ID: 1161270310

View in Genome Browser
Species Human (GRCh38)
Location 19:3386006-3386028
Sequence TATAATCAGAATGAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 314}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161270310_1161270316 15 Left 1161270310 19:3386006-3386028 CCATCCTCCTCATTCTGATTATA 0: 1
1: 0
2: 1
3: 36
4: 314
Right 1161270316 19:3386044-3386066 ACCTTTCCTTATGCATTCCCTGG 0: 1
1: 0
2: 1
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161270310 Original CRISPR TATAATCAGAATGAGGAGGA TGG (reversed) Intronic
901916172 1:12502331-12502353 TGGAATCTGAGTGAGGAGGAGGG + Intronic
902981325 1:20125544-20125566 AATAATGAGGATGAGGATGATGG + Intergenic
903096521 1:20980627-20980649 TACAATGAGAATGAAGAGAAAGG + Intronic
903557524 1:24204409-24204431 CAGACTCAGAATGAGGAGGAAGG - Intergenic
903864758 1:26389912-26389934 TAGGAGCAGAATGAGGAGGAAGG + Intergenic
907832388 1:58077458-58077480 AATAATGAGAATGAAGAAGAAGG + Intronic
907971823 1:59390604-59390626 TATAATCAAACTGAGGTGAAGGG + Intronic
908153045 1:61324266-61324288 TATAAACAGCGTGAGAAGGAGGG + Intronic
908318843 1:62961634-62961656 TGAAATCAGAATGGGGAGGAGGG - Intergenic
908698155 1:66868509-66868531 TAGAATTAGAAGGTGGAGGAAGG + Intronic
909078791 1:71084769-71084791 TATAATAAGAATAAAGAGAATGG - Intergenic
909345853 1:74585965-74585987 AATATTCAGAATGATGTGGAAGG - Intronic
909653682 1:78005300-78005322 TATGATCAGTTTGGGGAGGAAGG + Exonic
909709733 1:78634032-78634054 AAAAAACAGAATGAAGAGGAAGG + Intronic
909779104 1:79520415-79520437 TATAATCACACTGAGGAGAGGGG + Intergenic
911316118 1:96358845-96358867 TATATTAAGAATAATGAGGATGG + Intergenic
912385279 1:109268368-109268390 TATGTAGAGAATGAGGAGGAGGG + Intronic
912497041 1:110098425-110098447 GATAAAAAGAATGGGGAGGAGGG - Intergenic
912806914 1:112764131-112764153 GATACTCAGAATGGGGAGAATGG - Intergenic
913079915 1:115374063-115374085 AAGAATTAGAATGAGGAGGTGGG - Intergenic
913678410 1:121164808-121164830 AATGATCAGATTGAGGATGATGG - Intergenic
914030248 1:143952446-143952468 AATGATCAGATTGAGGATGATGG - Intronic
914159202 1:145115505-145115527 AATGATCAGATTGAGGATGATGG + Intergenic
916986585 1:170198594-170198616 TAATGGCAGAATGAGGAGGAAGG + Intergenic
917534445 1:175864200-175864222 TGTAATCAGAATGGCGACGAGGG + Intergenic
917803765 1:178595192-178595214 TCTAATGAGAATGAGGAAGTAGG - Intergenic
918337767 1:183537468-183537490 AATAGTAAGAATGAGGAGGAAGG - Intronic
918604048 1:186400284-186400306 AATAATAAGAATGGGGAGGCCGG - Intronic
918648600 1:186930997-186931019 TAAAGTTAGAATGAAGAGGAGGG - Intronic
918822758 1:189277952-189277974 TGTAATCAGAAATAAGAGGATGG + Intergenic
919718536 1:200806961-200806983 GACAATCAGAATGAGGAAGAGGG + Intronic
920004694 1:202824394-202824416 TATCAGCAGTATGAGGAGGAAGG + Intronic
920145102 1:203853553-203853575 TATAATCAGGAGGAAGAGGAAGG + Exonic
920286166 1:204881367-204881389 TACAATCAGAAAAAAGAGGAGGG - Intronic
920391148 1:205603157-205603179 TAAAATCAGAATAAGGAATAAGG + Intronic
920465715 1:206183332-206183354 AATGATCAGATTGAGGATGATGG - Intergenic
920770323 1:208878609-208878631 TATATTGAGAATGGGGAGGGTGG - Intergenic
921820198 1:219608452-219608474 TATAATCAGGAGGAAGAGGAAGG - Intergenic
922990658 1:229908240-229908262 AAAAATGAGAATGAGGGGGACGG - Intergenic
924092883 1:240520504-240520526 TATAATCTGAATGAGGAAAAAGG - Intronic
924356036 1:243177054-243177076 TGAAATCAGAATGGTGAGGATGG + Intronic
1064768458 10:18698711-18698733 TACAAGCAGCATTAGGAGGATGG - Intergenic
1066358991 10:34712416-34712438 TGTAATCAGAGTGAGGGTGAAGG - Intronic
1068485000 10:57646506-57646528 TATAATCAGGCTGAGGACGATGG + Intergenic
1069597889 10:69684445-69684467 TATAATTATGATGACGAGGAAGG + Intergenic
1070160494 10:73863905-73863927 TAGAATCAGAATGAGGATCAAGG - Intronic
1070238671 10:74656136-74656158 AATGATCAGATGGAGGAGGATGG + Intronic
1070922803 10:80199028-80199050 TATAATCAGAACGTGGTTGAGGG - Intronic
1071168007 10:82829421-82829443 TATAATCAGAAAGATGATAAGGG + Intronic
1073191281 10:101651997-101652019 TCAAATCCGAATGGGGAGGAGGG + Intronic
1076593867 10:131612386-131612408 TACAATCACAATGAAGAAGAGGG - Intergenic
1077031198 11:468747-468769 GGTAATCAGAGGGAGGAGGAGGG + Intronic
1077031262 11:468988-469010 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031271 11:469020-469042 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031279 11:469052-469074 GGTAATCAGAGGGAGGAGGAGGG + Intronic
1077031298 11:469116-469138 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077031315 11:469180-469202 GGTAATCAGAGGGAGGAGGAGGG + Intronic
1077031331 11:469244-469266 GGTAATCGGAAGGAGGAGGAGGG + Intronic
1077519267 11:3022081-3022103 TATAGGCAGAATGATGAGGCCGG + Intronic
1078189722 11:9083257-9083279 TATAACCATACTGAAGAGGATGG + Intronic
1078856968 11:15214140-15214162 TATAATCAGAAAGGGGAGCAAGG - Intronic
1080344017 11:31301195-31301217 TATATTCAAAAGGAGGAAGATGG - Intronic
1080696659 11:34608669-34608691 GATAGTCAGAGAGAGGAGGAAGG + Intergenic
1081563862 11:44244092-44244114 TTTGAGCAGAATGAGAAGGATGG - Intronic
1083876913 11:65529106-65529128 GAGAATCAGAATCAGGAGCAGGG + Intronic
1085438568 11:76534816-76534838 TATAATCTGAATATAGAGGAAGG + Intronic
1085865632 11:80288292-80288314 CATAAGCAGAATGAGGTGAATGG + Intergenic
1086493132 11:87375831-87375853 CATAATCAGAGAGAGTAGGAGGG + Intergenic
1086646434 11:89227542-89227564 TATAGGCAGAATGAACAGGAGGG + Intronic
1086801815 11:91184934-91184956 TATTATTGGAATGGGGAGGAGGG + Intergenic
1087091506 11:94278395-94278417 TGTAAACAGAATGTAGAGGAGGG + Intergenic
1088197361 11:107289915-107289937 TATAATCAGAAAGATCAGAAGGG - Intergenic
1088828555 11:113515961-113515983 TAGGATCAGAATGAGGGGGCTGG + Intergenic
1089613986 11:119684964-119684986 TACACTCAGGATGGGGAGGAGGG + Intronic
1089643489 11:119863204-119863226 GAGAAGCAGGATGAGGAGGATGG + Intergenic
1090674303 11:128974864-128974886 GACAATGAGAGTGAGGAGGAAGG - Exonic
1093285079 12:17249220-17249242 TTTACTAAGAATGAGGTGGAAGG + Intergenic
1093393388 12:18651080-18651102 TAAAATCAGAGAGATGAGGATGG - Intergenic
1093712913 12:22347996-22348018 TATCATAAGAATCAGGAGGGAGG + Intronic
1094815790 12:34182145-34182167 TATAAACAGAATGAAGGGGTTGG - Intergenic
1098300378 12:69048098-69048120 TATGAGCAGAAAGAGCAGGAGGG - Intergenic
1098763506 12:74454827-74454849 TATAATGATAATGATGACGATGG + Intergenic
1099148439 12:79077273-79077295 TAATATCAGAATTAGGTGGATGG - Intronic
1099530148 12:83769048-83769070 AAAAATCAGAAAGAGGAGAATGG + Intergenic
1101302174 12:103494501-103494523 TAAAATAAAAAGGAGGAGGATGG + Intronic
1104514533 12:129412514-129412536 TGTAGGAAGAATGAGGAGGAGGG - Intronic
1105659132 13:22473588-22473610 TATGATAATGATGAGGAGGATGG + Intergenic
1105724725 13:23151321-23151343 AATAATGAGAATGGGGAGAAGGG - Intergenic
1105794385 13:23835596-23835618 TATAATCAGAATTGGAGGGAAGG + Intronic
1105896337 13:24719653-24719675 AAGAAGCAGAAGGAGGAGGAGGG + Intergenic
1106805586 13:33303159-33303181 TTTCATGGGAATGAGGAGGAAGG - Intronic
1107874557 13:44778765-44778787 TAGAAAGAGAAAGAGGAGGATGG + Intergenic
1108812141 13:54240315-54240337 TTAAAGCAGAATAAGGAGGATGG - Intergenic
1109134850 13:58634573-58634595 TATAAGCAAAATGAAGAGAAGGG - Intergenic
1110366876 13:74696622-74696644 TAGAATCAGAAATGGGAGGAGGG - Intergenic
1110504290 13:76267492-76267514 TAGAAGGAGAAGGAGGAGGAAGG + Intergenic
1110684205 13:78352432-78352454 TATTATCAGTAAAAGGAGGAAGG - Intergenic
1111319553 13:86609207-86609229 AAAAATCACAATGGGGAGGAAGG + Intergenic
1111498041 13:89078833-89078855 TATAATCAGAATGATGAAAGAGG - Intergenic
1116042983 14:39708160-39708182 AATAATCAGAATGTGTAGGATGG + Intergenic
1116669617 14:47823999-47824021 AATAATAAGAATGAAGAAGAGGG + Intergenic
1117675356 14:58150478-58150500 TAGAATCAAAATGAGGAAAACGG - Intronic
1118612037 14:67548969-67548991 TATAATCCATATGAGGTGGAAGG - Intronic
1119061082 14:71475420-71475442 CATCATCACAAAGAGGAGGAGGG - Intronic
1119961580 14:78863834-78863856 TATAATGATGATGAGGAGGAAGG - Intronic
1120354080 14:83406673-83406695 TATACTCAGAATAAGGTGGATGG + Intergenic
1120992391 14:90389100-90389122 GAGAATGAGAATGAGAAGGAAGG + Intergenic
1123197978 14:106635266-106635288 AATAATGAGAAGCAGGAGGAGGG - Intergenic
1124989078 15:34652901-34652923 GATAATGAGTTTGAGGAGGAAGG + Intergenic
1126228802 15:46301201-46301223 TATAATCAGGATAAAAAGGAGGG + Intergenic
1126971380 15:54116034-54116056 TATAATTAAAATGATGTGGATGG - Intronic
1127228759 15:56965472-56965494 CACAATCTGAATGAAGAGGAAGG + Intronic
1127933544 15:63614117-63614139 TATATAAAGAAAGAGGAGGAAGG + Intronic
1127942766 15:63716682-63716704 TTTAATCAAAATAATGAGGAAGG - Intronic
1128846075 15:70896426-70896448 CAAAATCAGAATGGGGAAGATGG - Intronic
1129946411 15:79542719-79542741 TACAATCATAATGATGAAGATGG - Intergenic
1130439385 15:83936384-83936406 AATAATTAGAATGAGAAGAATGG + Intronic
1131745050 15:95438432-95438454 TATGACCAGAATGAGAAAGAAGG - Intergenic
1131901749 15:97095219-97095241 TATAATAAGAAAGTGGAGGAAGG - Intergenic
1132095667 15:98982666-98982688 AATAACCAGAGTGAGGAGGAAGG - Intronic
1132302586 15:100785315-100785337 TGTAGACAGAGTGAGGAGGAAGG + Intergenic
1132416506 15:101623997-101624019 TATGATCACCTTGAGGAGGATGG + Intronic
1132915878 16:2343138-2343160 TATAATCACAATCATGAGGTGGG + Intergenic
1133735078 16:8608780-8608802 TAAAATCATAATGATAAGGAAGG + Intergenic
1137389406 16:48068909-48068931 TATACTCAGAATCTGGAGAAAGG + Intergenic
1137739832 16:50758112-50758134 GATAAACACAGTGAGGAGGAAGG + Intronic
1137914231 16:52411371-52411393 TAGAATTAGAATGAGGGAGAAGG - Intergenic
1143785617 17:9253522-9253544 GATAACGAGAATGAGGAGGCAGG + Intronic
1144116197 17:12094046-12094068 AATAATCAAAATGAGAAAGAAGG + Intronic
1144203911 17:12965574-12965596 TATATTATGAATGGGGAGGAGGG + Intronic
1144226413 17:13152519-13152541 TATAATCAGAATCTATAGGAGGG - Intergenic
1147517395 17:41133941-41133963 TATAATAAGAGTGAGGAGTTTGG + Intergenic
1147546169 17:41403300-41403322 TCTATTGAGAAAGAGGAGGAGGG - Intergenic
1148514108 17:48199988-48200010 AAGAATTAGATTGAGGAGGAAGG + Intronic
1149294188 17:55246423-55246445 TATAATCAGACTGTTGTGGAGGG + Intergenic
1150459443 17:65335614-65335636 TATAAACACAATGAGAAGAAGGG + Intergenic
1151160936 17:72165311-72165333 TATAATGAGAACGAGGACTAGGG - Intergenic
1151223769 17:72633327-72633349 TTTAATAACAAGGAGGAGGAGGG + Intergenic
1153235988 18:2988189-2988211 TATAGTCAGGTTGAGGAGCATGG - Intronic
1153449876 18:5215394-5215416 TATAAGGAGACTGAGGTGGAAGG + Intergenic
1153849807 18:9082804-9082826 TATCAGCAGAATGAGCAGGAGGG + Intergenic
1154255816 18:12779990-12780012 AATAATCAGAATTAGCAAGAAGG - Intergenic
1155123932 18:22852057-22852079 GATAATCAGAATGAGTAAAAAGG - Intronic
1155421605 18:25662612-25662634 TATAATTAGAATAGGTAGGATGG - Intergenic
1155600678 18:27543102-27543124 TACAATCAGAATGACTAAGAAGG - Intergenic
1155831405 18:30519326-30519348 TCTGAACAGAATGAGGAGTAAGG + Intergenic
1156887881 18:42156573-42156595 TAAAAGCAGAAAGGGGAGGAGGG - Intergenic
1158082314 18:53607168-53607190 TAAAATCAGAACTAGAAGGAAGG + Intergenic
1158925118 18:62248826-62248848 TCTACTCAGAGTGATGAGGAGGG + Intronic
1158943358 18:62426626-62426648 GAAAATGAGAATCAGGAGGATGG - Intergenic
1158995946 18:62919786-62919808 TATACTCAAAAAAAGGAGGAAGG - Intronic
1160066752 18:75582823-75582845 TATAATCACAAAAAGGAGGCAGG + Intergenic
1160310392 18:77784578-77784600 TTTACTCAGAGTGGGGAGGAAGG + Intergenic
1161270310 19:3386006-3386028 TATAATCAGAATGAGGAGGATGG - Intronic
1161442573 19:4300680-4300702 TATAACCAGTGTGAGAAGGAAGG + Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164592065 19:29512643-29512665 GAGAACAAGAATGAGGAGGAAGG + Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1167439244 19:49499042-49499064 TATAACCAGAATGGGGATGTGGG + Intronic
1168545648 19:57247655-57247677 AATAATCATGATGAGGACGACGG - Intronic
925224841 2:2174663-2174685 TATAATCTGATTGAGGAAGTAGG - Intronic
925525726 2:4798647-4798669 TATAATTAGAGTGAAGAAGAGGG + Intergenic
926582917 2:14651048-14651070 TATGATGAGGATGAGCAGGATGG - Intergenic
928193484 2:29195426-29195448 TTTAGTCACAATGAAGAGGAGGG + Intronic
928747989 2:34437179-34437201 TACAATCATAATTAGAAGGATGG - Intergenic
929270720 2:39968682-39968704 AATAATCTGGATGGGGAGGAAGG - Intergenic
929368121 2:41186526-41186548 TTTTAACAGAATGATGAGGATGG - Intergenic
929910953 2:46089182-46089204 TAGAATAAGAATGAGGAGGGAGG - Intronic
931168758 2:59779740-59779762 TTTCATCAGAATGAGGAGGAGGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932581464 2:72995029-72995051 TATAATCAGAATTATGATGAAGG - Intronic
932631375 2:73346151-73346173 CATTGTCAGAGTGAGGAGGAAGG - Intergenic
932863713 2:75320167-75320189 TATAAACAGAAATAGGAGGTGGG - Intergenic
933050840 2:77599960-77599982 AGAAATCAGAAAGAGGAGGAAGG - Intergenic
933448840 2:82419576-82419598 CATTAACAGAATGAGGAGGTGGG - Intergenic
935246707 2:101225146-101225168 TATGTTGAGAATGGGGAGGAAGG - Intronic
936492374 2:112983430-112983452 TATGATCGCAATGAGTAGGAGGG + Intronic
936545600 2:113390277-113390299 TATAAACAAAATAAGGAGTAAGG - Intergenic
936889430 2:117351621-117351643 AATAACCAGCATGAGGAGAATGG + Intergenic
937053237 2:118909197-118909219 TATAATTAGAACAAGTAGGAGGG + Intergenic
938964572 2:136376908-136376930 TATTAACTGAAAGAGGAGGAAGG - Intergenic
940988874 2:160077546-160077568 TACAAACAGAATGGGGAGCAAGG + Intergenic
940995009 2:160139459-160139481 TATAAACAGATTTTGGAGGAAGG - Intronic
942895205 2:181045057-181045079 TATAAGCAGAAAGAGAGGGAGGG + Intronic
943309144 2:186305002-186305024 TATACTAAAAATGAGGAGGTAGG - Intergenic
943458679 2:188141572-188141594 CATGATAAGAATGAGCAGGAAGG + Intergenic
944967344 2:204950197-204950219 TATATTCAAAATGGGGAGGGGGG - Intronic
945396067 2:209319997-209320019 TTTAATCAGAATGAGAAGAGAGG + Intergenic
946733750 2:222733927-222733949 TATAATGAGAATGGGGAGCTGGG - Intergenic
1169857096 20:10114742-10114764 TAAAATCAGAATGAGAACCATGG + Intergenic
1169900316 20:10546105-10546127 TATAATCTGAAACAGGAGTATGG - Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1172821263 20:37736900-37736922 TCTAATTACAATGAGGAGTAAGG - Intronic
1172980114 20:38935109-38935131 TATTATCTCAATGGGGAGGAGGG + Intronic
1173125073 20:40328965-40328987 CTGAATCAGAATGGGGAGGAAGG + Intergenic
1173581536 20:44150197-44150219 CATAAAAAAAATGAGGAGGATGG + Intronic
1176669859 21:9723007-9723029 TATCATCGGAAAAAGGAGGAAGG - Intergenic
1177590513 21:23159529-23159551 TATCTTCAGAGTGAGGATGAAGG + Intergenic
1178215336 21:30590976-30590998 TATAACCAAAGTGAGGATGATGG - Intergenic
1179265012 21:39795544-39795566 TCTAGTATGAATGAGGAGGAAGG + Intronic
1180607763 22:17073439-17073461 TAAAGTCAGAATGTGGGGGATGG - Intergenic
1181393435 22:22600530-22600552 TCTACTCAGGATGATGAGGAGGG - Intergenic
1183868086 22:40720119-40720141 TAGAAGGAGAAGGAGGAGGAAGG - Intergenic
1183920178 22:41160131-41160153 AATAATCAAAAGGAGGAAGAAGG - Intronic
1185418810 22:50723796-50723818 TATAATCAGAGTGAGCAGCCTGG + Intergenic
949167469 3:959520-959542 TATAAACAGAATGGGGATGGGGG + Intergenic
949916084 3:8965742-8965764 CATAACTAGAATGAGGAAGATGG - Intergenic
950518512 3:13482480-13482502 TATCATCAGAAGGTGGAGGGAGG + Intronic
952104815 3:30056671-30056693 TATAACCACAATGAGGGGCAGGG + Intergenic
952875829 3:37943499-37943521 AAAAATCAGACTTAGGAGGAAGG - Intronic
953267013 3:41400183-41400205 TAAAATCAGAATAAGGTTGATGG - Intronic
955215603 3:56982813-56982835 CATATCCAGAAAGAGGAGGAAGG - Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955611404 3:60761066-60761088 TATAACCAGAAGAAGGGGGAGGG + Intronic
956017392 3:64897979-64898001 TATTACCAGAATTGGGAGGAAGG - Intergenic
956329209 3:68086630-68086652 TATAATGAGAATGAGGGGAAAGG + Intronic
957982666 3:87530368-87530390 TCTAATCAGAAAGAAAAGGAGGG - Intergenic
959286168 3:104413857-104413879 TCAAATCAGAGTAAGGAGGATGG - Intergenic
961957523 3:130819280-130819302 TATAATAAGAAGTTGGAGGAAGG - Intergenic
964400782 3:156296357-156296379 CAATTTCAGAATGAGGAGGAGGG - Intronic
965476465 3:169161717-169161739 GATAAACAGAATGAGGAGAAAGG + Intronic
965917144 3:173863591-173863613 CATGATCAGAATGAGGAAAAAGG + Intronic
966199581 3:177348016-177348038 TACAATCCAAATGATGAGGAAGG - Intergenic
967034047 3:185634468-185634490 TATGATCACCATGAGGAGGGGGG - Intergenic
971903357 4:32693409-32693431 TATAGTAAGAATGATGAGGGAGG + Intergenic
972939145 4:44176210-44176232 ATAAATCAGAATCAGGAGGAAGG + Intronic
973815637 4:54616657-54616679 TATCATCACATTGAGGATGAGGG - Intergenic
974016079 4:56650402-56650424 GATACTCAGAATGAACAGGATGG + Intronic
974207605 4:58726502-58726524 AAAAATCAGAAGCAGGAGGAAGG + Intergenic
974608223 4:64181400-64181422 TCTAAGCAGAATAAAGAGGAAGG + Intergenic
974928852 4:68337299-68337321 AACACTGAGAATGAGGAGGAAGG - Exonic
975380690 4:73697466-73697488 TCTACTCAGAATGAGGACCATGG - Intergenic
976343843 4:83976924-83976946 TATAATCAGAATGAGTTTGAAGG - Intergenic
977182402 4:93893067-93893089 GTAAATCAGAATGAGGAGAAAGG + Intergenic
977366925 4:96081979-96082001 TATAAACTGCATGAAGAGGAAGG + Intergenic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
979245775 4:118502575-118502597 TGAAATCAGAATGGTGAGGATGG - Intergenic
981223765 4:142268021-142268043 TATTATCAAAATGATGAGGGAGG + Intronic
981964697 4:150585453-150585475 GAAAAACAGAAAGAGGAGGAAGG - Intronic
982840746 4:160182620-160182642 TATAAACACAAGGAGGAGAAGGG - Intergenic
985404920 4:189628523-189628545 TATCATCAGACAAAGGAGGAAGG + Intergenic
986074083 5:4316506-4316528 TTAAATCAGAATCAGGAGGTGGG - Intergenic
987380942 5:17285438-17285460 GTTAATGAGAATGTGGAGGAAGG + Intergenic
988780477 5:34516727-34516749 TATAATCTGGATGAGATGGAGGG - Intergenic
990432518 5:55750436-55750458 TATTCTCAGGAGGAGGAGGAGGG + Intronic
990697207 5:58433547-58433569 TGTAAACAGAAGGGGGAGGAAGG - Intergenic
991480815 5:67077292-67077314 TTAAATCAGAATGGGGAGGGAGG - Intronic
991606378 5:68405776-68405798 TACAATCAAAATGAGGGGGATGG - Intergenic
992685530 5:79195750-79195772 TTTGGTCAGATTGAGGAGGAAGG - Intronic
992846450 5:80753907-80753929 TATAATCAGATTTAGGCAGAAGG - Intronic
993537007 5:89098892-89098914 AATACTCAGAAGGGGGAGGATGG - Intergenic
994563289 5:101406230-101406252 TATAATGAGAATTTGGAGGATGG - Intergenic
995160215 5:108970721-108970743 AATAGGCAGAAGGAGGAGGAGGG + Intronic
998758123 5:145403190-145403212 TATAATCAGAAAAAGGAGATTGG - Intergenic
998885650 5:146691165-146691187 TACAATCTGAAAGATGAGGAGGG - Exonic
999233233 5:150074954-150074976 TATAATGAAAAGGAGGAGGATGG - Intronic
999433516 5:151544183-151544205 TCTTATCAGATTGTGGAGGATGG - Exonic
999567478 5:152880982-152881004 TATGATCAGAACTAGGAGAAAGG - Intergenic
1003495146 6:6657257-6657279 TCTAATCAGAATGAGTAACAGGG - Intergenic
1003769863 6:9288308-9288330 TAGAATAACAATGTGGAGGAAGG + Intergenic
1003970808 6:11297333-11297355 TAATATCAGTGTGAGGAGGAAGG - Intronic
1004185391 6:13416991-13417013 TATGATAAGAATGATGATGATGG - Intronic
1009565435 6:65306110-65306132 TATAATCAGGAGGAAGAGGAAGG + Intronic
1009599394 6:65778905-65778927 ATTAAGCAGAATGAGGAAGATGG - Intergenic
1010294544 6:74181352-74181374 TCTAATCAGAATGATGAGTCAGG + Intergenic
1013521264 6:110935907-110935929 TAGAATCAGAATGGGGAGGGAGG - Intergenic
1014397274 6:120940401-120940423 AATAAAGAGAATGAGGAAGAGGG + Intergenic
1014490721 6:122058497-122058519 TTGAATTAGAATGAGGAGAAAGG + Intergenic
1015153362 6:130063319-130063341 TAGAAGCTGAAGGAGGAGGAGGG + Intronic
1015629976 6:135222435-135222457 TATAATCAGAATAGGGATAACGG + Intergenic
1017183620 6:151577996-151578018 TGAGATCAGAATGGGGAGGAGGG - Intronic
1018360692 6:163064539-163064561 CATAAACAGATTGAGAAGGAAGG - Intronic
1018443608 6:163834961-163834983 TATTACCAGGACGAGGAGGAAGG - Intergenic
1019066636 6:169306230-169306252 TCTAAAAAAAATGAGGAGGAGGG + Intergenic
1019091846 6:169543046-169543068 TGTAAGAAGAATGAGAAGGAAGG + Intronic
1019784154 7:2963471-2963493 TATAATGAGAAAATGGAGGAAGG + Intronic
1020906017 7:14065658-14065680 AAAAAAAAGAATGAGGAGGAAGG - Intergenic
1021603454 7:22387794-22387816 TATAACAAGAAGCAGGAGGATGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1024729901 7:52242517-52242539 AATAATCTGCATGAGGAGGCAGG - Intergenic
1026508455 7:71006950-71006972 AATAAGAAGAAAGAGGAGGAAGG - Intergenic
1026550934 7:71367879-71367901 TTTATTCAGAATAAGGAAGAGGG + Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1027352160 7:77323413-77323435 TATAATCAGTATTTGAAGGAAGG + Intronic
1027609634 7:80344208-80344230 TATAATAATAATGATGATGATGG - Intergenic
1027800585 7:82744912-82744934 TATAATCAGGATAGGCAGGAGGG - Intergenic
1028005374 7:85559709-85559731 TATAATTGGACTTAGGAGGATGG + Intergenic
1028030469 7:85905673-85905695 TATATTCACAATGAGTAGGATGG - Intergenic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1031624390 7:123975379-123975401 TATAATCAAAATGTGGGTGAGGG - Intergenic
1031850016 7:126851996-126852018 GATACTGAGACTGAGGAGGATGG + Intronic
1034042647 7:147895797-147895819 TATATTCAGCAAGAGGAGAACGG - Intronic
1034542545 7:151768058-151768080 AATAATCAGAATAAAGAGCAGGG + Intronic
1035199541 7:157252405-157252427 TTTAATCAGAATGAAGACAATGG + Intronic
1036414849 8:8537510-8537532 CATAGGCAGAAGGAGGAGGATGG - Intergenic
1037192319 8:16141603-16141625 TATACTCTGCATGAGGAGGGAGG + Intronic
1037399306 8:18477752-18477774 TATAATCTGAAGGAAGAGGAAGG + Intergenic
1037790730 8:21938879-21938901 TTTAATGAGAATGAGGAGCCTGG + Intronic
1038197710 8:25383175-25383197 TATAATAATAATGACAAGGATGG + Intronic
1038302002 8:26360222-26360244 TATAACTTGAAAGAGGAGGATGG + Exonic
1039531053 8:38263217-38263239 TATAATCACAATAAAGAGAAAGG + Exonic
1041410976 8:57554418-57554440 AATAAGCAGAAGGAGGAGAATGG - Intergenic
1042438153 8:68792205-68792227 TAGAATTAGAATGATGAGAAAGG + Intronic
1042635615 8:70870007-70870029 TATGATATGAATGAGGAGGCTGG + Intergenic
1043167137 8:76917277-76917299 TCTAATCAAAATGATGAGAAGGG - Intergenic
1043636743 8:82393791-82393813 TTTTATCATAATGGGGAGGATGG - Intergenic
1044653084 8:94519261-94519283 TATGATCAAGATGAGGAGGAAGG - Exonic
1045912542 8:107427095-107427117 TAAAATCAGAATCAGGAAAAGGG - Intronic
1046350577 8:113005634-113005656 CATAATGAAAATGAGGAGGATGG - Intronic
1046359037 8:113126657-113126679 GAAAAGCAGAAGGAGGAGGAAGG + Intronic
1046926140 8:119791095-119791117 TATAATTAGAATGTGGTGGCTGG - Intronic
1048039211 8:130709176-130709198 GAGAATTAGAATGAGGAGGGTGG + Intergenic
1048537274 8:135309003-135309025 AATAGTGAGAAAGAGGAGGATGG + Intergenic
1048558914 8:135511391-135511413 AAGAATAATAATGAGGAGGATGG - Intronic
1048694395 8:137008904-137008926 CAGAATAAGCATGAGGAGGAAGG - Intergenic
1050112535 9:2231696-2231718 CATGAACAGAAGGAGGAGGAAGG + Intergenic
1050412275 9:5379110-5379132 TCTAATCAGAATCAGCAGAATGG + Intronic
1050899288 9:10925088-10925110 TGTAAACATAATGAGGATGAGGG + Intergenic
1051432007 9:16988797-16988819 CATAGGCAGCATGAGGAGGATGG + Intergenic
1051955609 9:22689516-22689538 TAAAATCAGAATGATGAGTTAGG + Intergenic
1052406345 9:28065805-28065827 CATAATGAGAATGAGAATGATGG + Intronic
1052525243 9:29609067-29609089 AATAACCAGAATGAAAAGGAAGG + Intergenic
1052615400 9:30833011-30833033 TATAATGAAAATGAGGTGGTAGG - Intergenic
1052683386 9:31723405-31723427 GAGAATCAGAGTGAGGGGGAAGG - Intergenic
1052925784 9:34015268-34015290 TATAACCAAATTGAGGAGGAGGG + Intronic
1053055995 9:34993423-34993445 TATGACCAGTATGGGGAGGAAGG + Exonic
1056090303 9:83198822-83198844 TATAAATAGAATGGGGGGGAGGG + Intergenic
1057416831 9:94871159-94871181 TATAATAAGAGTGAGTAGAAAGG - Intronic
1057576242 9:96244984-96245006 TAAAAACAGCCTGAGGAGGAGGG - Intronic
1058243105 9:102591845-102591867 TATAATGAGAAATAGGAGGGTGG - Intergenic
1058347292 9:103979402-103979424 TATAATCAGAGAGGGGAAGAGGG + Intergenic
1061373910 9:130213016-130213038 CATCATCAGAAGGTGGAGGAGGG - Intronic
1186246755 X:7622946-7622968 GAAAAACAGAATGAGGAAGAAGG - Intergenic
1186970810 X:14840365-14840387 TCTAATCAGACTGAGGGGAAGGG - Intergenic
1187972689 X:24674504-24674526 AACAAACAGAATGAGGATGAGGG - Intergenic
1188849883 X:35118664-35118686 TTTAATCATAAGGAGGAGGTAGG - Intergenic
1191647860 X:63503040-63503062 TATAATGAGAATAAAGAGTAAGG - Intergenic
1192559852 X:72120634-72120656 TATAGGCAGAAGGAGGCGGAGGG - Intergenic
1192629955 X:72769623-72769645 TATGCACACAATGAGGAGGATGG - Intergenic
1192651755 X:72951181-72951203 TATGCACACAATGAGGAGGATGG + Intergenic
1194547721 X:95258363-95258385 AAGACTCAGAATGGGGAGGATGG - Intergenic
1196711839 X:118770837-118770859 GATGATGACAATGAGGAGGAGGG + Intronic
1197280983 X:124535592-124535614 TATAATAAGAATAATGAGGATGG - Intronic
1197419432 X:126220086-126220108 ATTAATCAGAATTAGGAGGTGGG - Intergenic
1197742758 X:129908017-129908039 AACAATCAGGATGAGGGGGAGGG - Intronic
1198224783 X:134635250-134635272 TTTAATTAGAATAAGGATGAAGG + Intronic
1198339400 X:135699484-135699506 AGGAATCTGAATGAGGAGGAAGG + Intergenic
1198852251 X:140977330-140977352 GAAAATAAGAAAGAGGAGGAGGG - Intergenic
1199013421 X:142783257-142783279 TATATTGAAAAGGAGGAGGAAGG + Intergenic
1199178624 X:144824570-144824592 AATAATTAGAAAGAGGAGAACGG + Intergenic
1201300204 Y:12498611-12498633 AATAAGAAGAAGGAGGAGGAGGG - Intergenic
1201326891 Y:12770550-12770572 TATAATCATAATGACAAGGTAGG + Intronic