ID: 1161267342

View in Genome Browser
Species Human (GRCh38)
Location 19:3370337-3370359
Sequence GACCCAGAGGGAGATACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161267342_1161267346 21 Left 1161267342 19:3370337-3370359 CCCGCTGTATCTCCCTCTGGGTC No data
Right 1161267346 19:3370381-3370403 TTCTCCCCCTCCCCTCTCTGCGG No data
1161267342_1161267347 24 Left 1161267342 19:3370337-3370359 CCCGCTGTATCTCCCTCTGGGTC No data
Right 1161267347 19:3370384-3370406 TCCCCCTCCCCTCTCTGCGGCGG No data
1161267342_1161267351 27 Left 1161267342 19:3370337-3370359 CCCGCTGTATCTCCCTCTGGGTC No data
Right 1161267351 19:3370387-3370409 CCCTCCCCTCTCTGCGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161267342 Original CRISPR GACCCAGAGGGAGATACAGC GGG (reversed) Intronic