ID: 1161267447

View in Genome Browser
Species Human (GRCh38)
Location 19:3370885-3370907
Sequence CGCTGTGTGCTCAGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161267447_1161267457 26 Left 1161267447 19:3370885-3370907 CCATCTGCCCTGAGCACACAGCG 0: 1
1: 0
2: 2
3: 26
4: 371
Right 1161267457 19:3370934-3370956 CACATCCATGAGCACACGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 104
1161267447_1161267456 25 Left 1161267447 19:3370885-3370907 CCATCTGCCCTGAGCACACAGCG 0: 1
1: 0
2: 2
3: 26
4: 371
Right 1161267456 19:3370933-3370955 TCACATCCATGAGCACACGCTGG 0: 1
1: 0
2: 0
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161267447 Original CRISPR CGCTGTGTGCTCAGGGCAGA TGG (reversed) Intronic
900182078 1:1315643-1315665 GGCTGTGTCCTCACAGCAGAGGG + Intronic
900331431 1:2136604-2136626 GGCTGTGTGCTTAGGGCAGGTGG + Intronic
900416785 1:2538978-2539000 CCCTGTGTGCACAGCCCAGAAGG + Intergenic
900492718 1:2960566-2960588 CTCTGTGTGGTCAGACCAGAAGG - Intergenic
900492724 1:2960601-2960623 CTCTGTGTGATCAGACCAGAAGG - Intergenic
900492737 1:2960705-2960727 CTCTGTGTGATCAGACCAGAAGG - Intergenic
900492750 1:2960774-2960796 CTCTGTGTGATCAGACCAGAAGG - Intergenic
900492757 1:2960844-2960866 CTCTGTGTGGTCAGACCAGAAGG - Intergenic
902232429 1:15036389-15036411 AGCTGGGTGGTCAGGGCAGGGGG - Intronic
903500109 1:23796021-23796043 AGGTGTGTGCTCAGGGCCCACGG + Intronic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907334263 1:53690080-53690102 CGCAGGGTGCTCACAGCAGAGGG - Intronic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
907479929 1:54738452-54738474 AGCTCTGTGCTCAGGGCAGAAGG - Intronic
907481488 1:54748290-54748312 CTCTGCGGGCTCAGGGCAGAGGG - Intergenic
908393350 1:63703225-63703247 GGCTTTGTGCCCAGGGCAGTGGG + Intergenic
908394606 1:63713961-63713983 ATCTGTGTGTTCAGGGCACATGG - Intergenic
908792230 1:67794264-67794286 CCCTGTGAGCTCAGGAGAGATGG + Intronic
909152002 1:72018748-72018770 TGCAGTGAGCTCAGGGCAGGAGG + Intronic
911819866 1:102404327-102404349 TGCTATGTGATCATGGCAGAAGG + Intergenic
913202629 1:116508194-116508216 CACTGAATGCTCAGGCCAGAAGG - Intergenic
914951711 1:152121155-152121177 CACTGTTAGCTCTGGGCAGAGGG + Intergenic
915557273 1:156667719-156667741 CCCTTTGGGCTCAGGGCTGAGGG - Intergenic
916443346 1:164848830-164848852 CTGTGTGTGCTCAGGGGAGCAGG + Exonic
918303868 1:183228379-183228401 CGCTGTGAGCTCTGTGCTGATGG + Exonic
919297549 1:195721660-195721682 CTCTTTGTTCTCAGGGCAAATGG + Intergenic
919822458 1:201481886-201481908 TGCTGTGGGGTCAGGGCAAAAGG - Intergenic
920365584 1:205446700-205446722 CACTGTGGGCCCAGGGCAGCTGG + Intronic
922909767 1:229205734-229205756 GCCTGTGTGCTCAGGACAGTGGG - Intergenic
923400434 1:233611359-233611381 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
923905354 1:238378158-238378180 AGTTGTGGGCTCAGGACAGATGG - Intergenic
1064782396 10:18856819-18856841 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1066365118 10:34769155-34769177 AGCTGTCTGCACAGGGCTGATGG + Intronic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1066531850 10:36349599-36349621 TGCTGTCTGCTCTGGGCAGCTGG + Intergenic
1067229777 10:44398010-44398032 TGCTGTGGGCTCAGGACCGAGGG - Intergenic
1067570791 10:47369416-47369438 GGCTGAGTGCTGAGGGCACAGGG + Intronic
1067945808 10:50687263-50687285 TGCTGTGTTCTGTGGGCAGATGG - Intergenic
1069633528 10:69911962-69911984 CACTGAGTGCTCCGTGCAGATGG + Intronic
1070676434 10:78414919-78414941 CCCTGTGTGCTGGGGGCTGAGGG + Intergenic
1070694097 10:78549006-78549028 TGATGTGTGCTCTGGGTAGAGGG - Intergenic
1070867324 10:79714136-79714158 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1070881116 10:79852260-79852282 TGCTGTGTTCTGTGGGCAGATGG - Intergenic
1071634239 10:87236359-87236381 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1071647689 10:87368576-87368598 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1072718303 10:97765860-97765882 CCCAGTGGGCTCAGAGCAGATGG - Intergenic
1074610108 10:115013868-115013890 CTCTGTCTGCACATGGCAGAAGG + Intergenic
1076472554 10:130729040-130729062 CGCTGGGGCCTCCGGGCAGACGG + Intergenic
1076998358 11:310415-310437 GGCTGTCGGCTCAGGACAGAGGG + Intronic
1077000384 11:319343-319365 GGCTGTCGGCTCAGGACAGAGGG - Intergenic
1077336795 11:2008888-2008910 CACCGTGAGCTCAGGCCAGAGGG - Intergenic
1077723989 11:4655160-4655182 GGCTATGTGTTCAGGACAGAAGG - Exonic
1079111734 11:17609116-17609138 TGCTCTGTCCTCAGGGTAGAAGG + Exonic
1080563830 11:33489795-33489817 AGCTGTGTGCTCAGGAATGAGGG + Intergenic
1080770095 11:35332716-35332738 GAGTGTGTGTTCAGGGCAGATGG - Intronic
1080895885 11:36448547-36448569 TGCTGGGTGCTGAGGGCACAAGG - Intronic
1081979807 11:47259276-47259298 CGGTCTGGGCTCAGGGGAGAGGG - Intronic
1083184414 11:61008832-61008854 CGCGGTGTGCTCAGGTCAGTGGG + Exonic
1083240496 11:61384503-61384525 TGCTATGTGCTCTGGGCAGGTGG - Intergenic
1083240500 11:61384529-61384551 TGCTATGTGCTCTGGGCAGGTGG - Intergenic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1084185036 11:67467127-67467149 GGCTGTGTGCCCAGGTCACAAGG + Intronic
1084403718 11:68959430-68959452 AGCAGGGTGCTCTGGGCAGAGGG + Intergenic
1085289088 11:75384535-75384557 AGCTGGGTGCTCAGGGGCGAAGG + Intergenic
1085553748 11:77400498-77400520 CACTGAGTCCTCAGTGCAGATGG - Intronic
1085643965 11:78210587-78210609 GGCTGTGTCCTTAGGGAAGAAGG - Exonic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1088470215 11:110182127-110182149 CGCTGAGAGCTCAGAGGAGAAGG - Intronic
1089308044 11:117538958-117538980 GGCTGTGTGCTGGGGACAGAAGG - Intronic
1090141651 11:124271097-124271119 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1090208320 11:124897836-124897858 CACTGTGAGCTCAGAGCAGCAGG - Exonic
1091190601 11:133692591-133692613 CTCTCAGTGCTCAGGGCTGATGG + Intergenic
1091198128 11:133749122-133749144 CACTGTGTGCTGTGGGGAGAGGG + Intergenic
1091312240 11:134582870-134582892 CTGTGTCTGCTCAGGGAAGAAGG - Intergenic
1202819779 11_KI270721v1_random:64070-64092 CACCGTGAGCTCAGGCCAGAGGG - Intergenic
1091963641 12:4720180-4720202 CTCTTTGTTCTTAGGGCAGATGG + Intronic
1092022880 12:5216684-5216706 GGCTGTGTTCTCAGGGCTGCTGG + Intergenic
1092163833 12:6330465-6330487 CGCTGGGGACTCTGGGCAGAAGG - Intronic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1097309898 12:58107176-58107198 GCCTCAGTGCTCAGGGCAGATGG + Intergenic
1100723097 12:97379428-97379450 AGCTGTGTGCTCCGGGCAATAGG - Intergenic
1103911388 12:124354447-124354469 TGCTGGGGGCCCAGGGCAGAAGG + Intronic
1103939581 12:124494577-124494599 CGCCCTGTGGCCAGGGCAGATGG - Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1104985751 12:132596070-132596092 CGCTGAGTGCTCCGGGCCCAAGG - Intergenic
1105642458 13:22279678-22279700 TGCTGTGGGCTCAAGGCAGGGGG + Intergenic
1106742467 13:32660408-32660430 GCCTGTGTGCTCAGGTGAGAAGG + Intronic
1107247947 13:38319894-38319916 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1111195345 13:84869545-84869567 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1111196238 13:84877126-84877148 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1113752421 13:112785459-112785481 CGCTGTGAGCCCTGGGCAGGTGG - Intronic
1113843706 13:113374331-113374353 TGCTCTGTGCTCAGGCCTGAGGG - Intergenic
1115889531 14:38011425-38011447 CTCTTTGTTCTTAGGGCAGATGG - Intronic
1116683767 14:48011587-48011609 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1117353336 14:54901990-54902012 CGCTGGGCGCTCAGGCGAGAGGG + Intronic
1117442369 14:55772014-55772036 CTCTTTGTACTCAGGGCAGAGGG + Intergenic
1119432054 14:74574946-74574968 CTCTGAGTGCTCAGGGGAGGAGG - Intronic
1121455317 14:94035091-94035113 CGCTATGATGTCAGGGCAGAAGG + Intronic
1122319555 14:100845588-100845610 GGCGGTGTGCTCCGGGCAGCTGG - Intergenic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1122640121 14:103155121-103155143 GGTTGTGTGCTGAGGCCAGAGGG + Intergenic
1122855044 14:104556079-104556101 AGCTGTGACCCCAGGGCAGATGG - Intronic
1122923279 14:104888702-104888724 AGGTGGGTGCACAGGGCAGAAGG - Intronic
1123153040 14:106200901-106200923 CGCGGGTTGCTCAGGTCAGAAGG - Intergenic
1123667081 15:22616441-22616463 CAATGTGTCCTCACGGCAGAAGG + Intergenic
1123750670 15:23356162-23356184 CAATGTGTCCTCATGGCAGAAGG - Intronic
1123762799 15:23445817-23445839 CAATGTATCCTCAGGGCAGAAGG + Intronic
1123798206 15:23794862-23794884 CTGTATGTGCTCAGGGCAGCTGG - Intergenic
1124283040 15:28380078-28380100 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124299659 15:28531535-28531557 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124320923 15:28711009-28711031 CAATGTGTCCTCACGGCAGAAGG + Intronic
1124481571 15:30084346-30084368 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124488028 15:30136442-30136464 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124522020 15:30412848-30412870 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124536645 15:30553370-30553392 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124543117 15:30605419-30605441 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124563068 15:30792861-30792883 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1124755499 15:32401879-32401901 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124762008 15:32454222-32454244 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124776621 15:32594846-32594868 CAATGTGTCCTCATGGCAGAAGG - Intronic
1124960222 15:34388338-34388360 CAATGTGTCCTCATGGCAGAAGG + Intronic
1124976851 15:34534559-34534581 CAATGTGTCCTCATGGCAGAAGG + Intronic
1125374173 15:39011425-39011447 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1126119026 15:45234650-45234672 CCCTTTGTTCTTAGGGCAGATGG + Intergenic
1126119967 15:45242660-45242682 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1127008311 15:54594968-54594990 CTCTTTGTTCTTAGGGCAGATGG + Intronic
1129036972 15:72656089-72656111 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129212915 15:74081136-74081158 CAATGTGTCCTCATGGCAGAAGG + Intronic
1129397487 15:75259950-75259972 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129401096 15:75284227-75284249 CAATGTGTCCTCATGGCAGAAGG - Intronic
1129474696 15:75776935-75776957 CTATGTGTCCTCATGGCAGAAGG - Intergenic
1129730052 15:77925452-77925474 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1129838465 15:78728535-78728557 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1129964694 15:79723800-79723822 GGCAGTGTGCTCAGGGTAGCAGG + Intergenic
1130096592 15:80860808-80860830 AGCTGTGTGGTGAGGTCAGAGGG - Intronic
1130260117 15:82348036-82348058 CAATGTGTCCTCATGGCAGAAGG + Intronic
1130268613 15:82431397-82431419 CAATGTGTCCTCATGGCAGAAGG - Intronic
1130281115 15:82520972-82520994 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130332171 15:82930983-82931005 CGGGGTGTGCACAGGGCAGGAGG - Intronic
1130472486 15:84237152-84237174 CAATGTGTCCTCATGGCAGAAGG - Intronic
1130479978 15:84351723-84351745 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130484207 15:84389303-84389325 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1130491792 15:84436406-84436428 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1130503407 15:84515446-84515468 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1130594783 15:85241789-85241811 CAATGTGTCCTCATGGCAGAAGG - Intergenic
1131087479 15:89589026-89589048 AGCAGTGTGTTCAGGGCAGGAGG + Intronic
1131771915 15:95747023-95747045 AGCACTGTGCTCAGGGCTGAGGG - Intergenic
1132433765 15:101780655-101780677 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1132617894 16:851463-851485 CCCTGTGTGGTCAGGGCCGTGGG - Intergenic
1135035830 16:19076027-19076049 TGCTGTATGGCCAGGGCAGACGG - Intronic
1135075959 16:19393755-19393777 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1135076911 16:19401739-19401761 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1135108709 16:19673390-19673412 CGCTGCCTGCACAGGGCAGCTGG - Intronic
1135424353 16:22324923-22324945 CTCTGAGGGCTCAGGGAAGAGGG + Intronic
1136298955 16:29320565-29320587 TGCTGCGAGTTCAGGGCAGAGGG + Intergenic
1137578124 16:49617278-49617300 CACTGGGTGCTCAGGACAGAGGG + Intronic
1137697861 16:50474387-50474409 GGCTGTGTGCCCAGCTCAGATGG + Intergenic
1138247734 16:55479711-55479733 CGCTGTGTGCCCACCGCCGAGGG - Intronic
1138442501 16:57043440-57043462 CTCTTTGTGGTCAGGGCACAGGG - Intronic
1141656610 16:85420090-85420112 AGCAGTGTGCTCAGGCCAGACGG + Intergenic
1141693285 16:85608235-85608257 GGCTGGGGGCTGAGGGCAGATGG + Intergenic
1141777687 16:86135065-86135087 CGCTGTGAGGCCAGTGCAGATGG + Intergenic
1141916230 16:87099066-87099088 AGGTGCGTGCTCCGGGCAGAAGG + Intronic
1142060640 16:88027120-88027142 TGCTGTGAGCTCAGGGCAGAGGG + Intronic
1142204529 16:88776584-88776606 GGCTGTGTGCTCAGGGCATCTGG + Intronic
1142328870 16:89437524-89437546 GACTGTTTGCTCAGGGGAGATGG - Intronic
1142358821 16:89616680-89616702 CGGAGTGTGCTGAGGGGAGAAGG - Intronic
1142401748 16:89862478-89862500 GGCTGTGAGCCCAGGGCAGATGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1143300809 17:5909591-5909613 AGCTGTGAGCCCAAGGCAGAGGG + Intronic
1143513154 17:7406722-7406744 GCCTGGGTGCTCAGGGCAGCAGG - Intronic
1143642634 17:8207815-8207837 GGCAGGGTGCTCAGGCCAGATGG + Exonic
1145972879 17:28967337-28967359 TGCTGTGTGATGAGGGCACAGGG - Intronic
1146002767 17:29141045-29141067 CCCTGTGTGCTGATGGCAGTGGG - Intronic
1146544415 17:33725853-33725875 CTCTGTGGGGTCAGTGCAGAAGG - Intronic
1148284560 17:46375786-46375808 CTCTGTGTGCTCAGGTTATATGG + Intergenic
1148306781 17:46593707-46593729 CTCTGTGTGCTCAGGTTATATGG + Intronic
1148767843 17:50049582-50049604 CGTTGTATGCTGAGGGCAGCAGG + Intergenic
1149105697 17:52961876-52961898 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1151068636 17:71182234-71182256 CCCTGTTTGCCCAGGGCTGAGGG - Intergenic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152337219 17:79705820-79705842 CGCTGAGGGCTCAGGGCTCAGGG - Intergenic
1152491585 17:80638318-80638340 AGCTGTGTGCACAGAGCATACGG - Intronic
1155566219 18:27137590-27137612 AGCTGTGGGCTCTGGGGAGAAGG + Intronic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1160405109 18:78639924-78639946 CGCCGTGTGCACAGTCCAGATGG + Intergenic
1160600915 18:80011987-80012009 CTCTTTGTTCTTAGGGCAGATGG - Intronic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1161513800 19:4685469-4685491 CCCTGTGTAGTCAGGGCAGGCGG + Intronic
1161574648 19:5048825-5048847 GGCTCTCTGCACAGGGCAGACGG - Intronic
1161995045 19:7706878-7706900 AGCTTTGGGCCCAGGGCAGAAGG - Intergenic
1162957351 19:14106880-14106902 GGCTGTGTTCTGTGGGCAGAGGG + Exonic
1163394676 19:17052768-17052790 CCCTGTTTGCTCAGGGCTGTTGG - Intronic
1163679823 19:18674721-18674743 GGCTGAGTGCCCAGGGCAGATGG - Intergenic
1165155128 19:33782234-33782256 TGCTGTGAACTCATGGCAGAAGG + Intergenic
1165374598 19:35432821-35432843 CACTGTGTGTTCAGAGAAGAGGG + Intergenic
1165460081 19:35939307-35939329 CACAGTGGGCTGAGGGCAGAAGG - Intronic
1165586682 19:36922743-36922765 CCCTGCCTGCTCTGGGCAGAAGG - Exonic
1165933752 19:39376686-39376708 CGTTCTGTGATAAGGGCAGAAGG - Exonic
1166161736 19:40959113-40959135 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1166960047 19:46491818-46491840 CTCTCTGTGCTCTGGGCAGTGGG - Exonic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168172551 19:54598038-54598060 GGCTCTGTGCTCAGGGCACCCGG + Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1168282270 19:55312056-55312078 CCCCGTGGGGTCAGGGCAGAGGG - Exonic
925599299 2:5591424-5591446 AGCTGTGAGCTCAGGCCAGATGG + Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
926706572 2:15841815-15841837 CCCTGGGAGCTCCGGGCAGAAGG - Intergenic
926800979 2:16660454-16660476 TGCAGTGTGCTGAGGGAAGAGGG - Intronic
927857712 2:26537669-26537691 CCCTCTGGGCTCAGGGCTGAGGG + Intronic
928112789 2:28524121-28524143 GGCTGGGTGGTCAGGACAGATGG + Intronic
929345328 2:40876016-40876038 TACTGAGTCCTCAGGGCAGAAGG - Intergenic
933246734 2:79984646-79984668 GTCAGTGTGCTGAGGGCAGAGGG + Intronic
933362384 2:81304655-81304677 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
933834976 2:86238690-86238712 CTGTGGGTGCACAGGGCAGAAGG + Intronic
934076139 2:88430171-88430193 CGCTGGGTTATCAGGGCAGAGGG - Intergenic
935053394 2:99543839-99543861 CGCTGTTTTCTCATGGAAGATGG + Intergenic
935083213 2:99819796-99819818 CACTGTGTGGTCAGGGGAGCCGG + Intronic
935698093 2:105787138-105787160 AGCTGAGTGCTCAGGGCTGAGGG - Intronic
935987528 2:108689148-108689170 GGCTGTGTGCCCTGGGCATATGG - Intergenic
936126354 2:109791845-109791867 GGCTGTGTGCCCTGGGCATATGG - Intergenic
936218339 2:110579623-110579645 GGCTGTGTGCCCTGGGCATATGG + Intergenic
937259230 2:120574839-120574861 GGCGGTGTGTTCAGGGCTGAGGG - Intergenic
937715181 2:125024381-125024403 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
939185944 2:138861108-138861130 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
939377274 2:141384897-141384919 CTCTTTGTTCTTAGGGCAGATGG - Intronic
942830965 2:180237242-180237264 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
944517983 2:200531503-200531525 ATCTGTGTCCTCAGGGGAGAGGG + Intronic
947588843 2:231373093-231373115 CACTCTGTGCTCAGGGAAGAAGG + Intronic
947700787 2:232232281-232232303 GGCTGCGTGCTCAGGGCAGCAGG + Intronic
947859638 2:233349347-233349369 CACTTTCTGCTCAGGGCAGCTGG - Intergenic
948524113 2:238559914-238559936 AGCTGTGGGCTGAGGGCTGAGGG - Intergenic
948710224 2:239820729-239820751 CACTGTGTGCTCAGTGCTGGTGG - Intergenic
1169083057 20:2809226-2809248 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1170702814 20:18718922-18718944 AGCTCTCTGCTCAGGGCAGAAGG - Intronic
1170799550 20:19579709-19579731 GGCAGAGTGTTCAGGGCAGAGGG + Intronic
1172450732 20:35020834-35020856 TGATGTGGGCTCAGGGCAGTGGG - Intronic
1172698340 20:36837230-36837252 GGCTGAGTTCTGAGGGCAGAGGG + Intronic
1172872347 20:38143622-38143644 CACTGGGTGCTCCTGGCAGACGG + Intronic
1172966648 20:38840278-38840300 TGCTGTGAGCTCAGGGGAGTGGG - Intronic
1174191337 20:48742802-48742824 CGCTGTGTCCTCAGGGTCCAGGG + Intronic
1174331672 20:49824764-49824786 CACAGTGTGCTCAAGGAAGATGG + Intronic
1174877960 20:54248107-54248129 GGCTTTGTGGCCAGGGCAGAGGG - Intergenic
1175541443 20:59750596-59750618 CGGTGTGTGGGCAGGGAAGACGG - Intronic
1175804324 20:61819051-61819073 CTCTGTCTGCTCAGGGCATGTGG - Intronic
1176295433 21:5069640-5069662 AGCTGTGTGTCCAGGGAAGAAGG + Intergenic
1176870610 21:14080641-14080663 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1179624948 21:42643767-42643789 AGGTGTTTGCTCAGGTCAGAGGG - Intergenic
1179724456 21:43334026-43334048 GGCTGTGCACTCAGGGCAGGAGG + Intergenic
1179861617 21:44192484-44192506 AGCTGTGTGTCCAGGGAAGAAGG - Intergenic
1179919161 21:44498184-44498206 AGCTGTCTGCTTAGGGCAAAGGG + Exonic
1180181640 21:46120884-46120906 CTCAGTGTGCTCAGGGCTGAAGG + Intronic
1180187430 21:46146420-46146442 ACCTGTGTGCTCGGGGCAGGGGG - Intronic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181637839 22:24182454-24182476 AGCTCCGTGCTCAGGGCAGAAGG - Intronic
1182116853 22:27761644-27761666 GGCTCTGTGCCCAGGGCAGAAGG - Intronic
1182321959 22:29483418-29483440 CGCTATGCGCTCAGCGCAGGAGG + Exonic
1183051588 22:35266213-35266235 CACTGTCTGCTTAGGGCAGTTGG + Intronic
1183311297 22:37111051-37111073 TGCTGTGTGCTGTGGGCATATGG + Intergenic
1184443248 22:44531864-44531886 GGGGGTGTGCTCAGGGGAGAGGG - Intergenic
1184760666 22:46542312-46542334 TGCTGTGGGCTCAGGGCAATGGG + Intergenic
1184795338 22:46728855-46728877 CAGGGTGTGCTGAGGGCAGAGGG + Intronic
1185416888 22:50715458-50715480 GGCTGTGTGGGCAGTGCAGATGG - Intergenic
949895451 3:8764781-8764803 GGCTGTGTGCTTGGGGCAGCGGG + Intronic
950553591 3:13682224-13682246 CGCTGTGTGGTCCGGGCAGGAGG + Intergenic
953075306 3:39564587-39564609 CGTTGTGTGCTCTGGGAAGCAGG + Intergenic
953621259 3:44534879-44534901 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
954883209 3:53849774-53849796 AGCTGGGTACTCCGGGCAGATGG + Exonic
955087555 3:55717943-55717965 GGCTTTGTGCTCAGTGCACAGGG + Intronic
955408651 3:58641975-58641997 CGCTGTGGGGTGAGGGCAGATGG + Intronic
956557009 3:70535421-70535443 CGATGTCTGCTCTGGGCACAGGG - Intergenic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957522023 3:81330076-81330098 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
957694577 3:83618583-83618605 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
960594501 3:119395771-119395793 AGCTATGTGCGAAGGGCAGAAGG + Intronic
960973719 3:123156606-123156628 TGCTGGGTGCTCTGGGCAGCAGG + Intronic
961144703 3:124584503-124584525 CGCTGTGGGCACGGGGCAAACGG - Intronic
961431974 3:126889956-126889978 CGCTGTCAGCTCAGGGCTGCTGG - Intronic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
962811617 3:138963290-138963312 CGGTGGGTGCTCAGGGCTGCAGG - Intergenic
964269883 3:154944513-154944535 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
964512716 3:157470628-157470650 GGCTGTGTGCTAAGGGGTGAGGG + Intronic
965024511 3:163283363-163283385 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
966919891 3:184604469-184604491 CGCTGCGTGCTCTAGGCAGCGGG + Intronic
968616431 4:1579559-1579581 CTCTGTGTGACCAGGGCGGATGG + Intergenic
969577688 4:8046184-8046206 CGCTGTGTCCCCTGGGCTGATGG + Intronic
969597729 4:8158491-8158513 CGCTCCGGGCGCAGGGCAGAGGG + Intronic
969671943 4:8594480-8594502 TGCTGTGTGACCTGGGCAGATGG + Intronic
969909408 4:10429416-10429438 CTGTGTGTGCTCAGGCCATATGG + Intergenic
969968605 4:11022758-11022780 TGCTGGATGCACAGGGCAGAGGG - Intergenic
970766574 4:19556489-19556511 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
971082193 4:23226464-23226486 AGATGTGTGTCCAGGGCAGAAGG + Intergenic
971291532 4:25345921-25345943 CTGTCTGTGCTCAGGGCACAGGG + Intronic
974515248 4:62899453-62899475 AGCTGTGTGTTCAGGACACAAGG + Intergenic
976306574 4:83565841-83565863 CGCTTTGTTCTTAGGGCAAATGG + Intronic
978368051 4:108003275-108003297 GGCTGTCTGCACATGGCAGAAGG + Intronic
979126580 4:116980613-116980635 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
981541925 4:145854911-145854933 CCCTGAGAGCTCAGTGCAGAGGG - Intronic
985489345 5:170193-170215 CACTGAGTGCTGTGGGCAGATGG + Intronic
985589293 5:756441-756463 GGCTGTGTGTGCAGGGCCGATGG - Intronic
985604010 5:849105-849127 GGCTGTGTGTGCAGGGCCGACGG - Intronic
985909738 5:2869498-2869520 GGATGTGTGCTGAGGGAAGATGG + Intergenic
986258501 5:6122251-6122273 AGCTGGGGGCTCAGAGCAGAGGG + Intergenic
986313312 5:6570941-6570963 TGATGTGTGCTCAGGACAGCTGG - Intergenic
986811507 5:11364717-11364739 CGGTGTGTGCTGGCGGCAGAGGG + Exonic
987215651 5:15734181-15734203 AGCTGTGTGCTCAGCGCAGCTGG - Intronic
987224330 5:15823845-15823867 CAAAGTGTGCTCAGGGCAGGTGG - Intronic
988649147 5:33129271-33129293 CGCTGTTTGATCAGAGCAGGAGG + Intergenic
991607940 5:68422078-68422100 CGATGTGTTCTAAGGGCAGAGGG + Intergenic
992084393 5:73265021-73265043 CGCACTGTTCTCATGGCAGAGGG + Intergenic
994917482 5:105999136-105999158 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
995338138 5:111026081-111026103 CACTGTGTCCTCATGGTAGAAGG - Intergenic
996728816 5:126697564-126697586 TGCTGTGTCCACATGGCAGAAGG + Intergenic
996751154 5:126890134-126890156 CGCTGTGTTATCTGAGCAGAGGG + Intronic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
1001009545 5:168085607-168085629 GGCTGAGTGCTCAGGGAAGGGGG - Intronic
1002405638 5:179027955-179027977 CCCAGAGTGCCCAGGGCAGAGGG - Intronic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003181837 6:3798715-3798737 TGCTGTGTACTCAGGGCTCACGG - Intergenic
1003572212 6:7263136-7263158 CACTGTGTGTTCTGGGCAGTGGG - Intergenic
1003905960 6:10699946-10699968 TGCTGTGTCCTCATGGTAGAAGG + Intronic
1004146957 6:13076867-13076889 CTCTGAGAGGTCAGGGCAGAGGG + Intronic
1004282881 6:14295879-14295901 CGCTCTCTACTAAGGGCAGAGGG - Intergenic
1004558871 6:16728259-16728281 AGCTGTGCGCACAGGGCAGTGGG + Intronic
1006432317 6:34005197-34005219 GGCTGTGGGCCCAGGGCAGTGGG - Intergenic
1006452767 6:34114651-34114673 GGCAGTGTCCTCAGGGTAGAGGG - Intronic
1007473816 6:42106550-42106572 CGCTGTGTTCTCTGGGCTGGGGG + Exonic
1009384238 6:63069264-63069286 AGGTGTGTGCTCAGGAGAGAAGG + Intergenic
1010335607 6:74679661-74679683 TGCTGTGTTCTCAGGGCAAATGG + Intergenic
1013179359 6:107705408-107705430 AGGGGTGTGCTCAGGGCATATGG + Intronic
1013976016 6:116079702-116079724 CACTGTGTGCCCTGAGCAGATGG + Intergenic
1015152714 6:130056541-130056563 AGCTGTGTGCCTAGGGCAGGTGG - Intronic
1015629277 6:135215314-135215336 AGTTGTGTGCTCAGGGCACCAGG - Intronic
1016814605 6:148292288-148292310 AGCTCAGAGCTCAGGGCAGATGG - Intronic
1017731676 6:157323068-157323090 CGCTGTGGTCCCAGGGGAGAGGG - Intronic
1018649161 6:165976938-165976960 CGATGTGTGCTGACAGCAGAGGG - Intronic
1018922112 6:168182531-168182553 CGCTGTGTGCTTGGGGGAAACGG + Intergenic
1019038693 6:169084615-169084637 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1019700153 7:2470892-2470914 CGCTTTGTGCTGAGGGCGGTGGG + Intergenic
1020279444 7:6642918-6642940 GGCTGGGGGCTCAGGGCAGCTGG + Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1021129208 7:16890814-16890836 GGCTGGATGCTCAGGGCAAATGG - Intergenic
1022452076 7:30524876-30524898 CAATGTGTCCTCATGGCAGAAGG + Intronic
1022865540 7:34415168-34415190 CGCTGTATGCTGTGGGCAAAGGG - Intergenic
1024330172 7:48147427-48147449 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1024335329 7:48201090-48201112 CTCTTTGTTCTTAGGGCAGATGG + Intronic
1024521093 7:50304550-50304572 CGCTGTGCGCGCGGGGCAGCCGG + Intronic
1024617370 7:51127076-51127098 AGCTGTGTGCTCAAGGCCGTGGG + Intronic
1026173681 7:67976978-67977000 CGCTCTGTTCCCAGGGTAGAGGG + Intergenic
1028213081 7:88099396-88099418 CACTGTGTGCTCAGGTTAGCCGG - Intronic
1031987776 7:128174491-128174513 CGGTGTGTGCTGAGAGCAGCGGG + Intergenic
1032697874 7:134353375-134353397 CGGTCTGTGGTCCGGGCAGAGGG - Intergenic
1032983270 7:137309381-137309403 TGCTGAGTGATCAGGGCAGTTGG + Intronic
1035640895 8:1184505-1184527 CGCGCTGTTCTCAGGGCAGTTGG + Intergenic
1035739601 8:1916194-1916216 CTCTGTGTCCTAAGTGCAGACGG + Intronic
1035904255 8:3491993-3492015 CTCTTTGTTCTCAGGGCAAATGG + Intronic
1036695992 8:10975510-10975532 AGCCGTGTGCCCAGGGCAGGTGG - Intronic
1038491586 8:27975769-27975791 GCCTGAGTCCTCAGGGCAGACGG + Intronic
1038610492 8:29056194-29056216 TGGTGTGTGATCAGAGCAGAGGG + Intronic
1041965587 8:63670699-63670721 GGCTGTGTGCTCCAGGGAGACGG - Intergenic
1042914293 8:73859898-73859920 CTGTGTGTGCTTAGGGGAGATGG - Intronic
1043295310 8:78654481-78654503 CTCTTTGTTCTTAGGGCAGAGGG - Intergenic
1044477465 8:92645324-92645346 CTCTGTATGCACATGGCAGAAGG + Intergenic
1047247242 8:123156549-123156571 CGCTGTTTGACCTGGGCAGAAGG + Intergenic
1049270907 8:141695756-141695778 TGCTGGCTGCTCAGGGCAGTGGG - Intergenic
1049446883 8:142635282-142635304 AGCAGTGTGCCCAGGGCAGTAGG + Intergenic
1049450995 8:142661413-142661435 CCCTGAGTGCTCAGGCCTGAGGG - Intronic
1049772611 8:144390753-144390775 CACTGTGTGCCCAGGGCACCAGG - Intronic
1052532525 9:29706120-29706142 ATGTGTGTGCTCAGGGCAGGCGG + Intergenic
1052774663 9:32721447-32721469 CGGTGTGTGCTCACTGCAGTAGG + Intergenic
1053073595 9:35115244-35115266 CTCTGAGTGCCCAGGCCAGAAGG + Intronic
1056697048 9:88867618-88867640 AGCTTTGTGCTCTGGGGAGAGGG + Intergenic
1056762609 9:89425872-89425894 AGCTGTTGGCTCAGGGCAGGTGG - Intronic
1057353134 9:94316801-94316823 TGCTGTGTTCTGTGGGCAGATGG + Intergenic
1057654613 9:96940790-96940812 TGCTGTGTTCTGTGGGCAGATGG - Intronic
1059368840 9:113808599-113808621 CCCTGTGTGTTCAAGGCAGCAGG - Intergenic
1060047749 9:120354021-120354043 AGCTGAGAGCACAGGGCAGAGGG + Intergenic
1062207668 9:135346315-135346337 CGCTGTGTTCTCAGGGGTGTCGG - Exonic
1185644010 X:1604212-1604234 AGCTGTGTGCGCAAGACAGAAGG + Intergenic
1186515577 X:10164221-10164243 GGCTGAGTGCTCAGGGCTGAGGG + Intronic
1186515759 X:10165201-10165223 GGCTGAGTGCTCAGGGCTGAGGG - Intronic
1186600709 X:11034136-11034158 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1186955611 X:14678687-14678709 TGCTGTGAGGTCAGGGCTGAGGG + Intronic
1189873620 X:45410568-45410590 TGCTATGTGTTCAGGCCAGAGGG - Intergenic
1190744813 X:53316172-53316194 GGCTGTGTGCACAGCGCAGGAGG - Intronic
1192865870 X:75131786-75131808 TGCTGTGGGCCCAGGTCAGAGGG - Intronic
1193018172 X:76759376-76759398 CGCTGTGGGCTGGGGGAAGAGGG + Intergenic
1194387411 X:93273356-93273378 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1196378748 X:115066336-115066358 AGCTGTGTGCCCAGGACAAAGGG + Intergenic
1199677357 X:150199592-150199614 CACTGTGGACTCAGGGGAGAGGG - Intergenic
1200872846 Y:8121997-8122019 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1201765868 Y:17573155-17573177 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1201783195 Y:17745209-17745231 CTCTTTGTTCTCAGGGCAGCTGG - Intergenic
1201818358 Y:18160778-18160800 CTCTTTGTTCTCAGGGCAGCTGG + Intergenic
1201835684 Y:18332834-18332856 CTCTTTGTTCTTAGGGCAGATGG - Intergenic
1202113254 Y:21446428-21446450 CTCTTTGTTCTTAGGGCAGATGG + Intergenic
1202133615 Y:21637455-21637477 GTCTGTCTGCTCAGGACAGAAGG - Intergenic
1202373873 Y:24215990-24216012 CAATGTGTCCTCATGGCAGAAGG + Intergenic
1202496908 Y:25454130-25454152 CAATGTGTCCTCATGGCAGAAGG - Intergenic