ID: 1161271048

View in Genome Browser
Species Human (GRCh38)
Location 19:3389464-3389486
Sequence GGGTGCTGCACTGGGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 348
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 315}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161271036_1161271048 17 Left 1161271036 19:3389424-3389446 CCCGTCCTCTTCTGCCTTTATTG 0: 1
1: 0
2: 0
3: 50
4: 761
Right 1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG 0: 1
1: 0
2: 2
3: 30
4: 315
1161271040_1161271048 3 Left 1161271040 19:3389438-3389460 CCTTTATTGATCTTCATCCCGGT 0: 1
1: 0
2: 0
3: 6
4: 69
Right 1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG 0: 1
1: 0
2: 2
3: 30
4: 315
1161271035_1161271048 20 Left 1161271035 19:3389421-3389443 CCTCCCGTCCTCTTCTGCCTTTA 0: 1
1: 0
2: 2
3: 30
4: 336
Right 1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG 0: 1
1: 0
2: 2
3: 30
4: 315
1161271038_1161271048 12 Left 1161271038 19:3389429-3389451 CCTCTTCTGCCTTTATTGATCTT 0: 1
1: 0
2: 1
3: 55
4: 517
Right 1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG 0: 1
1: 0
2: 2
3: 30
4: 315
1161271037_1161271048 16 Left 1161271037 19:3389425-3389447 CCGTCCTCTTCTGCCTTTATTGA 0: 1
1: 0
2: 3
3: 76
4: 1074
Right 1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG 0: 1
1: 0
2: 2
3: 30
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161271048 Original CRISPR GGGTGCTGCACTGGGGAGAC AGG Intronic
900188867 1:1345054-1345076 GGGTGCTGTACTGGGGTGCTGGG - Intronic
901627418 1:10631926-10631948 GGGAGCTGCGGTGGGCAGACAGG + Intergenic
902214351 1:14924781-14924803 GGGGGCTGCACCGGGGGGCCAGG + Intronic
902755411 1:18546147-18546169 AGCTGCTGAACTGGGGGGACAGG - Intergenic
902840280 1:19069966-19069988 TGTTGCTGGCCTGGGGAGACTGG - Intergenic
902916080 1:19640530-19640552 GTGGGCTGGACTGGGAAGACAGG + Intronic
904810763 1:33161994-33162016 GGGTGTGGCACTCAGGAGACAGG - Intronic
904936743 1:34135902-34135924 GGGCTCTGCAGTGGGGAGAAGGG + Intronic
904937677 1:34143249-34143271 GGCTGCTGCTCTGGGTGGACAGG - Intronic
905027323 1:34859689-34859711 GGGGGCCGCACTGGGGAGTGTGG - Exonic
905169455 1:36100505-36100527 GGCTGCTGTCCTGGGGAGGCTGG - Intronic
906616928 1:47239851-47239873 GGGTTCTGGACTGGGCACACGGG - Intergenic
906719931 1:47997267-47997289 GGGGGCGGCTCTGGGGCGACCGG + Intergenic
908692127 1:66794349-66794371 GGGTGATGTAATGGGAAGACTGG - Intergenic
908761165 1:67513165-67513187 GGCAGCTGCACTTGGGAGCCAGG + Intergenic
911291446 1:96060927-96060949 GCGTCCTGCACTGTGGAGACAGG + Intergenic
913384958 1:118249522-118249544 GGGTACTGCTCTTGGGTGACAGG + Intergenic
914508875 1:148313268-148313290 AGGAGCAGCACTGGAGAGACAGG + Intergenic
914680942 1:149937908-149937930 GGGTGGTGTACTGGGGGGAGGGG - Exonic
915973776 1:160371651-160371673 GGGTGAGGCCCTGGGGAGGCAGG + Exonic
916820985 1:168398673-168398695 GGGTTCTGAACAGGGGAGAGTGG - Intergenic
917041233 1:170808438-170808460 GGGAGCTGCACAGGGTAGGCAGG + Intergenic
917448868 1:175129861-175129883 TGTTGCTGTACTGTGGAGACAGG - Intronic
917471835 1:175332384-175332406 GGGGACTTCACTGGGGAGAAGGG - Intronic
918217791 1:182408050-182408072 GGATGGTGCATTGGGGAGACAGG - Intergenic
918674244 1:187261859-187261881 GGCTGCTGCAGTGGGGAGAGTGG + Intergenic
919049711 1:192499021-192499043 GGATCCTGCACTGGGGCCACAGG + Intergenic
920100341 1:203513447-203513469 TGGGGCTGCACTGTGGAGACTGG + Intergenic
920116778 1:203627109-203627131 GGTTGCCACACTGGGGAGACTGG + Exonic
920541393 1:206781095-206781117 GGGTACTGCAGTGGGAAGGCAGG - Intergenic
921978256 1:221226737-221226759 GGCTGCTGCTCTTGGTAGACAGG + Intergenic
922455450 1:225770450-225770472 GGGTGCTGCAGGGGGAAGAGGGG - Intergenic
922719270 1:227892026-227892048 GGCTGCAGCAGTGGGGAGGCTGG + Intergenic
923166535 1:231369251-231369273 TGGTGCTACATTGGAGAGACGGG - Intronic
1062834139 10:624881-624903 GGGAGCCGCACTGGGGACAGAGG + Intronic
1063930582 10:11024711-11024733 AGCTGTGGCACTGGGGAGACTGG - Intronic
1063981034 10:11451924-11451946 GGGAGCTGCGTTGGGGAGAAAGG - Intergenic
1064559105 10:16578205-16578227 GGGTTCTGCACTGGGTGGAGGGG - Intergenic
1066254113 10:33662113-33662135 GAGGGGTGCAGTGGGGAGACAGG - Intergenic
1069819416 10:71218143-71218165 TGGTGTTGCACTGGGGTGTCAGG + Intronic
1069856470 10:71443677-71443699 GGGTCCTGCACTTGGGAAGCTGG + Intronic
1069950322 10:72014263-72014285 GGGTGTTTCCCTGGGGAGAAGGG + Intergenic
1070189677 10:74100471-74100493 GGATGCTGCTCTGGGGAGCCTGG + Intronic
1071085280 10:81862629-81862651 GGATCCTGCACTGGGGCCACAGG + Intergenic
1073529957 10:104221820-104221842 GGTTGCTGCAGGGGGGAGGCAGG + Intronic
1074468921 10:113709150-113709172 GGATGCTACAATGGGGAGCCGGG + Intronic
1075762800 10:124869691-124869713 GGGTGGTGCATTGGGTAGGCAGG + Intergenic
1076378966 10:130012067-130012089 TGGTGCAGCACGGGGGAGCCTGG - Intergenic
1076383197 10:130038914-130038936 GAGTGCTGCACTGGGCAGGGAGG + Intergenic
1076695815 10:132246861-132246883 GGGTGCAGAATTGGGGACACAGG - Intronic
1076983932 11:222228-222250 GGGTGCTGGAGTGAGCAGACAGG - Intronic
1077257430 11:1593426-1593448 GGATGCTGAAATGGGGAGCCTGG - Intergenic
1077395030 11:2316441-2316463 GGGAGCTGCTCTGGTGTGACAGG + Intronic
1077619250 11:3705225-3705247 GGATGCTGAAATGGGGAGTCTGG + Exonic
1081567831 11:44270688-44270710 TGGGGCTGCACAGTGGAGACAGG - Intronic
1081867683 11:46368522-46368544 GGAGGCAGCACTGGGCAGACGGG + Intronic
1082775830 11:57243821-57243843 TGGTGCTGTAGTGGGGAGAATGG - Intergenic
1083775160 11:64891058-64891080 GAGTGCTGCACTGGGGTCGCAGG + Intergenic
1084240628 11:67817601-67817623 GGATCCTGCACTGGGGCCACAGG + Intergenic
1084566581 11:69932084-69932106 GGGTGCTCACCTGGGGAGACCGG - Intergenic
1085035659 11:73298293-73298315 GGGCTCTGCCCTGGGCAGACAGG + Exonic
1085200007 11:74696226-74696248 AGGTGCTGCAGTGGGGGGCCTGG + Intergenic
1085750859 11:79160113-79160135 GGATGCTGCACTGGGGAATAGGG - Intronic
1087971660 11:104491771-104491793 TTGTTCTGCAATGGGGAGACAGG + Intergenic
1088428578 11:109731975-109731997 GGGTGCTGCAGTGAGGAGATGGG + Intergenic
1088469506 11:110177817-110177839 GGGTGGAGCAGTAGGGAGACTGG - Intronic
1089129310 11:116199562-116199584 GGGGGCTGCAAAGGGGAGAGGGG + Intergenic
1089731911 11:120524599-120524621 GGGGACTGTACTGGGGTGACTGG + Intronic
1089749427 11:120639933-120639955 GGGTGCTGCCCTGGGGGAATAGG - Intronic
1091222547 11:133937747-133937769 GGAGGCTGCCCTGGGGAAACGGG + Intronic
1091224150 11:133947435-133947457 AGGTGCTGCCCTGGAGAGTCGGG - Intronic
1094488932 12:30946605-30946627 GGGTGCTGCTCTGGGGATCTGGG + Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096194883 12:49643345-49643367 GGGTGCTGCCCTTGGAGGACGGG + Exonic
1096678931 12:53242098-53242120 GGGAGCTGCACTAGAGGGACAGG - Intergenic
1098219432 12:68252907-68252929 TGATGTTGCTCTGGGGAGACGGG - Intronic
1100881660 12:99025124-99025146 AGGTGCAGCACAGGGGACACAGG - Intronic
1101446732 12:104742309-104742331 GGGTGATGCTCTTGGGAGGCAGG - Intronic
1102428814 12:112865562-112865584 AGGTGCTGCACAGGGAAGAAGGG - Intronic
1102987543 12:117290651-117290673 GGATTCTGCTCTGGGGAGAGGGG + Intronic
1103723431 12:122986557-122986579 AGGTGCAGCTGTGGGGAGACTGG + Exonic
1103941912 12:124505905-124505927 GGACGTGGCACTGGGGAGACAGG - Intronic
1103972228 12:124679422-124679444 GGAGGCTGCACAGGGGAGACAGG + Intergenic
1104417520 12:128607437-128607459 GGTTGCTGCATTGAGGAGAGAGG + Intronic
1105412641 13:20184220-20184242 GGGGGCTGCACTGAGGACAGGGG + Intergenic
1108720184 13:53123623-53123645 GGGTGCAGCAGTGGGGCAACAGG + Intergenic
1109586402 13:64410734-64410756 GGGTGCTGCACTGGAGTGCAGGG - Intergenic
1109854221 13:68107663-68107685 GGATCCTGCACTGGGGCCACAGG + Intergenic
1112212081 13:97387869-97387891 GGGTGCTTCAGAGAGGAGACTGG + Intronic
1113087589 13:106584294-106584316 GGCTGTTGCTCTGGGGACACTGG - Intergenic
1114257806 14:21017698-21017720 GGATGCTGCACTGGTCAGAGAGG + Exonic
1116915857 14:50525138-50525160 GAGTTCTGGACTGGGGATACAGG - Intronic
1118770183 14:68937797-68937819 GGGTGCTTGCCTGGGGAGGCTGG - Intronic
1119861688 14:77940579-77940601 GGCTGCTGAACTGGGGACAGAGG + Intergenic
1122066910 14:99180141-99180163 GGAGGCTGCACTGTGGAGAGGGG + Intronic
1122549947 14:102544443-102544465 GGGTGCGGCCGTGGGGAGCCTGG + Intergenic
1122994773 14:105257078-105257100 GGGGGCTGCGCTCGAGAGACAGG + Intronic
1124361318 15:29038460-29038482 TGGTTCAGCACTGTGGAGACAGG - Intronic
1124593047 15:31070169-31070191 GGGTGTTGCACTTGGCAGAGGGG + Exonic
1125579259 15:40774145-40774167 GGGGGGTGCTCTGGGGAGAAAGG - Intronic
1125641077 15:41231223-41231245 GGGTGGTGCGCTGGGGAGGGCGG - Exonic
1125903658 15:43371010-43371032 GGGAGCTGTACTTGGGAGGCTGG - Intronic
1127152675 15:56094339-56094361 TGATGCTGCACAGGAGAGACAGG + Exonic
1127268465 15:57379924-57379946 GGGGGCTGCAATCGGGACACGGG - Intronic
1128227273 15:66010920-66010942 GGGTGTGGCAGTGGGGAGAGGGG + Intronic
1128315288 15:66655863-66655885 GGGTGGTGCCCTGGAGAGACAGG - Intronic
1128403846 15:67314692-67314714 GAGTGCTGAACTGAGGACACAGG + Intronic
1129319740 15:74767899-74767921 GGGTGCATCCCTGGGGACACAGG - Intergenic
1129523614 15:76200705-76200727 GGCTGCTGCCCTGGGAAGCCAGG - Intronic
1132086856 15:98915598-98915620 GAGTGCAGCACTGTGGAGAATGG + Intronic
1133128200 16:3660245-3660267 GCTGGCTGCACTGGGGACACAGG + Exonic
1135265767 16:21024332-21024354 GGATTCTCCACTGGGGAGCCAGG + Intronic
1136283860 16:29230151-29230173 GGGTGCTTGGCTGGGGGGACAGG + Intergenic
1136285916 16:29241702-29241724 GGGTGCTGCACATGGGTGAAGGG - Intergenic
1138735849 16:59249211-59249233 GGCTGTTTCACTGGGGACACTGG + Intergenic
1139268208 16:65659190-65659212 AGGTGATTCACTGGTGAGACAGG + Intergenic
1139851015 16:69951650-69951672 GGATGCTGGACTGGGGAGGAAGG + Intronic
1139854111 16:69967215-69967237 GGCTGCTGGACTGGGAAGACTGG - Intergenic
1139879997 16:70174562-70174584 GGATGCTGGACTGGGGAGGAAGG + Intronic
1139883092 16:70190129-70190151 GGCTGCTGGACTGGGAAGACTGG - Intergenic
1140369416 16:74405391-74405413 GGCTGCTGGACTGGGAAGACTGG + Intergenic
1140372517 16:74420965-74420987 GGATGCTGGACTGGGGAGGAAGG - Intronic
1140930896 16:79626795-79626817 GGGAGCTGCACTGTGGTTACAGG - Intergenic
1142063338 16:88045505-88045527 AGGTGCTGCACAGGGAAGAAAGG - Intronic
1142091254 16:88211888-88211910 GGGTGCTGCACATGGGTGAAGGG - Intergenic
1142509721 17:385955-385977 GGGCGCTGCTCGGGGGAGTCGGG + Intronic
1142639841 17:1279504-1279526 GGGTGGTTCTCTGGGGAGAGGGG + Intergenic
1143498199 17:7324283-7324305 GGGTGCTGGAGTGAGGAGTCAGG + Intronic
1143729045 17:8869967-8869989 GGGGGCTGCTCTTTGGAGACTGG - Intergenic
1144042566 17:11425864-11425886 GGGTGTTGCACTGGGGCTGCAGG - Intronic
1144770330 17:17755963-17755985 GAGGGCCGCACTGGGGACACTGG - Intronic
1145304677 17:21666950-21666972 GGGTGCTGCACAAGGGACATGGG - Intergenic
1146180919 17:30697744-30697766 GGGTGATAAACTGGGGAGTCCGG - Intergenic
1146642349 17:34550790-34550812 GGGAGCTGCCCTGGGGAATCTGG - Intergenic
1146943064 17:36857151-36857173 GGCTGCGGCACTGGAGAGGCAGG - Intergenic
1147607473 17:41782425-41782447 GGGTGCTGCCCTGTGGGGATTGG - Intronic
1147717125 17:42516015-42516037 GAGTGCTCCTCTGGGGAGAGGGG - Intronic
1147988103 17:44318083-44318105 GGGTCCTTCCCTGGGGAGAGAGG - Exonic
1148018690 17:44539776-44539798 GGGTGGGGCAGTGAGGAGACTGG + Intergenic
1148844629 17:50522125-50522147 GGGTGCAGCCCTGAGGTGACTGG + Intronic
1148867315 17:50635207-50635229 GGCTGCAGCACTGGGGAGCCCGG + Intronic
1149547075 17:57511549-57511571 GGGTGTTGCCCTGGGGAGGCAGG + Intronic
1151534864 17:74733143-74733165 TGGAGCTGCACTGTGGTGACAGG + Intronic
1152231464 17:79115919-79115941 GGGTGCTGCGCTGGGAATGCCGG + Intronic
1152546002 17:81000375-81000397 GGGTGCTGCTCTGAGCAGGCTGG + Intronic
1153410588 18:4788788-4788810 GGATGGGGCACTGGGAAGACTGG + Intergenic
1153913767 18:9727119-9727141 GGATGCTGGCCTGGGGAGATGGG + Intronic
1154390913 18:13935253-13935275 GGGTGCTGAACTGGCGAAGCTGG - Intergenic
1156472984 18:37389017-37389039 GGGTCCTGCCCTGGTGAAACAGG + Intronic
1157381280 18:47220517-47220539 GTTTGCTGCACAGGGGAGTCAGG - Intronic
1157935117 18:51864309-51864331 GGATCCTGCACTGGGGCCACAGG + Intergenic
1161271048 19:3389464-3389486 GGGTGCTGCACTGGGGAGACAGG + Intronic
1162284438 19:9727654-9727676 GGGTGGTGCTCCGTGGAGACTGG + Intergenic
1162977663 19:14217788-14217810 GGGTGATCAACTGGGGAGTCCGG + Intergenic
1163223715 19:15939883-15939905 GGGTGCAGAACTGAGGAGACAGG + Intergenic
1163747424 19:19056725-19056747 GGGGGCTGCACGGAGGAGTCTGG - Intronic
1164445778 19:28316516-28316538 GTCTGCTGCTCTGGGGTGACGGG - Intergenic
1164595366 19:29528176-29528198 GCCGGCTGAACTGGGGAGACTGG - Intronic
1164846785 19:31439247-31439269 GGGTCTTGCCCTTGGGAGACAGG + Intergenic
1166341280 19:42138731-42138753 GGGTGCTGGGCTGGGGTGGCTGG + Intronic
1166808189 19:45499315-45499337 TGGTGCTGCCCTGGCGGGACTGG + Exonic
1167501665 19:49851635-49851657 GGGTGCTCCACGGGGGAACCCGG - Intronic
925016053 2:525186-525208 GGTTGCAGCACTGGGCAGCCTGG - Intergenic
925033102 2:666597-666619 GGTTGCTGCACAGGGAAGGCAGG - Intergenic
925033439 2:669526-669548 GGGAGCTGCACTGGGTGGACGGG + Exonic
925440717 2:3883100-3883122 AGGAGCTGCACTAGGGAGCCAGG - Intergenic
927708725 2:25312463-25312485 GGGTGCTGGGCTGGGAAGGCAGG + Intronic
927927997 2:27026458-27026480 TGCTGCAGCACTGGGGAGCCAGG + Exonic
928182806 2:29081207-29081229 TGCTGCTGCACTGGGGAGTGAGG + Intergenic
930605234 2:53486446-53486468 GGATCCTGCACTGGGGCCACGGG - Intergenic
930712739 2:54564466-54564488 GGGCCCTGCTGTGGGGAGACTGG - Intronic
932972140 2:76556909-76556931 AGGTGCTGCACTGGGGAGTCAGG + Intergenic
933691479 2:85182356-85182378 GGGTGCTGGCCTGGGGTGCCAGG + Intronic
935092079 2:99904977-99904999 GGGAGCAGCAGTGGGGAGATTGG - Intronic
937458676 2:122066769-122066791 GGATGCTGCACTTGGGAAGCAGG - Intergenic
937900027 2:127012650-127012672 GGGGGGTGGAGTGGGGAGACAGG - Intergenic
938462035 2:131503800-131503822 TGGTGATGCACTGAGGTGACAGG - Intergenic
938575258 2:132597402-132597424 GGATGATGCACTGGGGACTCTGG + Intronic
939509552 2:143089541-143089563 GGATCCTGCACTGGGGTCACAGG + Intergenic
941082480 2:161078003-161078025 GGGTGCTGCCCTGGGAGGAGGGG + Intergenic
942405117 2:175646142-175646164 GGATGGGGCACTGGGAAGACTGG + Intergenic
944101088 2:196028649-196028671 TGGGGCTGCACTGGGCAGAAAGG + Intronic
944252417 2:197591498-197591520 GGATACTGCACTGGGGCGGCAGG + Intronic
944318371 2:198307502-198307524 GGTGGTTGCACTGGGGAGAAGGG + Intronic
946623969 2:221591291-221591313 TGATACTGCACAGGGGAGACTGG + Intergenic
948405165 2:237711885-237711907 GCGTGCTGCGCTGGGCTGACTGG - Intronic
948481099 2:238251107-238251129 GCGTGCTGCACAGGTGAGGCTGG - Intronic
948835292 2:240623516-240623538 GGGTGCAGCTTTGGGGAGAGAGG + Intronic
948945875 2:241218454-241218476 GGGTGCGGCGGTGGGGAGCCGGG + Intronic
1168864581 20:1074508-1074530 GGGTGCTGAACTTGGGGGAGTGG - Intergenic
1169985468 20:11438602-11438624 GGCTGATTCACTGGGGAGAGAGG + Intergenic
1170830292 20:19833830-19833852 TGGTCCTGCACTGGGGCGAGGGG - Intergenic
1171347076 20:24473613-24473635 GAGGGACGCACTGGGGAGACAGG + Intronic
1171522191 20:25784390-25784412 GGGTGCTGCACAAGGGACATGGG - Intronic
1171522932 20:25789143-25789165 GGCTGCTGCACTGGGAACCCTGG - Intronic
1171529941 20:25846335-25846357 GGGTGCTGCACAAGGGACATGGG - Intronic
1171530675 20:25851112-25851134 GGCTGCTGCACTGGGGACCCTGG - Intronic
1171553895 20:26066740-26066762 GGCTGCTGCACTGGGAACCCTGG + Intergenic
1171554636 20:26071493-26071515 GGGTGCTGCACAAGGGACATGGG + Intergenic
1172599681 20:36175224-36175246 ATGTGCTGCTCTGGGGAGACAGG + Intronic
1173217950 20:41104288-41104310 GACTGCTGCTCTGCGGAGACTGG + Intronic
1173844578 20:46179837-46179859 GGGTGCAGCACAGGGAAGATGGG - Intronic
1173860797 20:46282301-46282323 GGGAGCAGCACTGGGGAGAAAGG + Intronic
1174404921 20:50296767-50296789 GGGGGCTCCACTGGGGTGAATGG + Intergenic
1175676334 20:60949550-60949572 GGCTGCAGCACTGGGGTGAAGGG - Intergenic
1175853770 20:62107982-62108004 GAGTCCTGCTGTGGGGAGACAGG + Intergenic
1176521496 21:7827861-7827883 GGGTGCTGGAGTGGGGACAAAGG - Intronic
1176655991 21:9589387-9589409 GGGTGCTGCACAAGGGACATGGG - Intergenic
1178655516 21:34457873-34457895 GGGTGCTGGAGTGGGGACAAAGG - Intergenic
1179567537 21:42258504-42258526 GAGTGCAGCACTGGGGACTCAGG - Intronic
1180983006 22:19888147-19888169 GGGTGCTGCACTGCTGGGCCTGG - Intronic
1181314419 22:21962322-21962344 GGGTGCTGGGCTGGGCACACAGG + Intronic
1181546037 22:23603247-23603269 GGGGGCTGCCCGAGGGAGACTGG - Intergenic
1181845305 22:25702933-25702955 GGGTTCTGCACAGGGAAAACAGG + Intronic
1181993379 22:26855517-26855539 AGGTGCTGCACCAGGGAGACAGG + Intergenic
1182621632 22:31621584-31621606 GGGGGCTGTGCTGGGGAGGCAGG + Intronic
1183092417 22:35531839-35531861 GAGTGCTGAGCTGGGGAGACGGG - Intergenic
1183349593 22:37327472-37327494 CTGTGCTGCACTGGGGATCCAGG - Intergenic
1183732763 22:39627904-39627926 GGGAGCAGCCCTGGGGAAACTGG - Intronic
1184300520 22:43556098-43556120 GGAGGAGGCACTGGGGAGACTGG + Intronic
1184361630 22:44022566-44022588 ATGTACTGCACTGGGGGGACTGG + Intronic
1184815079 22:46862837-46862859 GGGTGCAGGACTGGGGAGCATGG + Intronic
1184922880 22:47618202-47618224 GGGTGCTGCACGGGGCAGTCAGG - Intergenic
1184939307 22:47749432-47749454 GGTTGCTGCAGTGAGGAGTCAGG - Intergenic
1184997808 22:48223254-48223276 AGGGGCTGCACTGGGGAGTGTGG - Intergenic
1185345979 22:50310979-50311001 GGGTGCTGGCCAGGGGACACAGG - Exonic
949292830 3:2485329-2485351 GGATCCTGCACTGGGGCCACAGG - Intronic
949841688 3:8327050-8327072 GGGTGCTGAACTTGGGAGGCGGG - Intergenic
950499171 3:13353113-13353135 GGGGGCAGCACTGGGGAGGCTGG - Intronic
950724399 3:14907136-14907158 GGGTGCTGTGCAGAGGAGACAGG + Intronic
950770879 3:15310024-15310046 GGCTGTAACACTGGGGAGACAGG - Intronic
950897834 3:16469584-16469606 GGATGCCGCACTGGGGAGCATGG + Intronic
951959428 3:28300554-28300576 GGGTGCTGGAGAGGGGAGAGTGG - Intronic
953412221 3:42697023-42697045 CGGTGATGCACTTGGGAGGCTGG + Exonic
953571424 3:44074742-44074764 TTGTGCTGCAATGGGGAGAGTGG + Intergenic
954382524 3:50227301-50227323 GGCTGCAGCTCTGCGGAGACCGG + Intronic
954411617 3:50373625-50373647 GGGTGCTGGGGTGGGGAGAGCGG + Intronic
954615632 3:51967578-51967600 GGCTGCGGCACTGGGGCGGCTGG - Intronic
956540260 3:70328721-70328743 GAGTGATGCAGTGAGGAGACAGG + Intergenic
958731719 3:97967135-97967157 GGATTCTGCAATGGGGAAACTGG + Intronic
961648289 3:128404446-128404468 CTGTGCTGGGCTGGGGAGACAGG - Intronic
961690114 3:128663287-128663309 GCATGGTGCACTGAGGAGACTGG + Intronic
961860942 3:129916571-129916593 GGGGGCAGCACTGGGGAGGCCGG - Intergenic
962256771 3:133876103-133876125 GGCTCCTACACTGGGGAGAATGG - Intronic
962954508 3:140251961-140251983 GGCAGCTGCAGTGGGGAGACAGG + Intronic
966406626 3:179604942-179604964 GGGTGCTGGCCTAGGGAGAACGG + Intronic
968910618 4:3475476-3475498 GTGTGCTGACCTGGGAAGACAGG + Intronic
968922020 4:3527251-3527273 GGGTGGAGCTCTGGGGAGAAGGG - Intronic
969032808 4:4227407-4227429 GGTTGCGGGACTGGGGAGAGGGG + Intergenic
969490967 4:7499002-7499024 GGGGGCAGCACCGTGGAGACGGG + Intronic
969500975 4:7552750-7552772 GGGTGCTGGAGTGGAGAGGCAGG - Intronic
969869336 4:10095008-10095030 GGGTGCAGCGCTGGGGTGGCAGG - Intronic
971618852 4:28828424-28828446 GGATCCTGCACTGGGGCCACAGG - Intergenic
973583539 4:52368986-52369008 GGCTGTGGCACTGTGGAGACGGG - Intergenic
976734580 4:88296798-88296820 TGCAGCTGCACTGGGGAGAGTGG + Intergenic
980631284 4:135438438-135438460 GGATGCTGTGCTGAGGAGACAGG + Intergenic
981587146 4:146316346-146316368 GGGTGCTGGTATTGGGAGACAGG + Intronic
982522003 4:156429735-156429757 CGGTGCTTCACAGGGCAGACTGG + Intergenic
985403529 4:189615149-189615171 GGATCCTGCACTGGGGAGGCAGG + Intergenic
985517478 5:354373-354395 GGGGGCTGCCCTGGGGTGCCGGG + Intronic
986221849 5:5775489-5775511 CAGGGCTGTACTGGGGAGACAGG + Intergenic
986570697 5:9161671-9161693 TGGTGCTGCTCTGGAGAGCCAGG + Intronic
986897836 5:12392450-12392472 GGGTGCTGCACTGGAGAAGGTGG - Intergenic
988815489 5:34830317-34830339 TGGTCCTCCACTGGGAAGACGGG + Intronic
989483033 5:41954470-41954492 GGGTGCTGCTTTGAGGAGAGTGG - Intergenic
990517330 5:56542404-56542426 GGGTGGCCCAGTGGGGAGACTGG + Intronic
993160961 5:84290322-84290344 GGCAGCAGCACTGGGAAGACGGG - Intronic
997523489 5:134538126-134538148 GTGAGCTGCCCTGCGGAGACTGG + Intronic
998092759 5:139380761-139380783 GGGGTCTGCACTGGGGAAAAGGG - Intronic
998151116 5:139758108-139758130 CTGCCCTGCACTGGGGAGACAGG + Intergenic
1000255955 5:159538669-159538691 GGGTTCTCTGCTGGGGAGACAGG + Intergenic
1001093375 5:168757809-168757831 GGCTGTGGTACTGGGGAGACAGG - Intronic
1001269196 5:170298277-170298299 AGGTGCTACACTGTGCAGACAGG + Intergenic
1002532883 5:179859093-179859115 GGTTCCGGCCCTGGGGAGACTGG + Exonic
1004183831 6:13404956-13404978 TTGTGGTGCACTGGGGAGAGAGG - Intronic
1004455747 6:15790035-15790057 GGCTCCTGCACTGGGGAAGCAGG - Intergenic
1004501964 6:16217246-16217268 GGGTCCTGCACTGGGGCTGCAGG - Intergenic
1004516838 6:16327949-16327971 GCGTACTGCACGGGGGACACCGG + Exonic
1004549801 6:16635956-16635978 GGGTTGTGCTCTGGGGAAACCGG - Intronic
1005179440 6:23087804-23087826 GGGTGCTGCAGCTGGGAGAATGG - Intergenic
1005743497 6:28814539-28814561 GGCTGGGGCACTGGGGAGAACGG + Intergenic
1006317044 6:33297400-33297422 GGGTTCAGCTCTGGGGAGAAGGG - Intronic
1006419611 6:33924919-33924941 GGGTGCTGGTCTGGTGAGAGAGG + Intergenic
1006578052 6:35060283-35060305 GGGTGCTGCTCAGTGGAAACAGG + Intronic
1006717859 6:36131430-36131452 GGGGGCTGCCCTGGGGAGTCAGG + Intronic
1007166410 6:39831836-39831858 GGTAGGTGCACTGGGGAGGCAGG + Intronic
1007166457 6:39831986-39832008 GGTAGGTGCACTGGGGAGGCAGG + Intronic
1007305766 6:40903030-40903052 AGGTGCTGCAGGGGGGAAACAGG - Intergenic
1007369409 6:41416550-41416572 GGGTGGGGTACTGGGGGGACTGG - Intergenic
1008697502 6:54057248-54057270 GGCTGCTACACTGGGTAGATGGG + Intronic
1010951564 6:82042857-82042879 TAGAGCTGAACTGGGGAGACAGG - Intergenic
1013454914 6:110321924-110321946 TGGTGCTGCACGGGGGATCCTGG - Intronic
1015311814 6:131775289-131775311 GGATGCTCCTCTGGGGAGATGGG - Intergenic
1015730746 6:136345579-136345601 GGGTGCTGCTCTGTGCAGAGAGG + Intronic
1016588389 6:145715716-145715738 GTGAACTGCACTTGGGAGACAGG + Intronic
1019305230 7:331202-331224 TGGTGCTGAAGTGGGGAGAAGGG - Intergenic
1019348748 7:543326-543348 GGCTGCCACGCTGGGGAGACAGG - Intergenic
1019512067 7:1422650-1422672 GGGTGGGGCCCTGGGGACACCGG - Intergenic
1019569974 7:1706556-1706578 AGGGGCTGCACTGGGAAGGCCGG - Intronic
1021493412 7:21245627-21245649 GAGTGCAGCACTGGGCTGACAGG + Intergenic
1021613760 7:22481982-22482004 GAATCCTGCTCTGGGGAGACTGG + Intronic
1021625304 7:22587151-22587173 AGGAGCTGCACTGGGTAGAGAGG - Intronic
1022443953 7:30454973-30454995 CTGGGCTGCACTTGGGAGACAGG + Intronic
1023940593 7:44766363-44766385 AGGGGCTCCCCTGGGGAGACAGG - Intronic
1024160342 7:46668298-46668320 GGGTGATGAACTGGAGACACTGG + Intergenic
1024655917 7:51451324-51451346 TGGTGCAGCACTGGGAATACTGG + Intergenic
1024740685 7:52350822-52350844 GAGAGACGCACTGGGGAGACAGG + Intergenic
1026118679 7:67517957-67517979 TGGTGTTGCACTAGGGAGGCAGG - Intergenic
1026892305 7:73989387-73989409 GGGGGCTGAACTAGGGGGACAGG + Intergenic
1030366949 7:108657192-108657214 GGATGCTGCACTGGGGCTGCAGG + Intergenic
1033601518 7:142892230-142892252 GAGTGCTGATCTGGGGAGAATGG + Intergenic
1034469178 7:151246569-151246591 GGCTGCTGACCTGGGCAGACAGG - Intronic
1034489402 7:151385368-151385390 GGGTGCTGAAGTGGGCAGTCTGG - Intronic
1034943134 7:155244903-155244925 GGGTGCTGCGCTGGGGATGGGGG - Intergenic
1035434635 7:158850175-158850197 GGGTCCTGCACCTGGGAGAGTGG + Intergenic
1037609345 8:20463378-20463400 GGGAACTTCACTGGGGAGAGTGG + Intergenic
1038883412 8:31639287-31639309 GAGTGCTGCAATGGGAGGACGGG - Intergenic
1043620967 8:82192199-82192221 GGATCCTGCACCGGGGAGGCAGG + Intergenic
1044626255 8:94236967-94236989 AGCTGCTGGCCTGGGGAGACTGG - Intergenic
1044862085 8:96533789-96533811 GGATCCTGCACTGGGGCCACAGG + Intronic
1044876341 8:96671018-96671040 GGATGCTGCACTGGGGAAACTGG + Intronic
1048873777 8:138820843-138820865 GTGCTCTGCACTGGGGACACCGG - Intronic
1049001763 8:139830777-139830799 GGCTGCTGCACCAGGGAGCCCGG + Intronic
1049392937 8:142381413-142381435 GGGTGCTGGAAGGGGGAGGCCGG - Intronic
1049508916 8:143018235-143018257 GGGTGCTGACCTGGCGAGGCCGG - Intronic
1049577117 8:143394528-143394550 GGGTGCTGCCCTGGTGAGGGTGG + Intergenic
1050477032 9:6050852-6050874 GGGTGCTGCAAAGGGGAAAAAGG + Intergenic
1050589236 9:7145404-7145426 GGGTGCTGCGTAGGTGAGACAGG + Intergenic
1055312664 9:74999818-74999840 TGGTGCTGGACTAGGAAGACTGG - Exonic
1057300773 9:93880326-93880348 GGATCCTGCACTGGGGTCACAGG - Intergenic
1057509205 9:95663651-95663673 GGGAGCTGCACAGGGAACACAGG + Intergenic
1059539027 9:115112466-115112488 GGGGGCTGCTGTGGAGAGACAGG - Intronic
1060729922 9:126030781-126030803 GGCTCTGGCACTGGGGAGACAGG + Intergenic
1060958852 9:127664689-127664711 GGCTGCTGCAGTGCTGAGACTGG + Intronic
1061304627 9:129725125-129725147 TGGTGATGGGCTGGGGAGACTGG + Intergenic
1061478156 9:130883001-130883023 GGGTGCTCCTCTGGGGAGCATGG - Intronic
1061909795 9:133716540-133716562 GGCTGCTGGCCTGGGGAGCCCGG - Intronic
1062393949 9:136345138-136345160 GGGTGCTGCCCTGAGGGGTCCGG + Intronic
1062525535 9:136976718-136976740 GGGTGCAGCGCTGGGGTAACAGG + Intergenic
1203633708 Un_KI270750v1:92847-92869 GGGTGCTGCACAAGGGACATGGG - Intergenic
1185934406 X:4239487-4239509 GTGTCCTGCACAGGGAAGACAGG + Intergenic
1186952034 X:14637284-14637306 GGGTGATACACTGGGAAGTCAGG - Intronic
1190215724 X:48478353-48478375 GGGTGCTCCCCAGGGGAGAGGGG + Intronic
1191849354 X:65574614-65574636 GGGTGCTGCAAGGGGAAGAAGGG - Intergenic
1192363556 X:70453762-70453784 GGGAGCTGCGCAGGGGAGACCGG + Exonic
1192503474 X:71667639-71667661 GGGTGGTGCTCTGGGGCCACAGG - Intergenic
1196648616 X:118146143-118146165 GGGTGCTGATCTTGGGAGCCAGG - Intergenic
1199881123 X:151974801-151974823 GGCTGCTGCGGTGGGGAGCCGGG + Intergenic