ID: 1161266582

View in Genome Browser
Species Human (GRCh38)
Location 19:3367163-3367185
Sequence CAGGGCGGCCCGCACAACCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161266582_1161266598 27 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266598 19:3367213-3367235 GGCCCACGTGTGCATGGAGGGGG No data
1161266582_1161266597 26 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266597 19:3367212-3367234 TGGCCCACGTGTGCATGGAGGGG No data
1161266582_1161266595 24 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266595 19:3367210-3367232 ATTGGCCCACGTGTGCATGGAGG No data
1161266582_1161266601 30 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266601 19:3367216-3367238 CCACGTGTGCATGGAGGGGGAGG No data
1161266582_1161266596 25 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266596 19:3367211-3367233 TTGGCCCACGTGTGCATGGAGGG No data
1161266582_1161266594 21 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266594 19:3367207-3367229 GTTATTGGCCCACGTGTGCATGG No data
1161266582_1161266590 6 Left 1161266582 19:3367163-3367185 CCAAGGTTGTGCGGGCCGCCCTG No data
Right 1161266590 19:3367192-3367214 GGTCGCCTTTCCCTCGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161266582 Original CRISPR CAGGGCGGCCCGCACAACCT TGG (reversed) Intronic