ID: 1161274316

View in Genome Browser
Species Human (GRCh38)
Location 19:3407049-3407071
Sequence TGCAGGGCCTTGAGCGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 125}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161274316 Original CRISPR TGCAGGGCCTTGAGCGCCAT GGG Intronic
901056276 1:6449986-6450008 TGCAGGGGCTGGGGCTCCATAGG - Intronic
902359526 1:15934843-15934865 TGCAGGAGCTTGAGGGCCTTTGG - Exonic
902394478 1:16125187-16125209 GACAGGGCCTGGAGCCCCATCGG - Exonic
902478077 1:16698507-16698529 TGCAGGGGCTGGGGCTCCATAGG + Intergenic
908909778 1:69059844-69059866 TCAAGGTCCTTGAGCTCCATGGG + Intergenic
913286904 1:117234887-117234909 TGTAGGGCCTTGTGGGCCTTGGG + Intergenic
915668293 1:157464927-157464949 TGCAGGGCCGTAAGGGCCAATGG - Intergenic
922954602 1:229588449-229588471 GGCAGGGCCTTGGGCACCAGCGG - Intergenic
1063251925 10:4283028-4283050 TGCAGCTCCTTGAGGGCCAAAGG + Intergenic
1066084150 10:31960481-31960503 TGCAGGGGCAAGAGCCCCATAGG - Intergenic
1067120869 10:43471186-43471208 TGCAAGGGGTTGAGCGCAATGGG - Intronic
1067231359 10:44413178-44413200 TGCAGGGCCATGGGGGCCAAAGG + Intergenic
1074377676 10:112952357-112952379 CGCAGGGCCGCGAGCGCCCTGGG + Intronic
1082092324 11:48100092-48100114 TGGAGGGCATTGAGCTCCTTGGG + Intronic
1084556482 11:69879145-69879167 AGCAGGGCCTTGAGACCCGTGGG + Intergenic
1085011868 11:73146910-73146932 TGCAGGGCCAGGAGGGTCATAGG + Intergenic
1085336180 11:75698234-75698256 TGCAGGGCCTTGAAGGCCCTGGG - Intergenic
1092116893 12:6015714-6015736 TGTAGGGCCTTGAGAACCAATGG - Intronic
1093286849 12:17274420-17274442 TGAAGGGCCTTGAAGGCCATTGG + Intergenic
1094872856 12:34607630-34607652 TGCAGGGCCCAGAAGGCCATGGG + Intergenic
1095560002 12:43552687-43552709 TGCCGGGAGTTGAGTGCCATAGG + Intergenic
1095982804 12:47982565-47982587 TGGAGGGCCCTGAGCCCCAGGGG + Exonic
1097457559 12:59818632-59818654 GGCAGGGCCTTGTTCACCATGGG - Intergenic
1101381233 12:104215785-104215807 CACAGGGCCTTGTGCGACATGGG + Exonic
1102868266 12:116391667-116391689 TGCAGGGCCTGGCACACCATAGG + Intergenic
1103139501 12:118536228-118536250 TGCAGAGGCTTGAGGGTCATGGG + Intergenic
1105801551 13:23907558-23907580 TACAGGGCCTTAAAAGCCATTGG + Intergenic
1105935715 13:25096325-25096347 TGCAGGGACTTGATCACCAGCGG + Exonic
1106879141 13:34110137-34110159 TGCAGGGTCTTGAAAGTCATGGG + Intergenic
1107662179 13:42650105-42650127 TGCAGAGCATTGAGCACTATGGG + Intergenic
1113820744 13:113210215-113210237 TGCAGGGCCGGGAGCCCCAGAGG + Intronic
1124037653 15:26070938-26070960 TGCAGGGCCTTGGGAGGCCTGGG - Intergenic
1128341266 15:66824046-66824068 TTCAGGGCCTTGAGGGCCATGGG + Intergenic
1135485827 16:22863789-22863811 TGCACGGCCTGGAGAGCTATGGG - Intronic
1135576818 16:23592464-23592486 TGCAGAGCCTTAAGGGCCATGGG + Intronic
1135701426 16:24636026-24636048 TGCAGGGCACTGATCGCCTTGGG + Intergenic
1136394931 16:29987552-29987574 TGCAGGGCCCGGAAGGCCATGGG - Exonic
1137306709 16:47207718-47207740 TGCAGGGCCCTGGGGGCCACAGG + Intronic
1138319973 16:56103398-56103420 TGCAGGCCCCTGAGCTCCACCGG - Intergenic
1138432246 16:56976335-56976357 TGCAGGGCCCTGGAGGCCATGGG - Intronic
1141391240 16:83666537-83666559 TGCAGGGCCCTGTGGGCCATGGG - Intronic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1142275476 16:89116487-89116509 TGCTGGGCCTGGGGAGCCATGGG + Intronic
1146638464 17:34523083-34523105 TGCAGGGCCTTGTAGACCATAGG + Intergenic
1150289981 17:63975541-63975563 TGGAGGGCCTTGGGAGCCCTGGG - Intergenic
1151971334 17:77458999-77459021 AGGAGGGCCTTGGGGGCCATGGG + Intronic
1157602543 18:48902775-48902797 AGCAGGGCCTAGAGTCCCATGGG - Intergenic
1157731995 18:50011888-50011910 TGCAGGGCCTGGAGTGTCAGAGG - Intronic
1160808663 19:1003490-1003512 GGCAGGGCCTTGGGCGGCAGTGG - Exonic
1160920257 19:1516229-1516251 TCCAGGGCCCTGAGTCCCATGGG - Intergenic
1161213341 19:3079820-3079842 TGCAGGCCCTTGTGGGCCATGGG + Intergenic
1161238831 19:3210760-3210782 TGCAGGGCCTGGTGGGCCACGGG + Intergenic
1161274316 19:3407049-3407071 TGCAGGGCCTTGAGCGCCATGGG + Intronic
1161274927 19:3410577-3410599 TGCAGGGCCTTGTGGGCCACGGG + Intronic
1161277458 19:3426633-3426655 TGCAGGGCCTTGTGGGCCACAGG - Intronic
1161286469 19:3471063-3471085 TTCAGGGCCTTGTGGGCCACAGG + Intergenic
1161300029 19:3538051-3538073 TGCAGGGCCTTGTGGGCCTCAGG + Intronic
1161301594 19:3545363-3545385 TGCAGGGCCTGGTGGGCCATGGG - Intronic
1161421999 19:4181106-4181128 TGCAGGGCCTGGTGGGCCGTGGG - Intronic
1161490373 19:4557906-4557928 TGCAGGGCCTGTTGGGCCATTGG - Intronic
1161605852 19:5214525-5214547 GGCAGGGGCTTGAGGGCCGTGGG + Intronic
1161751709 19:6102548-6102570 TGCAGGGCCTTGGAGGCCATGGG - Intronic
1161756438 19:6137500-6137522 TGCAGGGCCTTGTGGACCGTGGG + Intronic
1162087861 19:8259420-8259442 TGCAGGTCCTTGAGGGCTGTGGG + Intronic
1162512991 19:11131053-11131075 TGCAGAGCCTTGTGGGCCACTGG + Intronic
1162829963 19:13278253-13278275 TGCAGGGGCTTGAGGGCCTCGGG - Intronic
1162875311 19:13616924-13616946 TACAGGGTCTTGTGGGCCATAGG + Intronic
1165475611 19:36028711-36028733 TGCAGAGCCCTGAGGGCCGTGGG - Intronic
1202712097 1_KI270714v1_random:24334-24356 TGCAGGGGCTGGGGCTCCATAGG + Intergenic
927157311 2:20228309-20228331 GGCATGGCCCTGAGTGCCATCGG + Intergenic
927980195 2:27370201-27370223 TGCCGGGCCTTGAGCGCCTTTGG - Intronic
928405386 2:31010703-31010725 GGCAGGGCCTTGGGGGCCACAGG - Intronic
929315788 2:40476761-40476783 TATAGGGCCTTGAACACCATAGG + Intronic
932315575 2:70779730-70779752 TGCTGGGGCTTGAGGGCCTTTGG - Intronic
932639307 2:73427047-73427069 TGAAAGGCCTGGAGCCCCATGGG - Intronic
934568795 2:95355134-95355156 TGCAGGGCCTTGGGGACCACCGG + Intronic
937875873 2:126824944-126824966 TGGAGGACCATGAGCGCCACAGG - Intergenic
938602966 2:132862085-132862107 TGCAGAGCCTTAAGCCCAATAGG - Intronic
1171969999 20:31558414-31558436 TGCAGGGCCCCGAGGACCATGGG - Intronic
1172126608 20:32628276-32628298 TGCAGGGCCCTGAGGGGCAGTGG - Intergenic
1173702113 20:45081829-45081851 TTCAGGGCCTTGTGGTCCATGGG + Intergenic
1173759050 20:45543754-45543776 TGAAGGGCCTTGTGGGTCATGGG - Intronic
1174117574 20:48237857-48237879 TGGAGGGCCTTGCAGGCCATGGG - Intergenic
1174514098 20:51078038-51078060 TGCAGGGGCTGGAGCCCAATGGG - Intergenic
1180243893 21:46533443-46533465 TGCATGGCCTGGAGCACCAAGGG + Intronic
1181018751 22:20087110-20087132 TGCAGGAGCATGAGCGCCAGGGG + Intronic
1184637803 22:45848978-45849000 TGCAGGGTCTTCAAGGCCATGGG + Intergenic
1185068369 22:48643185-48643207 TGCACGGCCTCCAGCGCCATGGG + Intronic
1185280800 22:49969079-49969101 TGCTGGGCCTGGAGGGCCATCGG - Intergenic
950297730 3:11846617-11846639 TGCAGCGTCTGCAGCGCCATGGG + Exonic
950407861 3:12815870-12815892 TGCAGGGCCTTGACCACAAGGGG - Exonic
951232690 3:20198075-20198097 TACAGGGCCTGGAGTGCCATTGG + Intergenic
954194900 3:48990627-48990649 TGCAGGGCCTGGAGCGCGGCGGG - Intronic
954914029 3:54134200-54134222 TGCAGGGCCTTCTGTGCCTTCGG + Intronic
956494373 3:69808727-69808749 TGCAGGACCTTGACCTCCCTGGG + Intronic
961009079 3:123424118-123424140 TGCAGACACTTGAGTGCCATGGG - Intronic
961017906 3:123481729-123481751 GGCAGGGCCTTCAGCTCCACTGG + Intergenic
961530553 3:127537492-127537514 TGCAGGGCATTGAGGGCCAGAGG - Intergenic
964466228 3:156996449-156996471 TGCAGGGCCTTGCAGGCCTTTGG + Intronic
967659811 3:192092529-192092551 TGCAGGGCCTTGAGGAACATAGG + Intergenic
981288576 4:143047593-143047615 GGCAGGGCCTGGAGTCCCATGGG + Intergenic
981356080 4:143790626-143790648 TGCAGTGCATTGCGCGCCCTTGG + Intergenic
982288926 4:153760484-153760506 TGCATGGCCTGGAGCAGCATAGG - Intergenic
984847759 4:184122226-184122248 TAGATGGCCTTGAGCTCCATGGG - Intronic
985031666 4:185796402-185796424 TGCAGGGCCCTGGGAGCCATTGG - Intronic
985038198 4:185862290-185862312 TGCAGGGCCTTGAGCCTTGTAGG + Intronic
985580823 5:694279-694301 TGCTGGGACTTGAGGGGCATAGG + Intergenic
985779919 5:1865166-1865188 TGCAGGGACTGGATCGCCCTGGG - Intergenic
985899987 5:2780689-2780711 TGCAGGGCCTGGAGCCCCTTTGG - Intergenic
990293555 5:54379013-54379035 TGCAAGGGGTTGAGCACCATGGG + Intergenic
992365786 5:76088003-76088025 TGCATGGCCTTCAGAGCCCTAGG + Intronic
995618693 5:113998306-113998328 TACAGGGCCTTGTGGGCCTTGGG - Intergenic
1001221185 5:169902429-169902451 AGCAGGGCCTTGTGCTCCAGGGG + Intronic
1001344552 5:170880864-170880886 TACAGTGCCTAGAGAGCCATGGG - Intronic
1002020812 5:176363368-176363390 TGCTGGGCCCTGAGAGCCACAGG - Intergenic
1002021022 5:176364724-176364746 TGCTGGGCCCTGAGAGCCACAGG + Intergenic
1002444463 5:179280599-179280621 TGGAAGGCCTTGCGTGCCATGGG - Intronic
1007168821 6:39847917-39847939 AGGAGGGCCTTGAGTGCCAGGGG - Intronic
1007385436 6:41517372-41517394 TGCAGAGCCCTGAGGGCCAGTGG + Intergenic
1008081862 6:47203509-47203531 GGCAGGGCCTTGAGCACCCTGGG + Intergenic
1009059306 6:58378413-58378435 TGCAGGGACTTCAGCACCCTGGG + Intergenic
1010020166 6:71150211-71150233 AACAGGGCTTTGAGCGTCATGGG - Intergenic
1011353638 6:86451092-86451114 TGCAGGGCTGTGAGTGCCCTTGG - Intergenic
1018768217 6:166950766-166950788 CGGAGGGCCGTGAGTGCCATGGG + Intronic
1018967843 6:168502414-168502436 TGCAGGGCATGGAGGGCCATCGG - Intronic
1021564549 7:22004105-22004127 GGCAGGGCCTGGAGAGCCAGTGG + Intergenic
1022537797 7:31108641-31108663 TGCAGGGCCTAGAGAAGCATTGG - Exonic
1026601513 7:71781475-71781497 TGCAGGCCATTGAGTGCCATGGG - Exonic
1032506604 7:132439803-132439825 AGCAGGGCCTAGAGGACCATGGG - Intronic
1037877157 8:22553923-22553945 AGCAGGGCCTTAAGCCCAATAGG - Intronic
1042445647 8:68882419-68882441 TCCAGGGCCATTAGTGCCATAGG + Intergenic
1045912752 8:107429209-107429231 TACAGGGCCTTGAGAGAAATAGG + Intronic
1045937087 8:107692488-107692510 TGCTGGGCTTAGAGCCCCATGGG + Intergenic
1046841138 8:118858520-118858542 TGCAGGGCTTTGTGGGCAATTGG - Intergenic
1049271102 8:141696734-141696756 GCAAGCGCCTTGAGCGCCATGGG + Intergenic
1049428676 8:142549337-142549359 TGCAGGGCCTGGAGAGGCCTCGG + Intergenic
1049428706 8:142549413-142549435 TGCAGGGCCTGGAGAGGCCTGGG + Intergenic
1049428716 8:142549449-142549471 TGCAGGGCCTGGAGGGCCCCTGG + Intergenic
1059541746 9:115137197-115137219 TGTAGGACCTTGAGAGCCCTGGG + Intergenic
1060583451 9:124771340-124771362 CGCAGGGCCTTGCGCGGCAGCGG - Intergenic
1061100274 9:128486840-128486862 AGCAGGGCCCTGAGCACCCTGGG - Intronic
1061664440 9:132152196-132152218 TGCAGGGCCTTGGGAGCCCAAGG - Intergenic
1062041884 9:134408078-134408100 TGCAGGGCCGTGGGGGACATAGG + Intronic
1062124767 9:134854174-134854196 TTCGGGTCCTTGAGTGCCATTGG + Intergenic
1189397163 X:40633235-40633257 TACTGGGCCTTGTGAGCCATTGG - Intronic
1189755814 X:44270366-44270388 AGCAGGGATTTGAGGGCCATGGG - Intronic
1193697171 X:84723585-84723607 ATCAGGGCCTTGAGTGACATAGG - Intergenic
1198641931 X:138765778-138765800 TGCAGGGCCTTGATAGTCATGGG - Intronic