ID: 1161264998

View in Genome Browser
Species Human (GRCh38)
Location 19:3359910-3359932
Sequence CGCGAGGGGCCCCCCACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 41}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161264998_1161265008 0 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265008 19:3359933-3359955 GGCGCCGCGAGTTGGCGAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 70
1161264998_1161265015 20 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265015 19:3359953-3359975 AGGGCGGGGCTCCCCGGAGAAGG 0: 1
1: 0
2: 3
3: 26
4: 283
1161264998_1161265011 4 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265011 19:3359937-3359959 CCGCGAGTTGGCGAGGAGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 111
1161264998_1161265014 14 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265014 19:3359947-3359969 GCGAGGAGGGCGGGGCTCCCCGG 0: 1
1: 0
2: 5
3: 61
4: 537
1161264998_1161265012 5 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265012 19:3359938-3359960 CGCGAGTTGGCGAGGAGGGCGGG 0: 1
1: 0
2: 0
3: 5
4: 93
1161264998_1161265005 -8 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265005 19:3359925-3359947 CCCTCGCGGGCGCCGCGAGTTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1161264998_1161265009 1 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265009 19:3359934-3359956 GCGCCGCGAGTTGGCGAGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1161264998_1161265007 -3 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265007 19:3359930-3359952 GCGGGCGCCGCGAGTTGGCGAGG 0: 1
1: 0
2: 3
3: 19
4: 86
1161264998_1161265013 6 Left 1161264998 19:3359910-3359932 CCCCAAGTGGGGGGCCCCTCGCG 0: 1
1: 0
2: 0
3: 4
4: 41
Right 1161265013 19:3359939-3359961 GCGAGTTGGCGAGGAGGGCGGGG 0: 1
1: 0
2: 0
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161264998 Original CRISPR CGCGAGGGGCCCCCCACTTG GGG (reversed) Intronic
900550593 1:3252522-3252544 CACGAGGGGCCCACCTCCTGCGG - Intronic
910841115 1:91561995-91562017 GGGGATGGGCCCCTCACTTGTGG + Intergenic
921850541 1:219928502-219928524 CGCGCCGCGCCCCCCACCTGTGG - Exonic
922730071 1:227945126-227945148 CGAGAGGGGCCTCCCAATGGAGG + Intronic
1064274320 10:13892176-13892198 AGCCAGGGGTCCCCCGCTTGGGG - Intronic
1073021702 10:100450241-100450263 TGCCAGAGGCCCCCCACTGGAGG + Intergenic
1073862744 10:107766342-107766364 CACGAGGGGTCCCCAACTTCCGG + Intergenic
1081566297 11:44263278-44263300 CTGGAGGGACCCCCCACCTGGGG + Exonic
1083258079 11:61508820-61508842 CGGGAGGAGGCACCCACTTGGGG - Exonic
1091418091 12:308117-308139 CGCCAGGGGCCCCACATTTTAGG - Intronic
1096704964 12:53414937-53414959 TGCAAAGGGCCCCTCACTTGAGG - Intronic
1103969896 12:124663958-124663980 CGTGGGGGCCCCTCCACTTGCGG - Intergenic
1121279098 14:92687061-92687083 CGCGCGGGGCTGCCCCCTTGTGG - Intronic
1121318108 14:92974155-92974177 CTCCAGGGGCCCCCAACTTCAGG - Intronic
1122230214 14:100303287-100303309 CTCGAGGGGCCCCCTGCTGGAGG - Intronic
1132828299 16:1915762-1915784 CTTGAGGGGCCTCCCACTTGGGG - Intronic
1140442782 16:74999754-74999776 CGGGAGGGGCGCCCCATTTCGGG + Exonic
1203145275 16_KI270728v1_random:1794711-1794733 CACTAGGAGCCCCCCAATTGGGG - Intergenic
1146656530 17:34638152-34638174 CGCGTGGGGCCCGCCACATCCGG - Exonic
1147920891 17:43916319-43916341 TGGGAGGGGCCCCAAACTTGGGG + Intergenic
1152650509 17:81490384-81490406 GGTCAGGGGCCCCCCAGTTGGGG + Intergenic
1160733484 19:651566-651588 CGCGAGGGCCCCACGCCTTGAGG - Intronic
1160831458 19:1106575-1106597 CGGGCGGGGCCACACACTTGTGG - Exonic
1161264998 19:3359910-3359932 CGCGAGGGGCCCCCCACTTGGGG - Intronic
931515945 2:63050748-63050770 CGCGCGGGGCCCCCGATTGGCGG + Intronic
932213279 2:69948914-69948936 CACCTGGGGGCCCCCACTTGGGG + Intergenic
947523506 2:230865411-230865433 GGCGAGGGGGCCCCCACTTTTGG - Intronic
1168876119 20:1173399-1173421 CACGAGGGGCTTCCCACTTCAGG + Intronic
1175967798 20:62668345-62668367 GACGAGGGGCTTCCCACTTGGGG + Intronic
1180868626 22:19133825-19133847 AGCGAGGGGCCCCCCAGGTGAGG - Exonic
1180960269 22:19759327-19759349 CGTCATGGGCCCCCCACTTGGGG - Intronic
950557603 3:13704856-13704878 ACTGAGGGGACCCCCACTTGAGG + Intergenic
955869205 3:63418788-63418810 CACCAGGTGCCTCCCACTTGTGG + Intronic
957641187 3:82855441-82855463 CGAGGTGGGCCCTCCACTTGAGG + Intergenic
968701217 4:2059115-2059137 CGCGAGGGGCCCGGCACGGGCGG - Intergenic
971023109 4:22558478-22558500 AGCGAGGGTCCCCCCACATTAGG - Intergenic
973279186 4:48341585-48341607 CGCCAGGGTCCCCCCACCTCGGG - Exonic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
1002632552 5:180591112-180591134 CGCGAGTGTCCCCTCCCTTGGGG - Intronic
1017913959 6:158818412-158818434 CTGGAGGTGCCCCCCAGTTGGGG + Intronic
1036837642 8:12088833-12088855 CTCGGTGGGCCCCACACTTGAGG + Intergenic
1036859435 8:12335081-12335103 CTCGGTGGGCCCCACACTTGAGG + Intergenic
1043464017 8:80487137-80487159 CGCGGGGGGCCCCCTGCTAGCGG + Exonic
1060918206 9:127403593-127403615 CGCAAGCGGCCCCCCTCTGGGGG - Intronic
1061351099 9:130065531-130065553 CGCAACGGGCACCTCACTTGAGG + Intronic
1199760050 X:150898471-150898493 CGCGCGGGGACCCCGCCTTGTGG - Intronic