ID: 1161258896

View in Genome Browser
Species Human (GRCh38)
Location 19:3324720-3324742
Sequence TAGTGGGAAGAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161258896_1161258901 1 Left 1161258896 19:3324720-3324742 CCTTCTTCCCTCTCTTCCCACTA No data
Right 1161258901 19:3324744-3324766 CTCTCTCTGCTGCAGCCACACGG No data
1161258896_1161258902 2 Left 1161258896 19:3324720-3324742 CCTTCTTCCCTCTCTTCCCACTA No data
Right 1161258902 19:3324745-3324767 TCTCTCTGCTGCAGCCACACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161258896 Original CRISPR TAGTGGGAAGAGAGGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr