ID: 1161265265

View in Genome Browser
Species Human (GRCh38)
Location 19:3360783-3360805
Sequence CCGCGGAGCCGCGTGTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161265258_1161265265 18 Left 1161265258 19:3360742-3360764 CCTGCGGGACGGTGTTGTGAAAC No data
Right 1161265265 19:3360783-3360805 CCGCGGAGCCGCGTGTCCCTGGG No data
1161265257_1161265265 19 Left 1161265257 19:3360741-3360763 CCCTGCGGGACGGTGTTGTGAAA No data
Right 1161265265 19:3360783-3360805 CCGCGGAGCCGCGTGTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161265265 Original CRISPR CCGCGGAGCCGCGTGTCCCT GGG Intronic