ID: 1161267458

View in Genome Browser
Species Human (GRCh38)
Location 19:3370939-3370961
Sequence GTGCGCCCAGCGTGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161267458_1161267459 7 Left 1161267458 19:3370939-3370961 CCATGAGCACACGCTGGGCGCAC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1161267459 19:3370969-3370991 CACACTCCCTGACACCCATACGG 0: 1
1: 0
2: 1
3: 9
4: 176
1161267458_1161267461 13 Left 1161267458 19:3370939-3370961 CCATGAGCACACGCTGGGCGCAC 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1161267461 19:3370975-3370997 CCCTGACACCCATACGGACGAGG 0: 1
1: 0
2: 0
3: 2
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161267458 Original CRISPR GTGCGCCCAGCGTGTGCTCA TGG (reversed) Intronic
901004035 1:6163087-6163109 GCTCGCCCAGCGTCCGCTCAGGG + Intronic
901302936 1:8212771-8212793 GTGCACCAAGTGTTTGCTCAGGG + Intergenic
905310281 1:37044181-37044203 GAGTACCCAGCGTGTGCTCAGGG + Intergenic
905405389 1:37728966-37728988 ATGAGTCCAGCCTGTGCTCATGG - Intronic
910193759 1:84620674-84620696 GTTCACCCAGCGTGCGCCCAGGG - Intergenic
915953566 1:160205693-160205715 GAGCGCCGAGCGTGTGCTGGAGG + Intronic
916407862 1:164515295-164515317 GTGCATCCAGCCTGTGCTCCAGG + Intergenic
919756807 1:201071115-201071137 GTGCCCCCACCGTCTGATCACGG - Intronic
923764283 1:236878772-236878794 TTATGCCCAGTGTGTGCTCAGGG - Intronic
1062955089 10:1534856-1534878 GTGGGGCCAGGGTGTGGTCAGGG - Intronic
1062955614 10:1538530-1538552 GTGCGTCCAGCATGTCCTCTGGG - Intronic
1065703507 10:28448165-28448187 GTGCACCCAGCCCGTGCTGATGG + Intergenic
1069720896 10:70548769-70548791 TTGGGCCCAGCTTTTGCTCAGGG + Intronic
1069785150 10:70983068-70983090 GTGTGCCCATCCTGTGCACACGG - Intergenic
1074121675 10:110498066-110498088 GCGCGCCCCGCGGGTGCCCACGG - Exonic
1076611681 10:131730001-131730023 GGGCCTCCAGCCTGTGCTCATGG + Intergenic
1076680901 10:132170637-132170659 CTGCTCCCAGCGTGTGTCCATGG + Intronic
1079136345 11:17777887-17777909 GCACGCCCAGCGTGTGCACGTGG + Intronic
1081529007 11:43945151-43945173 GTTGGGCCAGCGTGTTCTCAGGG - Intergenic
1084512834 11:69616798-69616820 GTGCACCCTGCAGGTGCTCACGG - Intergenic
1084723346 11:70923994-70924016 GTGAGCCCCGTGTCTGCTCAGGG + Intronic
1085442503 11:76577432-76577454 GTGCCCCCAGCCTGAGCTCTGGG + Intergenic
1090968311 11:131617542-131617564 ATGAGGCAAGCGTGTGCTCAAGG + Intronic
1091218944 11:133919480-133919502 GTGCGCCCGCCGAGAGCTCAGGG + Intronic
1094588235 12:31797456-31797478 GTGAGCTGAGCCTGTGCTCAAGG - Intergenic
1096881034 12:54670881-54670903 GTGCAAACAACGTGTGCTCAAGG - Intergenic
1100002260 12:89851421-89851443 GTGTGTCAAGCTTGTGCTCAGGG + Intergenic
1110111235 13:71748548-71748570 GTGCCCCCAGAGTGAGCTCAAGG - Intronic
1113853499 13:113431242-113431264 GTGGGCCCAGCCTGGGCTTAGGG - Intronic
1115912605 14:38272931-38272953 GTGCGCCTGGCCTGTGCTCAGGG - Intergenic
1120866865 14:89302616-89302638 GTGTGGCCTGTGTGTGCTCAGGG - Intronic
1122770996 14:104097583-104097605 GTGCCCCCAGCAGGTTCTCACGG - Exonic
1127644464 15:60945981-60946003 GTGAGCCCAGCCTGAACTCAGGG - Intronic
1128257987 15:66212378-66212400 ATGCACCCAGCTTGTGCTGATGG - Intronic
1132668167 16:1091213-1091235 GTGCACCCAGCGTGGGCTCATGG - Intronic
1132787732 16:1667295-1667317 GTGCACCCTGCGGCTGCTCATGG + Intronic
1132937337 16:2487841-2487863 GTGGGTCCTGCCTGTGCTCAGGG + Intronic
1132995329 16:2819647-2819669 AGGCACACAGCGTGTGCTCAAGG - Intronic
1136118489 16:28112077-28112099 GTGCAGCCAGCGGGTGCTGAAGG - Intronic
1136282017 16:29218886-29218908 GTGCTGCCAGGGTGTGTTCAGGG + Intergenic
1136680163 16:31956168-31956190 GTGCCCCCAGGTTGTCCTCAAGG - Intergenic
1136780505 16:32897712-32897734 GTGCCCCCAGGTTGTCCTCAAGG - Intergenic
1136889902 16:33961936-33961958 GTGCCCCCAGGTTGTCCTCAAGG + Intergenic
1140206124 16:72935176-72935198 CTGCGCATAGCGGGTGCTCAAGG + Intronic
1141662002 16:85446514-85446536 GTGGGCCCAGCGTTGGCTCTGGG + Intergenic
1142079068 16:88138378-88138400 GAGCGCCCAGCGGGTTGTCAAGG + Intergenic
1142086393 16:88184802-88184824 GTGCTGCCAGGGTGTGTTCAGGG + Intergenic
1203083132 16_KI270728v1_random:1161678-1161700 GTGCCCCCAGGTTGTCCTCAAGG - Intergenic
1142558427 17:795361-795383 GGGCACCCAGCGTGAGCTCCAGG - Intergenic
1143203663 17:5129020-5129042 GGGCGCCCGGTGAGTGCTCAGGG - Exonic
1143420410 17:6786935-6786957 GTGTGCCCTGCGTGTATTCAAGG + Exonic
1143452245 17:7043036-7043058 GGCCCCCCAGCGCGTGCTCAGGG + Exonic
1144036183 17:11367942-11367964 GTCCGGCCAGCATCTGCTCAAGG - Intronic
1145038391 17:19557556-19557578 GTGGGCCCAGGGTATGTTCACGG + Intronic
1145116878 17:20218533-20218555 GAGAGCCCTGCCTGTGCTCAGGG - Intronic
1145258042 17:21338259-21338281 GTGAGCCCAGCATCTGCTCATGG + Intergenic
1145318595 17:21749747-21749769 GTAAGCCCAGCATCTGCTCATGG - Intergenic
1146492921 17:33294928-33294950 GTGCTCCCAGCCTGGTCTCAAGG + Intronic
1149775169 17:59351529-59351551 GTGTGCCCAGGGTGTGATGAAGG + Intronic
1151317912 17:73335267-73335289 GTGTGCCCAGCATGGGCTCCTGG + Exonic
1152562244 17:81084358-81084380 TTGTGACCAGCGTGTGCCCATGG + Intronic
1161267458 19:3370939-3370961 GTGCGCCCAGCGTGTGCTCATGG - Intronic
1161356071 19:3820217-3820239 CTGGGCCCAGCCTCTGCTCATGG - Exonic
1161573210 19:5041475-5041497 GTGGGGCCAGGGTGAGCTCAGGG - Intronic
1162334626 19:10052850-10052872 GGGAGCTCAGCGTCTGCTCAGGG - Intergenic
1164479938 19:28603415-28603437 CTGCGCCCAGCCTGTTCACAGGG + Intergenic
1165831877 19:38734568-38734590 GGGTGCCCAGTCTGTGCTCAAGG + Intronic
1166102282 19:40577744-40577766 GCGCGCCCGGCCTGTGATCAAGG - Intronic
1167037600 19:47003305-47003327 GTGTGCACAGAGGGTGCTCATGG + Exonic
1167591957 19:50409021-50409043 GAGGGGCCTGCGTGTGCTCATGG + Intronic
1167765452 19:51479442-51479464 CTGTGTCCAGCCTGTGCTCAGGG + Intronic
925838215 2:7966093-7966115 GTGCAGCCAGTGTGAGCTCAAGG - Intergenic
926737148 2:16082276-16082298 GTGTGCAGAGCCTGTGCTCAGGG + Intergenic
941678253 2:168367102-168367124 GTGCTCCCAGGGTCTGCTCCAGG - Intergenic
948216454 2:236236987-236237009 GCCCTCCCAGCGTGTGCTCCGGG - Intronic
948968049 2:241400123-241400145 GTGCAGCCAGAGTGTGCTCCAGG - Intronic
1169216515 20:3797362-3797384 GTGAGCCCAGGGTGTGAGCAAGG - Intronic
1169463413 20:5816777-5816799 CTGCGCCCAGCCTATCCTCAGGG - Intronic
1172116363 20:32575681-32575703 GTCCGCCCTGCTAGTGCTCATGG + Intronic
1172182283 20:33010846-33010868 GTGCACCCAAGGTGGGCTCATGG + Intronic
1172303140 20:33863585-33863607 GTGGGCCCAGTGTGGCCTCAGGG + Intergenic
1174339892 20:49889038-49889060 GTGCGTGGAGCGTGTGCTCCAGG - Exonic
1175642337 20:60641368-60641390 GAGTGCCCACTGTGTGCTCATGG + Intergenic
1176426338 21:6550893-6550915 GAGCGCCCAGTGTGTGCTGTGGG + Intergenic
1179096391 21:38319621-38319643 TTGCTCCCAGAGTTTGCTCAAGG - Intergenic
1179701829 21:43159210-43159232 GAGCGCCCAGTGTGTGCTGTGGG + Exonic
1179928562 21:44551820-44551842 CTGTGCCCAGCGTGAGCTCTGGG + Intronic
1180038521 21:45263715-45263737 GTGTGGCCTGGGTGTGCTCAAGG - Intergenic
1181306427 22:21919850-21919872 GTGAGCCCAGCGTGGGCACCGGG - Exonic
1182627974 22:31662237-31662259 GTGCGCCCAGCGTGTGAAGGGGG - Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
1185047566 22:48536739-48536761 GTGCGCGCCGCCTGTGCCCATGG - Intronic
956681442 3:71785213-71785235 GTGCCCCCCGCGTGTGCTGCCGG - Intergenic
966852037 3:184170460-184170482 GGGCGCCCAGCGAGCGCTCAGGG + Exonic
968283817 3:197496552-197496574 ATGGGCCCAGCATGTCCTCAGGG - Intergenic
968572548 4:1349683-1349705 CTGTGCCCAGCGTGAGCTCCAGG - Exonic
982460931 4:155667718-155667740 GCGCGCCCCGCGCGTTCTCACGG - Intronic
982916951 4:161224198-161224220 GTGTTTCCAGCATGTGCTCAAGG + Intergenic
991415971 5:66393262-66393284 GTGAGCCCGGCATGTTCTCACGG - Intergenic
995060632 5:107808655-107808677 GTGCTCCCAGAGTGTGCACATGG + Intergenic
1002536959 5:179881090-179881112 GTGCAGCCAACGTGTGCTCCTGG + Intronic
1003359206 6:5408241-5408263 CTGAGCCCAGCCTGTGCTCCTGG + Intronic
1006298067 6:33178863-33178885 CTGAGCCCAGCGTGGGCTGAAGG + Intronic
1024528949 7:50374592-50374614 GTGTGCCCAGCGTGTGGTATTGG + Intronic
1026766115 7:73160891-73160913 GTGAGCCCAACGTGCCCTCAGGG - Intergenic
1027042590 7:74970587-74970609 GTGAGCCCAACGTGCCCTCAGGG - Intronic
1027081053 7:75231770-75231792 GTGAGCCCAACGTGCCCTCAGGG + Intergenic
1034479618 7:151309249-151309271 GCTGGCCCAGCGGGTGCTCAGGG + Intergenic
1045354848 8:101376516-101376538 GTGCACTCAGTGTGTGCTGAAGG + Intergenic
1045650685 8:104339163-104339185 GTGTGCCCAGCCTGAGCCCAAGG + Intronic
1045651745 8:104347890-104347912 GTGGGCCCAGCGTATTCACAAGG + Intronic
1048319536 8:133387700-133387722 GAGCCCCCAGGGTGTGGTCAAGG - Intergenic
1049828385 8:144685041-144685063 GTGTGCCCAGCCTGAGCTCGGGG - Intergenic
1049834001 8:144721346-144721368 GTGAGCCCAGCTGGTGCTCTGGG - Exonic
1062133381 9:134912356-134912378 GTGCCACCTGAGTGTGCTCAGGG + Intronic
1062211049 9:135364310-135364332 GAGCGCTCAGCGAGTGCTCAGGG + Intergenic
1062585228 9:137246235-137246257 GTGGGCCCTGCGTGTGTCCAAGG - Intronic
1185609788 X:1387479-1387501 CGGCCCCCAGGGTGTGCTCACGG + Intronic
1196711633 X:118769712-118769734 GTGAGCCCAGGGGATGCTCATGG - Intronic
1197172338 X:123448296-123448318 GCTCCCCCAGCCTGTGCTCATGG - Intronic