intronic
900160837 1:1222689-1222711 TGCTGGTCACGGCACCTTCACGG - Intronic
901086671 1:6615030-6615052 GGATGGGCCCCGCACCTTCGGGG + Intronic
902446196 1:16466165-16466187 GGATGGTCCCCAAACTATCAAGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
911235399 1:95406480-95406502 TGATGGTCACCTCACATTCCTGG + Intergenic
912182434 1:107235511-107235533 CTCTGGTCCCCACACTTTCATGG + Intronic
912704663 1:111903168-111903190 TGATGGTCACCAGACTCTCAGGG - Intronic
916059030 1:161086439-161086461 GGATGGGCCCCTCCCTTTCAAGG + Intronic
918400913 1:184162178-184162200 TGATGGTCGCCTGACTTTCCTGG - Intergenic
924496307 1:244593739-244593761 TGATGGTCCCTGCATGTTGAGGG + Intronic
1063018888 10:2105914-2105936 TGATGGTCACCTGACTTTCCTGG + Intergenic
1063047169 10:2404059-2404081 TGAGAGTCCCCGCACCTGCAGGG - Intergenic
1069174385 10:65271886-65271908 TGATGGTCGCCTCACATTCCTGG + Intergenic
1070945351 10:80386805-80386827 GGCTGGCCCCCACACTTTCATGG - Intergenic
1071224986 10:83518844-83518866 TGATGGTCGCCTGACTTTCCTGG - Intergenic
1077206710 11:1348262-1348284 GCATCGTCCCCGCACTTACACGG - Intergenic
1079405967 11:20146011-20146033 TGATGGTCACCTCACATTCCTGG + Intergenic
1083391998 11:62358590-62358612 CCATGGTCCCTGCACTTTAAAGG + Intronic
1084001787 11:66299517-66299539 TGAAGGTCCACTCAGTTTCAAGG + Intergenic
1085622766 11:78049945-78049967 TGATGGTCACCTGACTTTCCTGG + Intronic
1087092253 11:94285671-94285693 TGATTTTCCCCACTCTTTCATGG - Intergenic
1101406974 12:104437256-104437278 TGATGGTCCCCTGACATTCCTGG + Intergenic
1111405498 13:87799089-87799111 AGAGGGTCCCAGAACTTTCAAGG - Intergenic
1114967482 14:27981211-27981233 TGATGGTCCCCTAACATTCCTGG + Intergenic
1120793577 14:88607733-88607755 GGATGGTACTCGCACTTACAGGG - Intronic
1121722334 14:96118373-96118395 TGATGGTCGCCTGACTTTCCTGG + Intergenic
1122843567 14:104478417-104478439 TGTTGGTCCCCGCATTTATAAGG + Intronic
1125365891 15:38915577-38915599 TGATGATCCTAGCACTTTGATGG + Intergenic
1131258392 15:90876097-90876119 TCATGGTCCCCGCATTTTGCTGG + Intronic
1132841594 16:1980779-1980801 TGAGGGACCCCGCCCTCTCAAGG - Exonic
1133255049 16:4511611-4511633 TGAGGGGCCCGGCACTTACAGGG + Exonic
1148513527 17:48194214-48194236 TGATGGCCACCCAACTTTCATGG + Intronic
1153777260 18:8465113-8465135 TGATCATCCCCGGCCTTTCATGG + Intergenic
1154012063 18:10582766-10582788 TGAGGGGCACCTCACTTTCAAGG - Intergenic
1157915100 18:51656604-51656626 TGATGGTCACCTGACTTTCCTGG + Intergenic
1160019859 18:75172007-75172029 TGATGGTCCCCTCATCTTCGGGG + Intergenic
1161249978 19:3275385-3275407 TGATGGTCCCCGCACTTTCACGG - Intronic
1163948789 19:20565342-20565364 TGGTGGTCCCTGCACATTCTGGG + Intronic
925587358 2:5476626-5476648 TGATGGTCACCTGACTTTCCTGG - Intergenic
926651640 2:15352935-15352957 TGATGGTCGCCTGACTTTCCTGG + Intronic
926910543 2:17848788-17848810 TGAGGCTCCCCACACTTTCAAGG + Intergenic
929417314 2:41756540-41756562 TAAAGGGCCCCACACTTTCATGG + Intergenic
938107808 2:128545212-128545234 TCCGGGTCCACGCACTTTCATGG - Intergenic
941159676 2:162022217-162022239 TGAGGGTCACCACACTTTCCTGG + Intronic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
1175251710 20:57613901-57613923 TGATGGGCCCCGCACAGTCTGGG - Intronic
1176034480 20:63029517-63029539 GGGGGGTCCCCGCACCTTCACGG - Intergenic
1183801400 22:40167950-40167972 TGCAGGCCCCCTCACTTTCATGG - Intronic
953259221 3:41321522-41321544 TGATGGTCGCCTCACATTCCTGG - Intronic
957738210 3:84228626-84228648 TGATGGTCTCCCCACATTCCTGG + Intergenic
963253184 3:143120421-143120443 TGGGGGTCCCCGCACCTTCGAGG - Exonic
965933226 3:174072509-174072531 TGATGTGCCCCACACTTTCATGG - Intronic
971787219 4:31120049-31120071 TGATGGTCACCTGACTTTCCTGG + Intronic
971851289 4:31989102-31989124 TCATGGTCCCCTCACTTTCCTGG - Intergenic
972003378 4:34067563-34067585 TGATGGTCGCCTGACTTTCCTGG - Intergenic
972138096 4:35918566-35918588 GGAAGGTCCTCACACTTTCATGG + Intergenic
974910115 4:68107679-68107701 TTTTGGTCCCAGCACTTTGAGGG + Intronic
974945237 4:68519088-68519110 TGATGGTCACCTGACTTTCCTGG - Intergenic
976899955 4:90160428-90160450 TGATAGTCCTCCTACTTTCATGG - Intronic
978850682 4:113332273-113332295 TGAAGGTCACAGCACTTTAAGGG - Intronic
984507301 4:180635651-180635673 TGATGGTCCTGGAACTTGCAAGG + Intergenic
984544317 4:181082071-181082093 TGATGGACCACCCAGTTTCAAGG - Intergenic
990124464 5:52497220-52497242 TGAAAGTCCCCGAACTTCCAAGG + Intergenic
990444590 5:55882151-55882173 TGATGGTCACCTGACTTTCCTGG + Intronic
991989588 5:72324395-72324417 TGATGGACTCCGCCCTTTCTAGG + Intronic
995558684 5:113357464-113357486 TGATGGTCACCGGACATTCCTGG - Intronic
996281861 5:121739591-121739613 TGATGGTCGCCGGACATTCCTGG + Intergenic
998438284 5:142133006-142133028 TGATGGTCCCCGCATTTCTGGGG - Intronic
1002392732 5:178928495-178928517 TGATGGTTTCTGGACTTTCATGG - Intronic
1015244978 6:131064929-131064951 TGCTGGTTCCCACATTTTCAAGG - Intergenic
1016283628 6:142448326-142448348 TGATGATCCCAGCACAGTCATGG - Intergenic
1017921763 6:158879076-158879098 AGAGGGGCCCCACACTTTCATGG - Intronic
1018275023 6:162121300-162121322 TGATGGTGCCTACATTTTCATGG - Intronic
1019502177 7:1369786-1369808 TGAGGGTCCCCCCACCTCCAGGG + Intergenic
1021689005 7:23214287-23214309 TGATGGTCCCCTGACATTCCTGG + Intergenic
1023293630 7:38692449-38692471 TGATGGTCACCTGACTTTCCTGG + Intergenic
1030449965 7:109696355-109696377 AGAGGGCCCCCACACTTTCATGG + Intergenic
1035246062 7:157562572-157562594 TGAAGGTCCCCGGACTTTGAAGG - Intronic
1038043818 8:23749426-23749448 TGATGGTCCCCAAACTTTGCAGG - Intergenic
1041134155 8:54737810-54737832 TGACTGTCCCAGCTCTTTCAGGG + Intergenic
1045427837 8:102084885-102084907 TGATGGTCTCCTGACTTTCCCGG + Intronic
1199566829 X:149224090-149224112 GGTTGGGCCCCACACTTTCAGGG + Intergenic
1200768851 Y:7105163-7105185 TGATGGTCGCCTCACATTCCTGG - Intergenic