ID: 1161267458

View in Genome Browser
Species Human (GRCh38)
Location 19:3370939-3370961
Sequence GTGCGCCCAGCGTGTGCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161267458_1161267461 13 Left 1161267458 19:3370939-3370961 CCATGAGCACACGCTGGGCGCAC No data
Right 1161267461 19:3370975-3370997 CCCTGACACCCATACGGACGAGG No data
1161267458_1161267459 7 Left 1161267458 19:3370939-3370961 CCATGAGCACACGCTGGGCGCAC No data
Right 1161267459 19:3370969-3370991 CACACTCCCTGACACCCATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161267458 Original CRISPR GTGCGCCCAGCGTGTGCTCA TGG (reversed) Intronic