ID: 1161265257

View in Genome Browser
Species Human (GRCh38)
Location 19:3360741-3360763
Sequence TTTCACAACACCGTCCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161265257_1161265269 30 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265269 19:3360794-3360816 CGTGTCCCTGGGTGACCGTGGGG No data
1161265257_1161265263 18 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265263 19:3360782-3360804 TCCGCGGAGCCGCGTGTCCCTGG No data
1161265257_1161265267 28 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265267 19:3360792-3360814 CGCGTGTCCCTGGGTGACCGTGG No data
1161265257_1161265265 19 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265265 19:3360783-3360805 CCGCGGAGCCGCGTGTCCCTGGG No data
1161265257_1161265268 29 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265268 19:3360793-3360815 GCGTGTCCCTGGGTGACCGTGGG No data
1161265257_1161265262 2 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265262 19:3360766-3360788 ATGGCTGGGCTGCGTGTCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161265257 Original CRISPR TTTCACAACACCGTCCCGCA GGG (reversed) Intronic