ID: 1161278817

View in Genome Browser
Species Human (GRCh38)
Location 19:3434149-3434171
Sequence GGAACCGGGCCAATATGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161278804_1161278817 29 Left 1161278804 19:3434097-3434119 CCATGGCCTTGGTCCTCTGATCC 0: 1
1: 0
2: 1
3: 45
4: 284
Right 1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1161278808_1161278817 8 Left 1161278808 19:3434118-3434140 CCATAGAATAAAACTGGTTTCAG 0: 1
1: 0
2: 1
3: 39
4: 282
Right 1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1161278803_1161278817 30 Left 1161278803 19:3434096-3434118 CCCATGGCCTTGGTCCTCTGATC 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1161278805_1161278817 23 Left 1161278805 19:3434103-3434125 CCTTGGTCCTCTGATCCATAGAA 0: 1
1: 0
2: 0
3: 5
4: 145
Right 1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 43
1161278806_1161278817 16 Left 1161278806 19:3434110-3434132 CCTCTGATCCATAGAATAAAACT 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161278817 Original CRISPR GGAACCGGGCCAATATGGGA AGG Intronic
900845655 1:5098192-5098214 GGAAAAGGGACAACATGGGAGGG + Intergenic
902409977 1:16206858-16206880 GGAACCGGGCCATAGAGGGAGGG - Intronic
903787689 1:25872292-25872314 GAAACAGGGCCAAGAGGGGAGGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906254719 1:44339403-44339425 GGAACAGGGCCACAGTGGGAGGG - Intronic
908260555 1:62336808-62336830 GGAGCCGGGCCAAGGTTGGATGG + Intergenic
909773669 1:79457711-79457733 GGAGCAGGACCAAGATGGGAGGG - Intergenic
916712962 1:167428095-167428117 GGAAAGGGACCAAAATGGGAAGG + Intergenic
920370672 1:205477519-205477541 AGACCCGGGCCAAGGTGGGAAGG - Intergenic
921006029 1:211094400-211094422 GGAATCAGGCCAATATAGCAGGG - Intronic
1065071515 10:22029384-22029406 GGAACTGGACCCAAATGGGATGG + Intergenic
1076465380 10:130677771-130677793 GGAGCTGGGCCAAGATGGGCAGG - Intergenic
1083636064 11:64121568-64121590 GGAGCTGGGCCAAGAGGGGATGG - Intronic
1087085315 11:94212411-94212433 GGAAGCTGTCCCATATGGGATGG - Intergenic
1101992061 12:109494348-109494370 GGAACAGGGCAAGTTTGGGAAGG - Intronic
1115689596 14:35828825-35828847 GGAACCTGCCCGATATGGGAAGG + Intronic
1121667392 14:95683832-95683854 GGTACTGGGCCAAAATGGCAGGG - Intergenic
1125130420 15:36278486-36278508 GGAAGAGGGTCACTATGGGAGGG + Intergenic
1130833997 15:87631508-87631530 TGAACCTGGCCAATATGGTGAGG - Intergenic
1132946284 16:2532888-2532910 GGAACAGGGCCAGTCTGGGAGGG - Intergenic
1155170144 18:23260972-23260994 GGACCCAGGCCAGGATGGGAAGG + Intronic
1160774769 19:850404-850426 GGAACCCTGCCAAAAGGGGAGGG + Intergenic
1161278817 19:3434149-3434171 GGAACCGGGCCAATATGGGAAGG + Intronic
1162809336 19:13154752-13154774 GAAACTGGGCCAATCTGGGGAGG + Exonic
1163879074 19:19901746-19901768 GGACCTCAGCCAATATGGGAAGG + Intronic
1165378537 19:35461140-35461162 GGACCCGGGACAACATGGGACGG - Intergenic
925212354 2:2060738-2060760 GGAAGTGGGCAAAGATGGGAGGG - Intronic
926357488 2:12054950-12054972 TGACCCGGGCCATTCTGGGATGG + Intergenic
931178058 2:59873207-59873229 GGAACAGGGCCTATCTGAGATGG + Intergenic
946226715 2:218267781-218267803 GGAGCTTGGCAAATATGGGAAGG - Intronic
948953581 2:241271158-241271180 GGGACTGGGGCCATATGGGAGGG - Intronic
1168909839 20:1438923-1438945 GGAACCCAGCCAAATTGGGATGG + Intergenic
1183026749 22:35071078-35071100 TGAACAGGGCCAGTCTGGGAAGG - Intronic
1185248406 22:49785934-49785956 GGAACAGGGACAAGATGTGAGGG + Intronic
955506387 3:59637136-59637158 GGAAGCAGGCCAATGTGAGATGG + Intergenic
959721703 3:109498100-109498122 TGAACCAGGCCCATATGAGATGG - Intergenic
966865898 3:184259164-184259186 GGAGCCAGGCCAAAATGGGAGGG - Intronic
994183463 5:96793484-96793506 GGAACCTGGTCACTATGGAATGG - Exonic
1001934310 5:175693724-175693746 GCACCCGGACCAAGATGGGAAGG - Intergenic
1007110855 6:39312976-39312998 GGAACCGTGCCAGGGTGGGAAGG - Intronic
1012109082 6:95203396-95203418 TGAACTGGGCCAATATAAGATGG - Intergenic
1036599373 8:10245840-10245862 AGACCAGAGCCAATATGGGATGG + Intronic
1039611442 8:38922446-38922468 GGGACAGGGCCAAAATGGAATGG + Intronic
1049763947 8:144344223-144344245 GGACCCAGGTCAATATCGGAGGG - Intergenic
1050475640 9:6037995-6038017 GAAACTGGGCCAATCTGGGGAGG - Intergenic
1189669997 X:43398200-43398222 GGAACAGTGCAAATATGGAATGG + Intergenic
1192795198 X:74420633-74420655 GGAGCCGGGCCAGGAAGGGAGGG - Intergenic
1198027816 X:132725870-132725892 GGAACTGGGCCATTATGCTAAGG + Intronic