ID: 1161267347

View in Genome Browser
Species Human (GRCh38)
Location 19:3370384-3370406
Sequence TCCCCCTCCCCTCTCTGCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161267344_1161267347 12 Left 1161267344 19:3370349-3370371 CCCTCTGGGTCTCTCTGTGCATC No data
Right 1161267347 19:3370384-3370406 TCCCCCTCCCCTCTCTGCGGCGG No data
1161267343_1161267347 23 Left 1161267343 19:3370338-3370360 CCGCTGTATCTCCCTCTGGGTCT No data
Right 1161267347 19:3370384-3370406 TCCCCCTCCCCTCTCTGCGGCGG No data
1161267342_1161267347 24 Left 1161267342 19:3370337-3370359 CCCGCTGTATCTCCCTCTGGGTC No data
Right 1161267347 19:3370384-3370406 TCCCCCTCCCCTCTCTGCGGCGG No data
1161267345_1161267347 11 Left 1161267345 19:3370350-3370372 CCTCTGGGTCTCTCTGTGCATCT No data
Right 1161267347 19:3370384-3370406 TCCCCCTCCCCTCTCTGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161267347 Original CRISPR TCCCCCTCCCCTCTCTGCGG CGG Intronic