ID: 1161255594

View in Genome Browser
Species Human (GRCh38)
Location 19:3307460-3307482
Sequence CTTTACTCCAGCGGGGGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161255589_1161255594 28 Left 1161255589 19:3307409-3307431 CCTTGGGTGAAATTCAGGGATAC No data
Right 1161255594 19:3307460-3307482 CTTTACTCCAGCGGGGGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161255594 Original CRISPR CTTTACTCCAGCGGGGGCTC CGG Intergenic
No off target data available for this crispr