ID: 1161277472

View in Genome Browser
Species Human (GRCh38)
Location 19:3426684-3426706
Sequence CGACGGGGAGAGAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2562
Summary {0: 1, 1: 3, 2: 28, 3: 223, 4: 2307}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161277472 Original CRISPR CGACGGGGAGAGAGGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr