ID: 1161283966

View in Genome Browser
Species Human (GRCh38)
Location 19:3459444-3459466
Sequence CTGGGTAAACCGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 180}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161283949_1161283966 23 Left 1161283949 19:3459398-3459420 CCTTCACGCCCCTACATTTCTCC 0: 1
1: 0
2: 0
3: 17
4: 181
Right 1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 180
1161283954_1161283966 13 Left 1161283954 19:3459408-3459430 CCTACATTTCTCCTGCACGGGAA 0: 1
1: 0
2: 0
3: 11
4: 82
Right 1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 180
1161283958_1161283966 -10 Left 1161283958 19:3459431-3459453 CCCACGTAAGCAGCTGGGTAAAC 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 180
1161283953_1161283966 14 Left 1161283953 19:3459407-3459429 CCCTACATTTCTCCTGCACGGGA 0: 1
1: 0
2: 1
3: 7
4: 83
Right 1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 180
1161283955_1161283966 2 Left 1161283955 19:3459419-3459441 CCTGCACGGGAACCCACGTAAGC 0: 1
1: 0
2: 0
3: 4
4: 28
Right 1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 180
1161283951_1161283966 15 Left 1161283951 19:3459406-3459428 CCCCTACATTTCTCCTGCACGGG No data
Right 1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG 0: 1
1: 0
2: 1
3: 20
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161283966 Original CRISPR CTGGGTAAACCGAGGGTGGG GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900637475 1:3672984-3673006 CTGGGTATGAGGAGGGTGGGTGG - Intronic
902251136 1:15154743-15154765 CTGGGGAAACCGTGGGGGAGGGG - Intronic
902597769 1:17520843-17520865 CTGGGAAAACTGAGGCTTGGAGG + Intergenic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903087898 1:20880505-20880527 CTTGGGAGACCGAGGTTGGGTGG + Intronic
904301123 1:29555598-29555620 CTGGGTAATCCGAGGCTTGCTGG + Intergenic
907304443 1:53505970-53505992 GTGGGCAAACTGAGGCTGGGAGG - Intergenic
908786226 1:67736946-67736968 ATGTGTAAACTGAGGGTTGGAGG + Intronic
910095559 1:83517671-83517693 CTGGAAAAACCTAGGGTGGCTGG + Intergenic
912744865 1:112237747-112237769 CTGAGTAATCAGAGGGTAGGAGG - Intergenic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
918118647 1:181518127-181518149 ATGGGGAAACCGAGGCTGAGTGG + Intronic
918185842 1:182127191-182127213 CTTAATAAACAGAGGGTGGGGGG - Intergenic
920295619 1:204954421-204954443 CTGGGTAAATGGAGAGTGGGGGG + Intronic
922536621 1:226385832-226385854 CATTGTAAACCAAGGGTGGGTGG - Intronic
922547233 1:226466999-226467021 CTGCCTGAACTGAGGGTGGGAGG + Intergenic
1065695301 10:28374272-28374294 CTGGGCAAAGAGAGGGTGGATGG - Intergenic
1065719413 10:28611648-28611670 CTGGGTAATATGGGGGTGGGGGG + Intronic
1067297229 10:44981874-44981896 CTAGGGAAACCGAGGGAGGTTGG + Intronic
1069856400 10:71443394-71443416 AGGGGTAAACAGAGGCTGGGTGG - Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1072917691 10:99549484-99549506 CTCGGGAGACTGAGGGTGGGAGG - Intergenic
1074058021 10:109940316-109940338 ATGGGTAAACTGAGGTTTGGAGG + Intergenic
1075078927 10:119369902-119369924 CTGGGTAAACGGAGGGTCAGGGG - Intronic
1075091150 10:119444746-119444768 ATGGGCAAACCGAGCCTGGGAGG + Intronic
1077031237 11:468896-468918 CTGGGTAATCGGAGGGAGGAGGG + Intronic
1077196407 11:1283137-1283159 CTGGGTAAACCTGCGCTGGGTGG + Intronic
1079104922 11:17564437-17564459 CTGGGTAAGGAGAGGGAGGGAGG + Intronic
1081612990 11:44574393-44574415 ATGGGGAAGCCAAGGGTGGGTGG - Intronic
1084737402 11:71114353-71114375 CTGGGTAAAATGATGGTGCGGGG + Intronic
1085047099 11:73359974-73359996 CTGGGGAGCCAGAGGGTGGGAGG + Intronic
1088005983 11:104941077-104941099 TAGGATAAACCCAGGGTGGGAGG - Intergenic
1094185726 12:27640586-27640608 GTGGGCAACCCGGGGGTGGGGGG - Intronic
1096088196 12:48880497-48880519 CTGGCAAAACAGAGGATGGGAGG - Intergenic
1096712083 12:53464989-53465011 CTGGGTGAAATGAGGTTGGGGGG - Intronic
1097232441 12:57520853-57520875 CAGGGGACACCGAGGGTGGTGGG + Intronic
1097710032 12:62908169-62908191 TTTGGGAAGCCGAGGGTGGGCGG + Intronic
1099782481 12:87215314-87215336 CTGAGTTAAGTGAGGGTGGGAGG - Intergenic
1100024161 12:90107365-90107387 CTGGGAAAGTAGAGGGTGGGAGG + Intergenic
1103495243 12:121357054-121357076 CTTGGGAGGCCGAGGGTGGGAGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1108577445 13:51802490-51802512 TTGGGTAAATTGAGGGTGTGGGG - Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1114042210 14:18689414-18689436 CTGGGGAAAGGGAGTGTGGGAGG + Intergenic
1114659508 14:24335335-24335357 GTGGGGAGACCGAGGGCGGGGGG + Intronic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121643117 14:95499614-95499636 CTGGTTTAACGGTGGGTGGGAGG - Intergenic
1121812204 14:96901075-96901097 CTGTTTAAAGTGAGGGTGGGTGG + Intronic
1122232624 14:100314287-100314309 CTGTGCAAACGGAGGGTGGCAGG + Intergenic
1122573873 14:102728390-102728412 CTGTGTACACCGAGGGCGGCAGG + Exonic
1122662762 14:103309093-103309115 CTGGGCAAAGCGAGGGTGGCTGG + Intergenic
1122707236 14:103629093-103629115 CTGGGGAAACTGAGGCTGGGTGG - Intronic
1122994925 14:105257882-105257904 CTGGGGAAAGGCAGGGTGGGTGG + Intronic
1123130871 14:105984302-105984324 CTTGGTGAACAGAGGATGGGAGG - Intergenic
1123581098 15:21715523-21715545 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1123617747 15:22158146-22158168 CTTGGTGAACAGAGGATGGGGGG - Intergenic
1124395067 15:29293927-29293949 GTGGGGAAACTGAGGGTGGGGGG + Intronic
1125282955 15:38062500-38062522 CTGGGGAAACCGAGGGCTGGAGG - Intergenic
1125400722 15:39299779-39299801 TTGGGGAAGCAGAGGGTGGGGGG + Intergenic
1126048986 15:44669906-44669928 CTGGGTGGACAGAGTGTGGGAGG - Intronic
1126274089 15:46855873-46855895 CTGGGTAAACCCAGAATGGTTGG - Intergenic
1128357190 15:66936440-66936462 CTGGGGACGCCGTGGGTGGGTGG - Intergenic
1128632837 15:69282845-69282867 CTGGGTGAACCTGGGGTGGGTGG - Intergenic
1128866704 15:71119864-71119886 ATGGGGAAACTGAGGCTGGGTGG - Intronic
1129361927 15:75029708-75029730 CTGGGTACACAGCGGGTGGCTGG - Intronic
1129863629 15:78884394-78884416 TTTGGGAAGCCGAGGGTGGGCGG + Intronic
1130991816 15:88880082-88880104 CTGGGCAAAGCCAGGTTGGGCGG + Intronic
1131678877 15:94700961-94700983 CTGTGTCAATAGAGGGTGGGTGG + Intergenic
1133089023 16:3389333-3389355 CTGGCTAAGCCCAGGGTGGGAGG - Intronic
1133235865 16:4387180-4387202 CTGGGGAGACTGAGGCTGGGGGG - Intronic
1133367952 16:5225913-5225935 CTGGGGAATCCTTGGGTGGGGGG + Intergenic
1133702529 16:8322445-8322467 CAGAGAAAACCGAGGGTGTGAGG - Intergenic
1135993726 16:27232799-27232821 CTGGGTGAACGGGGAGTGGGAGG + Intronic
1137057837 16:35753906-35753928 CTGGGGAGACCGAGGGCTGGAGG + Intergenic
1141624790 16:85255360-85255382 ATGGGGAAACTGAGGCTGGGAGG - Intergenic
1142183612 16:88684084-88684106 TTAGGAAAACTGAGGGTGGGAGG - Intronic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1146653412 17:34621127-34621149 CTGGGGAAACTGAGGCTCGGAGG + Intronic
1147878137 17:43636213-43636235 CTGGGTAAGCCCATGGTGGGTGG - Intergenic
1150715908 17:67572458-67572480 CTGGGTAAAGCGGGGGGGGGGGG + Intronic
1151547114 17:74799925-74799947 CAAGGTAAACCGTGGGAGGGCGG - Intronic
1151582155 17:74986372-74986394 CTGGGGAGGCCGAGGTTGGGAGG - Intergenic
1151977284 17:77489967-77489989 CTGGGCAAGCCGAGGGCGGGCGG + Intronic
1152821353 17:82439341-82439363 CTGGGTGGACCTTGGGTGGGTGG - Intronic
1152945264 17:83194512-83194534 TTGGGTGAGCCAAGGGTGGGGGG + Intergenic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1157286067 18:46378308-46378330 ATGGGAAAACCGAGGCTGGGTGG + Intronic
1157592117 18:48842261-48842283 CTGAGTAGAACGAGGGTGGTGGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1160411377 18:78677644-78677666 CTGGCTCAGCCGAGGGTGTGAGG - Intergenic
1161074603 19:2279179-2279201 ATGGGGAAACCGAGGCTGAGAGG - Intronic
1161283966 19:3459444-3459466 CTGGGTAAACCGAGGGTGGGGGG + Intronic
1161526691 19:4760258-4760280 CTGGGTAAACCTAGATTTGGGGG + Intergenic
1161790498 19:6356788-6356810 CTTGGTAGACTGAGGTTGGGAGG + Intergenic
1161849581 19:6731549-6731571 CAGGGGAGACTGAGGGTGGGAGG + Intronic
1162334411 19:10051613-10051635 CTGGGAATACCGGGGGGGGGGGG - Intergenic
1162429489 19:10619077-10619099 CTGGGGAAGCCTAGGGTGGGAGG - Intronic
1162547323 19:11338755-11338777 CTGGAAAGACCAAGGGTGGGCGG - Intronic
1163125913 19:15244173-15244195 ATGGGTAAACCGAGGCAGGAAGG + Intronic
1166830894 19:45639179-45639201 CTGGGGGAACTGCGGGTGGGGGG - Intronic
1167278506 19:48552944-48552966 ATGGGGAAACTGAGGCTGGGAGG + Intronic
1167402604 19:49282893-49282915 CTTGGTTAACAGAGGATGGGCGG + Intergenic
1167792212 19:51689589-51689611 CTGCGGAAAGGGAGGGTGGGGGG + Intergenic
1168028764 19:53663312-53663334 CTGGGGACGCCGTGGGTGGGAGG + Intergenic
1168663321 19:58183898-58183920 CTGAGGAAACCGAAGTTGGGAGG - Intronic
925422869 2:3726113-3726135 CAGGGGAAACCAGGGGTGGGAGG + Intronic
926685115 2:15692099-15692121 TTGGGTAATGCGAGGGTGGGTGG + Intronic
926726803 2:16004910-16004932 ATGGGGAAACCGAGGCTGGAAGG + Intergenic
927312599 2:21647964-21647986 CTGGGGAGACCCAGGGCGGGGGG + Intergenic
930523169 2:52493798-52493820 CTGGGTAAACTGAGGGCTGCAGG - Intergenic
933775791 2:85770434-85770456 CTGGGGAAAAGGGGGGTGGGTGG + Intronic
934604609 2:95684586-95684608 CTGGGAAATCCAAGGTTGGGGGG + Intergenic
935787238 2:106560333-106560355 CTGGGAAAAAAGAGGGAGGGAGG - Intergenic
938268005 2:129943117-129943139 CTGGGGAAAGGGAGTGTGGGAGG - Intergenic
939538179 2:143459324-143459346 CTGGTTAAATGGGGGGTGGGGGG + Intronic
941238690 2:163010119-163010141 CTGGGAGAATGGAGGGTGGGTGG - Intergenic
942144448 2:173012760-173012782 CTGGTTCACCCGAGAGTGGGAGG - Intronic
946190270 2:218004077-218004099 CTGGACCAACTGAGGGTGGGTGG + Intergenic
946371687 2:219285184-219285206 CTGGTGAAGCCCAGGGTGGGGGG + Exonic
948588208 2:239034506-239034528 CTGGGGAAACCCAGAGTGGGGGG - Intergenic
948788699 2:240366099-240366121 CAGGGTATGGCGAGGGTGGGAGG - Intergenic
1169273604 20:4218558-4218580 CTGGGTTAACCGGGGCAGGGAGG + Intergenic
1172780632 20:37435000-37435022 ATGGGTACACGGTGGGTGGGAGG - Intergenic
1172838387 20:37887408-37887430 CTGGGGAAACTGAGGCTGAGAGG + Intergenic
1173338391 20:42131952-42131974 CTGGGAAAACAGAGTGTGAGGGG + Intronic
1173338712 20:42135214-42135236 CTGGGTAAACAGAGGCTCAGGGG - Intronic
1174465338 20:50712905-50712927 CTGTGGAAACCAAAGGTGGGGGG + Intergenic
1175304327 20:57965567-57965589 CTGGGAAAACCGTGGGAAGGTGG + Intergenic
1175882706 20:62270116-62270138 CAGGGTGGACGGAGGGTGGGCGG - Intronic
1179919345 21:44499188-44499210 ACGGGTAAACTGAGGCTGGGAGG + Exonic
1180007617 21:45030220-45030242 CTGGCTAAACCCAGGTTGGGAGG - Intergenic
1180937746 22:19637229-19637251 TTGGGGAAGCCCAGGGTGGGAGG + Intergenic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1182357247 22:29727813-29727835 GTGGGGAAACCGAGGCGGGGGGG - Intronic
1184093543 22:42304680-42304702 CTGGGGAAACCGAGGCAGAGAGG + Intronic
1184381740 22:44149084-44149106 ATGGGGAAACTGAGGCTGGGGGG - Intronic
1184471130 22:44697133-44697155 CTGGGGAAACTGAGGCTGTGTGG - Intronic
1184488183 22:44793972-44793994 CTGGGGAGACCGAGGGAGCGAGG + Intronic
1184920340 22:47601108-47601130 CGGGGTACACAGAGGCTGGGAGG - Intergenic
949359104 3:3213043-3213065 CTCAGGAAGCCGAGGGTGGGAGG - Intergenic
950437083 3:12986583-12986605 CTGGTGAACCCGAGAGTGGGAGG + Intronic
951078351 3:18424407-18424429 CGGGGGACAGCGAGGGTGGGGGG + Exonic
954610280 3:51941554-51941576 CTGAGGGAACCGAGGGGGGGGGG - Intronic
955484208 3:59419281-59419303 CTGGGTCACCCCAGGGTTGGGGG + Intergenic
956250629 3:67230623-67230645 CTTGGTGAACAGAGGATGGGTGG - Intergenic
961433942 3:126903363-126903385 CTGGGAAATCCGAGGCTGGGAGG - Intronic
964732304 3:159880278-159880300 CTTGGTGAACTGAGGTTGGGCGG - Intronic
969293441 4:6255104-6255126 ATGGGGAAACCAAGGTTGGGAGG + Intergenic
969468897 4:7374817-7374839 CTGGGTAGACCGCGGGTGGGGGG + Intronic
969516013 4:7648626-7648648 CTGGGTCTACTGAGGGCGGGCGG + Intronic
971300084 4:25434692-25434714 CTGAGTAAACTGAGGCTGAGTGG + Intergenic
979996304 4:127435548-127435570 CTGGGGAAGCAGAGGTTGGGAGG + Intergenic
982276312 4:153640022-153640044 GTGTCTAAAGCGAGGGTGGGAGG + Intergenic
984823955 4:183907164-183907186 TTAGGTAAAACGAGGGAGGGGGG + Intronic
985555038 5:554475-554497 CGGGATAAACCAGGGGTGGGGGG + Intergenic
985555085 5:554604-554626 CGGGATAAACCAGGGGTGGGGGG + Intergenic
985827666 5:2204949-2204971 CTGGGTAGAAGGAGGGAGGGAGG + Intergenic
991589011 5:68229596-68229618 CAGGGTAGACAGAGGGTGCGAGG + Intronic
992377557 5:76203327-76203349 ATGGGTAAATGAAGGGTGGGTGG + Intronic
996237289 5:121147229-121147251 ATGGGTAAACTGAGTGTTGGGGG + Intergenic
997309291 5:132866502-132866524 CTGGGTGACCCGTAGGTGGGAGG - Intronic
1002344404 5:178537390-178537412 ATGGGGAAACCGAGGCCGGGTGG + Intronic
1003286893 6:4742258-4742280 CTTGGGAAACTGATGGTGGGAGG + Intronic
1003426115 6:5999404-5999426 CTGTCTAAAGCGGGGGTGGGGGG + Intronic
1003619484 6:7685383-7685405 CAGTGTAAACCAAGGGTGGTTGG - Intergenic
1004624791 6:17364640-17364662 CTCGGGAGGCCGAGGGTGGGAGG - Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1013439430 6:110147853-110147875 CTTGGGAAACTGAGGGTGGGAGG - Intronic
1015128684 6:129785349-129785371 CTGGGTGAACTGAGGGTGGATGG + Intergenic
1015203990 6:130614374-130614396 GTGGGGAAAACGTGGGTGGGGGG + Intergenic
1019290055 7:245938-245960 CTCGGAAACCAGAGGGTGGGCGG + Intronic
1019476249 7:1245868-1245890 CTGGCTAAACCCACGGTGGAAGG + Intergenic
1019710278 7:2515291-2515313 CTGGTTGAACTGATGGTGGGGGG - Intronic
1019715837 7:2538922-2538944 ATGGGTAAACTGAGGATTGGAGG - Intronic
1022205384 7:28158726-28158748 TTGGGTAAACTGATGGTGAGAGG - Intronic
1024499942 7:50093958-50093980 CTGGGTAAAAAGAGGGCAGGTGG - Intronic
1025229340 7:57190494-57190516 GTGGGTAAACCGAGGATTGTCGG - Intergenic
1025297395 7:57786925-57786947 AAGGGTAAACCTGGGGTGGGGGG - Intergenic
1027172185 7:75880362-75880384 CTATGTATACCTAGGGTGGGGGG - Intronic
1028887188 7:95947477-95947499 CTGGGTAGACCAATGGTGGCAGG - Intronic
1032078024 7:128845304-128845326 CTGGGTAGTCCGTGGGAGGGAGG + Intronic
1036679718 8:10862908-10862930 CTGGGTAATGCAGGGGTGGGGGG + Intergenic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037974645 8:23200761-23200783 CTGGGTACACACAGGGAGGGAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043511699 8:80956609-80956631 CTGGGAACACTGAGGGTGGAGGG + Intergenic
1045918046 8:107497084-107497106 CTGGGTAAGCCAAGGTTTGGGGG - Intronic
1046199875 8:110911143-110911165 CTGGGGATACAGAGGGCGGGGGG + Intergenic
1049403374 8:142440807-142440829 CTGGGTAGACAGAGGGCAGGAGG - Intergenic
1055467650 9:76581769-76581791 CTGGGTACTCAGAGGGTGGCTGG - Intergenic
1056809063 9:89750254-89750276 CTGTGTCAAGCGAGGGGGGGGGG + Intergenic
1057326482 9:94069281-94069303 TTTGGTATACCGGGGGTGGGAGG - Intronic
1057546214 9:96021752-96021774 CGTGGGAAACCGAGGGCGGGAGG + Intergenic
1060672098 9:125478827-125478849 CTGGGAAAACTGAGGCTTGGAGG - Intronic
1061415633 9:130445495-130445517 CAGGGTAAACTGAGGCTGCGGGG - Intronic
1061430508 9:130527571-130527593 ATGGGGAAACTGAGGCTGGGGGG + Intergenic
1061950857 9:133935109-133935131 CTGGGCAGGCCAAGGGTGGGAGG + Intronic
1185745485 X:2569408-2569430 CTGGGTAGACTGAGAGTCGGTGG - Intergenic
1185998233 X:4977683-4977705 CTGGGAGAACTGAGGGTGTGAGG + Intergenic
1186043315 X:5505399-5505421 TTGGGAAAAGCCAGGGTGGGTGG - Intergenic