ID: 1161272698

View in Genome Browser
Species Human (GRCh38)
Location 19:3398752-3398774
Sequence TTATGTAACCAGTTTATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161272691_1161272698 23 Left 1161272691 19:3398706-3398728 CCCGGGACAGGTTGCTGCCGGAT 0: 1
1: 0
2: 1
3: 5
4: 88
Right 1161272698 19:3398752-3398774 TTATGTAACCAGTTTATGCAAGG 0: 1
1: 0
2: 0
3: 17
4: 127
1161272695_1161272698 -7 Left 1161272695 19:3398736-3398758 CCTGTGCCTCGCTGCCTTATGTA 0: 1
1: 0
2: 0
3: 6
4: 124
Right 1161272698 19:3398752-3398774 TTATGTAACCAGTTTATGCAAGG 0: 1
1: 0
2: 0
3: 17
4: 127
1161272692_1161272698 22 Left 1161272692 19:3398707-3398729 CCGGGACAGGTTGCTGCCGGATG 0: 1
1: 0
2: 2
3: 22
4: 127
Right 1161272698 19:3398752-3398774 TTATGTAACCAGTTTATGCAAGG 0: 1
1: 0
2: 0
3: 17
4: 127
1161272694_1161272698 6 Left 1161272694 19:3398723-3398745 CCGGATGGACAAGCCTGTGCCTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 1161272698 19:3398752-3398774 TTATGTAACCAGTTTATGCAAGG 0: 1
1: 0
2: 0
3: 17
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161272698 Original CRISPR TTATGTAACCAGTTTATGCA AGG Intronic
900082719 1:870365-870387 TTTTGTACACAGTTTTTGCACGG - Intergenic
905839024 1:41157862-41157884 TTATGTAAGCTCTTTATGGATGG + Intronic
909787405 1:79632502-79632524 TTGTCTAACCAGCTTATCCAAGG - Intergenic
911704003 1:100989747-100989769 TTATGAAACCAATTTATACAAGG - Intronic
912849760 1:113112878-113112900 TTATTTCACAATTTTATGCAAGG + Intronic
912898872 1:113625868-113625890 TTATATAACCAGTTTTTTTAGGG + Intronic
914730679 1:150367285-150367307 CAATGAAAACAGTTTATGCATGG + Intronic
918532167 1:185535513-185535535 ATAAGTAAACATTTTATGCATGG + Intergenic
918864203 1:189873672-189873694 TTATGTATCCAGTAGATTCAAGG + Intergenic
919396433 1:197054985-197055007 TAATTTAACCAGTTTATTGATGG - Intronic
920906540 1:210175020-210175042 TTCTGTAACCAGCTAATGCATGG - Intergenic
923181098 1:231520572-231520594 TTATATATCCTGTTTATACATGG - Intergenic
924360033 1:243229931-243229953 TTTTGTAAACTGTTTTTGCAAGG - Intronic
1067999683 10:51317806-51317828 TTATTTAGCCAGGTTATGCCAGG + Intronic
1068000390 10:51326881-51326903 TTATGTAATCACATTATGCTTGG + Intronic
1070481354 10:76885958-76885980 TAATGTAGCCAATTTAGGCAGGG - Exonic
1071178952 10:82960717-82960739 TAATGTCACCAGTTAAGGCAAGG - Intronic
1071685626 10:87752316-87752338 TTATGGAACTGGTTTAAGCATGG + Exonic
1071726480 10:88202879-88202901 TTATGTGGCCAGTGTTTGCAAGG - Intergenic
1074177092 10:111018688-111018710 TTAATTAACCTGTTTATGCTGGG + Intergenic
1078389151 11:10920918-10920940 TCTTATAACCAGTTTTTGCATGG + Intergenic
1079801441 11:24874450-24874472 TTATGTAACCATGTTATGGGTGG - Intronic
1082212803 11:49525967-49525989 TTATATACCCAGTTTAAGCAAGG + Intergenic
1085955445 11:81387991-81388013 ATATATAACCTGTATATGCATGG - Intergenic
1086636793 11:89098542-89098564 TTATATACCCAGTTTAAGCAAGG - Intergenic
1087728884 11:101756307-101756329 TTATGTAACCATGTTATGAGTGG + Intronic
1087833353 11:102844254-102844276 TTCTGTAACCAATTTATTAATGG + Intergenic
1091756681 12:3057142-3057164 TTATGTTTCCAGTTTATTGAAGG + Intergenic
1092363897 12:7861085-7861107 TTATGAAAACAGTTGATGCCGGG - Intronic
1093654696 12:21681370-21681392 TTATGTTTCCTGTGTATGCAAGG + Intronic
1094316736 12:29144459-29144481 TTATGTTACCAGTTTGCACAGGG + Intergenic
1099045839 12:77718372-77718394 TCATTTGACCAATTTATGCATGG + Intergenic
1099647087 12:85371060-85371082 TTAGGAAAGCAGTTTGTGCAAGG + Intergenic
1100427176 12:94498230-94498252 TTATGTAACCATGTTATGGATGG - Intergenic
1101008412 12:100425424-100425446 TTGAGCACCCAGTTTATGCAAGG - Intergenic
1101155965 12:101928036-101928058 TTATGTAACCACCTACTGCAGGG + Intronic
1101981596 12:109411995-109412017 TTATTTTACCAGATTTTGCATGG + Intronic
1103901867 12:124307555-124307577 TTGTGAAACCAGTTTATGAGGGG - Intronic
1105248141 13:18671266-18671288 TTATGGAACCATGTTATGCATGG - Intergenic
1105619224 13:22051025-22051047 TTTTGTAAACAGTATAGGCAAGG + Intergenic
1106444622 13:29815935-29815957 TCAAATAACCAGTTTCTGCATGG + Intronic
1109773504 13:67008326-67008348 CTATGTAAACAATTTAGGCAAGG + Intronic
1109999706 13:70179546-70179568 TTATATAACAAGTCCATGCAGGG + Intergenic
1110687000 13:78387164-78387186 TCATGTAACTAGTGTGTGCATGG - Intergenic
1110806524 13:79760801-79760823 TTCTGTAACCAGTTTTTTGAGGG + Intergenic
1110861125 13:80345465-80345487 TTATGACTACAGTTTATGCAAGG + Intergenic
1113759839 13:112839628-112839650 TTATGTCACCTGTGTGTGCACGG + Intronic
1114334825 14:21677259-21677281 TCATTTAACCAGTTTACACAGGG - Intergenic
1114357883 14:21933557-21933579 TTATTTCACAAGATTATGCAAGG - Intergenic
1115581682 14:34765967-34765989 TTATAGAACCAGATTATGTATGG - Intronic
1115925833 14:38433069-38433091 TTATGTTTGCAGTTTAAGCAGGG - Intergenic
1117015284 14:51511542-51511564 TTATGTCACCATTTTATAGAGGG + Intronic
1118391136 14:65296655-65296677 TTATGTAACCTGTGTGTCCAAGG + Intergenic
1124593337 15:31072485-31072507 TTATGTAACAAGTTTTTGAGTGG + Intronic
1130755087 15:86754736-86754758 TAAAGAAACCACTTTATGCAGGG - Intronic
1138049169 16:53758419-53758441 TTATGTAACCATTGTAACCAGGG + Intronic
1138593005 16:58012836-58012858 TTAAGGAACCACTGTATGCAGGG - Intronic
1150019030 17:61591888-61591910 TTATTTAACCTATTTATGCTGGG - Intergenic
1151583470 17:74993600-74993622 TTATGTAACTAGTTTTTTCTTGG + Intronic
1154440713 18:14387857-14387879 TTATGGAACCATGTTATGCATGG + Intergenic
1156690698 18:39703471-39703493 TTATGTAACCACTTTGTACTAGG + Intergenic
1158915778 18:62127575-62127597 TTATGTACTTAGTGTATGCAAGG - Intronic
1160478495 18:79216589-79216611 TTTTGTAACTAGTTTGTGCAAGG + Intronic
1161272698 19:3398752-3398774 TTATGTAACCAGTTTATGCAAGG + Intronic
1162015281 19:7842653-7842675 TTATGTATCAAGTGTGTGCATGG + Intronic
1165016293 19:32882653-32882675 TTAGGTTACCAGTTGATGCAGGG - Intronic
1167156793 19:47743507-47743529 TTATGTACCCAGGTTGTGCAAGG - Intergenic
927017340 2:18978737-18978759 TTAGGTAAGCAATTTATGTATGG + Intergenic
927328843 2:21838949-21838971 ATATGAAACCATTTTATTCAAGG + Intergenic
930329905 2:49969367-49969389 TTATGTAGACAGTTCATACATGG + Intronic
930364736 2:50424820-50424842 GTAAGTAACCAGTGTATACAAGG - Intronic
933415653 2:81983875-81983897 ATATGTATCCACTTAATGCATGG - Intergenic
940294878 2:152112216-152112238 TTATGCAACTAGTTAGTGCATGG + Intergenic
940810136 2:158233655-158233677 TCATTTAGCCAGTTCATGCAGGG + Intronic
944144231 2:196488926-196488948 CTATGTATGCATTTTATGCATGG - Intronic
945601186 2:211866470-211866492 TTATTGTACAAGTTTATGCATGG + Intronic
946583488 2:221157504-221157526 TTAGGTAACAAGTGTTTGCAAGG - Intergenic
1170358223 20:15516261-15516283 ATATGTAACCTGTTTCTGAAAGG + Intronic
1170581926 20:17705754-17705776 TTATGCAACTAGTTCATGCTGGG + Intronic
1175050285 20:56149208-56149230 TGATTTAACCAGTTGGTGCATGG - Intergenic
1176455337 21:6903318-6903340 TTATGGAACCATATTATGCATGG - Intergenic
1176833509 21:13768366-13768388 TTATGGAACCATATTATGCATGG - Intergenic
1177070855 21:16505733-16505755 TTATGGAAACAGCTTATGTATGG + Intergenic
1179380427 21:40894200-40894222 CTTTGTAACCAGCTTATGCAAGG + Intergenic
1180710326 22:17835217-17835239 TTGTGAAACCAGCTGATGCACGG - Intronic
1183140381 22:35932299-35932321 TTTTCTAACCAGTTTTTTCATGG - Intronic
952858577 3:37793648-37793670 TCATGTAAGCAGTTTATTTAGGG + Intronic
954922322 3:54202615-54202637 TTAATTATCCAGTTAATGCATGG + Intronic
956011728 3:64838870-64838892 TTATGTAAGCAGGTCCTGCAAGG + Intergenic
956039089 3:65127335-65127357 TTTTATAACCAGTTGATTCAGGG - Intergenic
964894170 3:161574804-161574826 CTGTGTAACCAGTTTTTGGAGGG + Intergenic
966740955 3:183233019-183233041 TTAAGTAACCAGTTTATATCTGG - Intronic
969036375 4:4257076-4257098 TTATGTAACCATGTTATGGGTGG - Intergenic
971556185 4:28014808-28014830 TTATGTAACCACATTATGGGTGG - Intergenic
972192668 4:36613431-36613453 TTATGTCAAGAGTTTAAGCAGGG + Intergenic
972882449 4:43442504-43442526 TTATTAAACCAGTTTATTCATGG - Intergenic
974104906 4:57458828-57458850 TTCTGTAACCAGTTTATCATTGG - Intergenic
974403078 4:61428292-61428314 TTATGTAACCATGTTATGAGTGG - Intronic
975355390 4:73396605-73396627 ATATGTAACTAATTTATTCATGG - Intergenic
975995384 4:80308031-80308053 ATATATAACCAGTTTAGGAAAGG + Intronic
976088050 4:81426262-81426284 TTATCTTAACAGTTTGTGCATGG - Intergenic
976218373 4:82735861-82735883 TAATGAAACCAGTTTAACCACGG - Intronic
976456856 4:85257713-85257735 TTATGTAACCAGTAAGAGCATGG - Intergenic
976811378 4:89104619-89104641 TTATGTAACCATGTTATGGGTGG + Intronic
976811994 4:89108311-89108333 TTATGTAACCACATTATGGGTGG + Intronic
977865380 4:102019830-102019852 TTATATAATCAGACTATGCAGGG - Intronic
979949741 4:126877321-126877343 TTATATAACCAGTTTATTGATGG + Intergenic
980821783 4:138026046-138026068 TTTCGTAACCAGTTTTTCCAGGG + Intergenic
984214852 4:176898250-176898272 TAATGTAAACATTTTATGGATGG - Intergenic
986959448 5:13196117-13196139 TTCTCTAAACAGTTCATGCAAGG - Intergenic
991333136 5:65514733-65514755 TTATTTTATAAGTTTATGCAAGG + Intergenic
992795407 5:80251413-80251435 CTTTATAGCCAGTTTATGCAAGG - Intronic
994329444 5:98488522-98488544 TAATCTATCCAGTTTCTGCAGGG - Intergenic
994564380 5:101423006-101423028 TTATGTAAGCAGAATATCCAAGG + Intergenic
995563379 5:113407556-113407578 TTATTTAACCAGGTGATGCTTGG - Intronic
1001465448 5:171960881-171960903 TTATTTAACTAGTATATTCAGGG + Intronic
1004339033 6:14791232-14791254 TTATGTAAACATTTTCTACAGGG - Intergenic
1005200388 6:23337974-23337996 TTATGTAGCCAGTGCTTGCATGG - Intergenic
1006172514 6:32102388-32102410 TTATTTATCCACTTTATGAATGG - Intronic
1008328655 6:50218584-50218606 TTATGTGACAATTTTTTGCATGG - Intergenic
1011878676 6:91995236-91995258 TTATGTAAATAGCTTATTCATGG + Intergenic
1014090969 6:117403009-117403031 TTATGTACCCAGTTGTTGAATGG + Intronic
1014514936 6:122366485-122366507 TTATGAAACCATGTTATGCGTGG + Intergenic
1021507059 7:21397539-21397561 TTATGTAACATGCTTATGCACGG + Intergenic
1021780958 7:24105467-24105489 TTATGTAACCACCTTATTCAAGG + Intergenic
1024143310 7:46484038-46484060 TTATGACAACAGTTTAAGCAAGG - Intergenic
1030203090 7:106925558-106925580 TCATGTATCCAGGTTCTGCAAGG + Intergenic
1035378445 7:158423161-158423183 TGATGTATACAGTTTATTCACGG - Intronic
1039409595 8:37341736-37341758 TTATATAGTCAGTTTATTCACGG - Intergenic
1039720119 8:40154319-40154341 TTCAGTAAACAATTTATGCATGG - Exonic
1039950624 8:42169315-42169337 TTATGTAACCATTTTAAACGTGG + Exonic
1040882372 8:52219989-52220011 TTAGGTAACCAATTTGTGCCAGG + Intronic
1045201235 8:99983800-99983822 TTAAGTACCCAGTATATGCTGGG + Intronic
1047161161 8:122381544-122381566 TTATTTAACCAGTTCATGAGGGG - Intergenic
1047564460 8:126026540-126026562 TTATTTAACTGGTTTATTCATGG + Intergenic
1048074616 8:131055838-131055860 TCATGTAACCTGTTTAACCAAGG - Intergenic
1050194199 9:3063300-3063322 TAATATAAACAGTTTATGGAAGG + Intergenic
1056004790 9:82257407-82257429 TTATATACCCATTTTATACATGG + Intergenic
1058506443 9:105670819-105670841 GCATGGAACCAGTTTTTGCAGGG - Intergenic
1185744117 X:2557942-2557964 TTCTGTAGTGAGTTTATGCAGGG - Intergenic
1189445554 X:41077438-41077460 ATATTTATCCAGTTTCTGCAGGG - Intergenic
1190907437 X:54741311-54741333 TTCTATAACCAGTTTTTGGAGGG + Intergenic
1194051998 X:89080455-89080477 TTATTTAAACACTTTATGAAAGG - Intergenic
1196905246 X:120424918-120424940 TTCTGTAACCATTTAATGTAAGG + Intergenic
1201310183 Y:12590046-12590068 ATATGTAACCACTTTTTCCAAGG + Intergenic