ID: 1161262924

View in Genome Browser
Species Human (GRCh38)
Location 19:3347472-3347494
Sequence CTGGGTTGACACTGGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161262924_1161262934 -1 Left 1161262924 19:3347472-3347494 CCCAGCACCCAGTGTCAACCCAG No data
Right 1161262934 19:3347494-3347516 GCACTTTGGGAGGCCAAGGCAGG 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
1161262924_1161262937 13 Left 1161262924 19:3347472-3347494 CCCAGCACCCAGTGTCAACCCAG No data
Right 1161262937 19:3347508-3347530 CAAGGCAGGAGGATCACTTGAGG 0: 1224
1: 7489
2: 28542
3: 63428
4: 97615
1161262924_1161262935 2 Left 1161262924 19:3347472-3347494 CCCAGCACCCAGTGTCAACCCAG No data
Right 1161262935 19:3347497-3347519 CTTTGGGAGGCCAAGGCAGGAGG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
1161262924_1161262938 18 Left 1161262924 19:3347472-3347494 CCCAGCACCCAGTGTCAACCCAG No data
Right 1161262938 19:3347513-3347535 CAGGAGGATCACTTGAGGCCAGG 0: 2248
1: 14678
2: 48590
3: 155856
4: 284737
1161262924_1161262932 -5 Left 1161262924 19:3347472-3347494 CCCAGCACCCAGTGTCAACCCAG No data
Right 1161262932 19:3347490-3347512 CCCAGCACTTTGGGAGGCCAAGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161262924 Original CRISPR CTGGGTTGACACTGGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr