ID: 1161284539

View in Genome Browser
Species Human (GRCh38)
Location 19:3462592-3462614
Sequence CAGGTTGTTAGAGCCTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161284528_1161284539 17 Left 1161284528 19:3462552-3462574 CCTCCCTCAGAGACAAAGTCACT 0: 1
1: 0
2: 1
3: 16
4: 229
Right 1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 334
1161284530_1161284539 13 Left 1161284530 19:3462556-3462578 CCTCAGAGACAAAGTCACTTGCC 0: 1
1: 1
2: 6
3: 62
4: 418
Right 1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 334
1161284534_1161284539 -8 Left 1161284534 19:3462577-3462599 CCATGGGTCACCCAGCAGGTTGT 0: 1
1: 0
2: 2
3: 12
4: 199
Right 1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 334
1161284529_1161284539 14 Left 1161284529 19:3462555-3462577 CCCTCAGAGACAAAGTCACTTGC 0: 1
1: 0
2: 3
3: 22
4: 228
Right 1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG 0: 1
1: 0
2: 3
3: 30
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161284539 Original CRISPR CAGGTTGTTAGAGCCTGGGA TGG Intronic
900246635 1:1639326-1639348 AGGATTGTTTGAGCCTGGGAGGG + Intronic
900417378 1:2541211-2541233 CTGGTTCTTAGAGGCTGGGGAGG + Intergenic
900879396 1:5369715-5369737 AGGATTGTTTGAGCCTGGGAGGG + Intergenic
901613564 1:10518868-10518890 CAGCTTGTTAGTGCCGGTGAAGG + Intronic
901753350 1:11425767-11425789 CAGGTTGGTAGAACCTAGAAAGG + Intergenic
901810254 1:11763325-11763347 CAGCTTGTTAGAGGCTGAGGTGG + Intronic
903169582 1:21543887-21543909 CTGCTTGGTAGAGCCTTGGAGGG + Intronic
905798457 1:40828707-40828729 CACGTTCTGGGAGCCTGGGAGGG + Intronic
906584031 1:46960685-46960707 GAGGTTAGTAGAGTCTGGGAAGG + Intergenic
907590084 1:55658195-55658217 CAAGTTGTAAGACCCTGGGCAGG - Intergenic
907632978 1:56102898-56102920 GAGGTTACTAGAGGCTGGGAAGG - Intergenic
908527913 1:65005370-65005392 GTGGTTATTAGAGGCTGGGAAGG + Intergenic
909359177 1:74742244-74742266 CAGGTAGTCAAAGCCTGTGAGGG - Intronic
909676744 1:78246921-78246943 CAGGATACTAGAGGCTGGGAAGG - Intergenic
909984457 1:82143572-82143594 GAGGATGCTAGAGGCTGGGAAGG + Intergenic
911875650 1:103159841-103159863 TACATTGTTAGATCCTGGGAAGG + Intergenic
911958326 1:104265702-104265724 CAGTTTATTTGAGGCTGGGATGG - Intergenic
912016658 1:105046385-105046407 GAGGATATTAGAGGCTGGGAAGG - Intergenic
914433543 1:147640866-147640888 CAGGTTTCTAGAGGCTGGCAGGG + Intronic
914862714 1:151399788-151399810 CTGGTTTTGAGAGCCCGGGAAGG + Intronic
915559430 1:156677685-156677707 CAGGACGTTCCAGCCTGGGAGGG + Intergenic
916301740 1:163283110-163283132 GTGGTTATTAGATCCTGGGAAGG + Intronic
916533690 1:165682590-165682612 AAGGTTGGTAGGGCCTAGGAAGG - Intronic
916583372 1:166128374-166128396 CAGGTGGACAGAGCCTGGGCTGG + Intronic
917267491 1:173236819-173236841 GAGGATATTAGAGACTGGGAAGG + Intergenic
918128909 1:181608019-181608041 GAGGTTGTTAGAGCCTGGTGAGG + Intronic
918536598 1:185581828-185581850 CATGTTGTTAGAAGCTGGGAAGG + Intergenic
918922308 1:190729913-190729935 ATGGTTATTAGAGCCTGAGAAGG - Intergenic
920250991 1:204622333-204622355 CAGGATGCTAGGGCTTGGGAGGG + Intronic
922006090 1:221532061-221532083 AAGGTTGTGTGAGGCTGGGAGGG - Intergenic
922398406 1:225226188-225226210 TATGTTATTAGAGGCTGGGAAGG - Intronic
922550558 1:226491113-226491135 CAGGTTGATGGGGCCTAGGAGGG + Intergenic
924259624 1:242215989-242216011 CATGTTGTTAGAAGCGGGGAAGG - Intronic
1063599134 10:7464178-7464200 AAGATTGTTTGAGCCTAGGAGGG - Intergenic
1066015518 10:31239191-31239213 GTGGTTATTAGAGGCTGGGAAGG + Intergenic
1066496281 10:35945240-35945262 CAGGTGGGCAGAGACTGGGATGG - Intergenic
1066962703 10:42235837-42235859 CAGGTTGTAGGAGCCTTGTAGGG - Intergenic
1067096276 10:43302795-43302817 CACGTTATTATAGGCTGGGAAGG + Intergenic
1067373554 10:45706887-45706909 CAGGTGGTTACAGCCTGCGATGG + Intergenic
1067380135 10:45765332-45765354 CAGGTGGTTACAGCCTGCGATGG - Intronic
1069118200 10:64534711-64534733 CAGGTGTTTAGAGTCTGGGGAGG + Intergenic
1070235445 10:74620278-74620300 GAGGATATTAGAGGCTGGGAAGG - Intronic
1071524580 10:86350954-86350976 CAGGTTACTAGAGACTGGGGAGG - Intronic
1072729855 10:97838347-97838369 TAGCTTGGTAGAGACTGGGAAGG - Intergenic
1073006553 10:100329658-100329680 CCGGTTGTGGGAGCCTGGCATGG - Intronic
1073006796 10:100330704-100330726 GAGGTGGGCAGAGCCTGGGAGGG - Intergenic
1074149714 10:110747372-110747394 CAGGTGCTTTGAGCCTGGGCAGG - Intronic
1075080386 10:119379590-119379612 GAGGGCGATAGAGCCTGGGAAGG - Intronic
1075419222 10:122288567-122288589 CAGTGTGTGTGAGCCTGGGATGG + Intronic
1075667508 10:124241419-124241441 CAGCTGGTTAGAACCTGGAATGG + Intergenic
1075987881 10:126803704-126803726 CAGTTGGTTAGGGACTGGGAGGG - Intergenic
1076569173 10:131421093-131421115 CAGGAGGGTAGGGCCTGGGAGGG - Intergenic
1077148425 11:1056332-1056354 CGGGTTAATAGAGCGTGGGACGG + Intergenic
1078050718 11:7962905-7962927 AAGGGTCTTAGAGACTGGGAGGG - Intronic
1078305711 11:10183817-10183839 GTGGTTATTAGAGGCTGGGAAGG + Intronic
1078589768 11:12629813-12629835 TAGGCTGTTAGAAACTGGGATGG - Intergenic
1079205708 11:18412617-18412639 CAGAATGTTGGAGCCGGGGATGG - Intronic
1080571849 11:33564111-33564133 CAGTTGGTTAGTGCTTGGGAAGG + Intronic
1080922108 11:36719772-36719794 GAGGTTTTTATAGGCTGGGACGG - Intergenic
1081551953 11:44121760-44121782 GAGAGTGTTAGAGCCTGGGCAGG - Intronic
1082901609 11:58259852-58259874 GTGGTTATTAGAGCCTGGTAAGG - Intergenic
1083560096 11:63666489-63666511 CAGGTTGTTAGTGGCAGGGCTGG - Intronic
1084029687 11:66473957-66473979 CAGCTTGTGAGGGCCTGGCAAGG - Intronic
1084041478 11:66545583-66545605 CATTTTTTTAGAACCTGGGATGG - Intronic
1084726533 11:70945964-70945986 GAGGGAGGTAGAGCCTGGGAAGG - Intronic
1085086475 11:73671248-73671270 AAGATTGCTTGAGCCTGGGAGGG + Intergenic
1085154289 11:74279196-74279218 CAGGTTGTTAGATCATCTGAGGG - Intronic
1085927389 11:81038297-81038319 TATGTTATTAGAGGCTGGGAAGG - Intergenic
1086774578 11:90814441-90814463 CATGGTTTTAGAGGCTGGGAAGG + Intergenic
1087254565 11:95939536-95939558 TATGTTATTAGAGGCTGGGAAGG - Intergenic
1089427787 11:118394242-118394264 AGGGTTGCTTGAGCCTGGGAGGG - Intronic
1089458747 11:118640719-118640741 CAGGTTGTTGGGGACGGGGAGGG + Intronic
1090957681 11:131527815-131527837 CAGATTGTTAAATCCTGGAAAGG - Intronic
1091112184 11:132979810-132979832 CAGCTTGTAAGAGACTGAGAAGG + Intronic
1096609895 12:52794236-52794258 AAGGTTGTTTGTGCCTGAGATGG + Exonic
1096736047 12:53655752-53655774 CAGGGTGTTAGAGCCTGAGGAGG - Intronic
1096746727 12:53733372-53733394 CATGTTGATAGAGCATGGAATGG - Intergenic
1096863873 12:54549770-54549792 CAGGTGGGAAGGGCCTGGGATGG + Exonic
1097089036 12:56490663-56490685 CAGGTGGTTAAAGCTTGGCAGGG + Intergenic
1097293623 12:57941371-57941393 CGGGTTGTTACAGCCTTTGAGGG + Intergenic
1098108183 12:67093308-67093330 GTGGTTATTAGAGGCTGGGAAGG + Intergenic
1099945602 12:89240244-89240266 ATGGTTGTAAGAGGCTGGGAAGG - Intergenic
1100097183 12:91055041-91055063 GAGGTTGTTTGTGCCTGGTATGG + Intronic
1100122737 12:91387875-91387897 CAGCCTGTCAGAGCCTGGCATGG + Intergenic
1100459031 12:94780371-94780393 CAGGTTGTGGGGTCCTGGGAGGG - Intergenic
1100903891 12:99275347-99275369 AAGGTTATCAGAGGCTGGGAAGG - Intronic
1101109699 12:101473626-101473648 CAGGTGCAAAGAGCCTGGGATGG - Intergenic
1101461016 12:104893839-104893861 ATGGTTGCTAGAGGCTGGGAAGG + Intronic
1102716616 12:114979028-114979050 AAGGATATTAGAGACTGGGAAGG + Intergenic
1103241910 12:119420548-119420570 ATGGTTATTAGAGGCTGGGAAGG + Intronic
1103949307 12:124542519-124542541 CAGGTTCCTAGGGCCTGGGACGG - Intronic
1104145901 12:126033455-126033477 CACGTTATTAGAGCCTGGGAAGG - Intergenic
1104410576 12:128554301-128554323 CAGGCTGTGAGAGGCGGGGAGGG + Intronic
1104617846 12:130285266-130285288 CTGGTTGTTACAACTTGGGAGGG + Intergenic
1105348325 13:19593937-19593959 ATGGTTATTAGAGGCTGGGAAGG + Intergenic
1105686247 13:22785102-22785124 GTGGTTCTTAGGGCCTGGGATGG + Intergenic
1105850646 13:24332397-24332419 CAGGTTATTAGAGGGTGGAAAGG - Intergenic
1106412278 13:29518922-29518944 CAGCTTGTTATAGCCTGGTGGGG - Intronic
1107265445 13:38548037-38548059 ATGGTTATTAGAGGCTGGGAAGG - Intergenic
1108034547 13:46275000-46275022 GTGGTTATTAGAGGCTGGGAAGG - Intronic
1108615411 13:52127998-52128020 CAGGTGGTTGGGGCCTGAGATGG + Intronic
1109178468 13:59184667-59184689 GTGGTTGCTAGAGGCTGGGAAGG - Intergenic
1110449200 13:75622186-75622208 CAGGTTGAAAATGCCTGGGAGGG - Intronic
1110590861 13:77257218-77257240 CTGGTTACTAGAGACTGGGAAGG + Intronic
1111085366 13:83370011-83370033 ATGGTTGCTAGAGCCTGGGAAGG - Intergenic
1112540129 13:100301534-100301556 CAGCTTGTTTGTGCCTGAGAGGG - Exonic
1113236303 13:108278738-108278760 CAGGTTATTTGAGACAGGGAAGG + Intronic
1113441299 13:110330693-110330715 CATGTAGATACAGCCTGGGAAGG - Intronic
1113500224 13:110767480-110767502 CTGGCTGATAGAGGCTGGGAGGG + Intergenic
1113794018 13:113046339-113046361 CAGGGTCCCAGAGCCTGGGAGGG - Intronic
1113914352 13:113861911-113861933 CAGGCTGTGAGAGGATGGGAGGG + Intronic
1114863681 14:26559717-26559739 CTGGTTATCAGAGGCTGGGAAGG + Intronic
1115171303 14:30510624-30510646 GTGGTTATTAGAGGCTGGGAAGG + Intergenic
1117043486 14:51789260-51789282 GAGGTTACTAGAGGCTGGGAGGG - Intergenic
1117328424 14:54689700-54689722 CTGGTTGTTAGCGCCTAAGATGG - Intronic
1117914990 14:60668546-60668568 GTGGTTGCTAGAGGCTGGGAGGG + Intergenic
1118247248 14:64123251-64123273 CAGCCTGATAGAGCCTGTGACGG - Intronic
1118729191 14:68654813-68654835 CGGGTTCTTGGAGCCTGAGAGGG - Intronic
1119218969 14:72891689-72891711 CAGGGTGTGAGAGGCTGGGCTGG + Intronic
1120103550 14:80470352-80470374 CACGTTATTAAAGCCTGGGAAGG - Intergenic
1122980665 14:105191157-105191179 CAGGGTCTTGGAGCCTGGGGAGG - Intergenic
1124145936 15:27125327-27125349 GAGGTTATTAGAGGCTGAGAAGG + Intronic
1125362615 15:38880107-38880129 AAGGTCGTAAGAGCCTGAGATGG - Intergenic
1126197208 15:45945375-45945397 GTGGTTATTAGAGGCTGGGAAGG + Intergenic
1126563160 15:50067052-50067074 CAGTTTGTTAGAGAGTGGGAGGG - Intronic
1128370237 15:67034873-67034895 CAGGTTTTTAGAGCTTCAGATGG + Intergenic
1130169512 15:81497258-81497280 CCTGTTGTGAGAGCCTGAGAAGG - Intergenic
1130677520 15:85966553-85966575 CAAGTTGTTAGATGTTGGGATGG + Intergenic
1132124799 15:99213613-99213635 AAGGTTGTTAGTGACTGGGAAGG - Intronic
1136355735 16:29744152-29744174 CAGGTGGAAGGAGCCTGGGAAGG + Exonic
1138030151 16:53553284-53553306 CAGGTGGTTAGGGCCAGTGAGGG + Intergenic
1138273716 16:55715661-55715683 GAGGATGCTAGAGGCTGGGAAGG - Intergenic
1138515774 16:57535009-57535031 CAGGGTTTCAGAGCCGGGGAAGG - Intronic
1140474754 16:75234378-75234400 CCTGGTGTTGGAGCCTGGGAAGG - Intronic
1140566697 16:76051062-76051084 TAGTTTGCTAGAGGCTGGGAAGG - Intergenic
1141141491 16:81499605-81499627 CAGATTCTTGGAGGCTGGGATGG - Intronic
1144775003 17:17780990-17781012 CAGGTTCCTAGCTCCTGGGAGGG - Intronic
1145403680 17:22568541-22568563 CAGGTGGTAGGAGCCTGGTAGGG - Intergenic
1145774495 17:27518588-27518610 CAGATTGCAAGAGCCTGGCAAGG - Intronic
1146140369 17:30362622-30362644 CAGGGTGTCAGAGCCTAAGAGGG + Intergenic
1146271993 17:31490644-31490666 AAGATTGCTTGAGCCTGGGAGGG - Intronic
1147648671 17:42049746-42049768 CAGGTAGGTAGAGCCCAGGAAGG + Intronic
1148207041 17:45785329-45785351 CGGGTTGTGTGAGCCAGGGAAGG + Intronic
1148872683 17:50668050-50668072 CAGGTTGTTGGGGTCAGGGAAGG + Intronic
1149147046 17:53506563-53506585 ATGGTTATTAGAGGCTGGGAAGG - Intergenic
1149287151 17:55177295-55177317 CAGGGTGTTACAGCCAGAGAAGG - Intergenic
1149573703 17:57696230-57696252 CATGTTGGGAGAGCCTGGCATGG + Intergenic
1149865180 17:60147627-60147649 CCGGTTGTGAGAGTCTGGGCTGG + Intergenic
1150467896 17:65410405-65410427 CTAGTTATTAGAGGCTGGGAAGG + Intergenic
1150563990 17:66321940-66321962 CCAGTTGTTAGAGCCAAGGATGG - Intronic
1151295160 17:73179896-73179918 CAGGTTGTTAGACCCTGGAGTGG - Intergenic
1152656188 17:81520122-81520144 CAGGTTGTTTGCGGCTGGGCTGG + Intronic
1153541364 18:6159361-6159383 CAGCTTGTTAGAGCCAGAGTGGG - Intronic
1156217391 18:35013680-35013702 CAGGATACTAGAGGCTGGGAAGG - Intronic
1156474214 18:37395378-37395400 CAGCTTGCAAGAGCCTGGAAGGG - Intronic
1156503456 18:37574474-37574496 CAGGCTGTTAGAACCTGCGATGG + Intergenic
1158835304 18:61324499-61324521 CAGGTTACTAGAGACTGGGAAGG + Intergenic
1158902828 18:61982198-61982220 ATGGTTTTCAGAGCCTGGGAAGG - Intergenic
1159214727 18:65376490-65376512 AGTGTTTTTAGAGCCTGGGAAGG - Intergenic
1159525260 18:69580843-69580865 GTGGTTATTAGAGGCTGGGAAGG - Intronic
1160631705 18:80250992-80251014 CAGATTGTTTGAGACTGGGGAGG + Intergenic
1161284539 19:3462592-3462614 CAGGTTGTTAGAGCCTGGGATGG + Intronic
1161357564 19:3827436-3827458 CAGGGTGGCAGAGCCTGGGCCGG + Intronic
1162294553 19:9804189-9804211 CAGGTCATTTGAGCCTGGGGAGG - Intergenic
1164255679 19:23526173-23526195 CACGTTGTCAGAGGCTGAGAAGG + Intronic
1166104036 19:40588954-40588976 CAGGTTGTTAGAGTTGGGCAGGG - Intronic
1166269037 19:41702182-41702204 TTGGTTGTTAGAGCTTGGGGAGG - Intronic
1166454877 19:42932534-42932556 CAGGGTGTCAGAGGCTGGAAGGG - Intronic
1166625858 19:44355576-44355598 CAGGTGGTAAGAGCCTGAGCTGG - Intronic
1166641448 19:44498226-44498248 CATGTATTTAGAGCCTGGGTAGG - Intronic
1166783107 19:45352455-45352477 CTGGTTCTTGGAGCCTGGGATGG + Intronic
1167662931 19:50806757-50806779 CAAGTAGTTAGAGCCGGGCATGG - Intergenic
926092159 2:10058115-10058137 CAGATTGTCAGAGCTGGGGAGGG + Exonic
928125931 2:28616051-28616073 GTGGTTATTAGAGGCTGGGAAGG + Intronic
928384795 2:30857964-30857986 CTGGTTATCAGAGGCTGGGAAGG + Intergenic
929025888 2:37601190-37601212 CATGTTGTTAGATACTGGAAAGG + Intergenic
929456470 2:42069569-42069591 TAGGTTATTAGAGCCCAGGAGGG - Intergenic
929579961 2:43075837-43075859 CAGGTTGGCAAGGCCTGGGATGG - Intergenic
930452931 2:51566234-51566256 GTGGTTATTAGAGACTGGGAAGG - Intergenic
930717456 2:54606218-54606240 CTGCTGGTTGGAGCCTGGGAAGG + Intronic
932391382 2:71393773-71393795 AACGTTATTAGAGGCTGGGAAGG - Intronic
934060375 2:88286810-88286832 GTGGTTGTTAGAGGCTGGTAGGG - Intergenic
934088933 2:88534222-88534244 GTGGTTATTAGAGGCTGGGAAGG - Intergenic
934686156 2:96323313-96323335 GAGGATGCTAGAGGCTGGGAAGG + Intergenic
935057677 2:99581774-99581796 CTGGCTGTTAGAGGCTGGCATGG + Intronic
935800175 2:106687976-106687998 CACCTTGTTATTGCCTGGGAGGG + Intergenic
936032252 2:109081738-109081760 CAGGTTGTGAAGTCCTGGGATGG - Intergenic
936779924 2:116019933-116019955 CAGGTTGCTGGAACCTGGCAAGG - Intergenic
937949828 2:127375782-127375804 CACGTTGTTAGAAGCTGGGAAGG - Intronic
938863705 2:135396648-135396670 ATGGTTATTAGAGACTGGGAAGG + Intronic
939376391 2:141374197-141374219 CAGGTGATTAGAGAATGGGATGG - Intronic
939424977 2:142023738-142023760 AAGGTAGTTTGAGACTGGGATGG + Intronic
940810080 2:158232843-158232865 GTGGTTATTAGAGGCTGGGAAGG + Intronic
941170460 2:162129553-162129575 AAGGTTATCAGAGGCTGGGAAGG - Intergenic
942093620 2:172517654-172517676 CACGTTATTAAAGGCTGGGAAGG - Intergenic
943634034 2:190285667-190285689 CAGGTAGGTAGAGCCTAGGTAGG - Intronic
943789653 2:191917995-191918017 GAGGTTGTCAGAGCCTTGCAAGG - Intergenic
945230831 2:207587772-207587794 GTGGGTATTAGAGCCTGGGAAGG + Intronic
946197766 2:218046364-218046386 GAGGTTACTAGAGGCTGGGAAGG - Intronic
946447543 2:219752343-219752365 ATGGTTATTAGAGGCTGGGAAGG - Intergenic
947486648 2:230556154-230556176 CATGTTGATAGAGGATGGGATGG - Intergenic
947742653 2:232491689-232491711 CAGGATCTGAGAGCCTGGGCAGG - Intergenic
948258388 2:236584764-236584786 CAGAGTATTAGAGCCTGGGATGG - Intergenic
948324811 2:237106180-237106202 CAGGATACTAGAGGCTGGGAAGG + Intergenic
948588986 2:239037580-239037602 CACGTTGTCAGAGCCTGGCCCGG - Intergenic
948756066 2:240160380-240160402 CAGGTGGCCAGAGCCTGGGGGGG - Intergenic
948869300 2:240790249-240790271 CTGGGTGTGAGAACCTGGGAGGG - Intronic
948873362 2:240815081-240815103 CAGGTCCTTGGGGCCTGGGAGGG - Intronic
1168778505 20:468600-468622 TACGTTATTAGAGGCTGGGAAGG + Intergenic
1169413358 20:5393668-5393690 CAGCTTGATAAAGCCTTGGAGGG - Intergenic
1169991653 20:11510878-11510900 ATGGTTACTAGAGCCTGGGAAGG + Intergenic
1171106414 20:22437509-22437531 GAGGTTATTATAGCCTGAGAAGG - Intergenic
1171561820 20:26134022-26134044 CAGGTGGTAGGAGCCTGGTAGGG - Intergenic
1173162421 20:40662744-40662766 CAGGTTCTGAGAGGCTGGGCTGG - Intergenic
1173322845 20:42004644-42004666 TAGGTTTTTAGAGAATGGGATGG + Intergenic
1174388015 20:50198296-50198318 CAGGGTGTTGGAGGCTGGGCGGG + Intergenic
1175652673 20:60739939-60739961 TAGGTTGACAGAGACTGGGAGGG - Intergenic
1183328079 22:37205106-37205128 CAGGATGATAGAGCATGGGGAGG + Exonic
1184305526 22:43598388-43598410 GAGGTTATCAGAGGCTGGGAAGG + Intronic
1184487563 22:44790037-44790059 CACATTGTCAAAGCCTGGGAGGG + Intronic
950432519 3:12959101-12959123 CAGGATGTCAGGGCCTGGGCAGG + Intronic
954634672 3:52065032-52065054 CAGGTGGTTTGAGCAGGGGATGG + Intergenic
957404095 3:79754832-79754854 CAGGTAATTAGAGCTTGGGTAGG - Intronic
959981338 3:112521277-112521299 GTGGTTTTTAGAGTCTGGGAAGG - Intergenic
961121160 3:124371949-124371971 AAGGTTTTTAGAAGCTGGGAAGG - Intronic
961398837 3:126619537-126619559 GTGGTTATTAGAGGCTGGGAAGG + Intronic
962600884 3:136990103-136990125 AAGGGTGCTACAGCCTGGGATGG + Intronic
962982778 3:140505987-140506009 CAGCTTGTTAGTGGCAGGGATGG - Intronic
963033681 3:141005222-141005244 CTGGTTACTAGAGGCTGGGAAGG - Intergenic
965348859 3:167588111-167588133 ATGGTTATTAGAGGCTGGGAAGG - Intronic
965502265 3:169471078-169471100 AGGGTTGTTTGAGCCTGGGGTGG - Intronic
965602515 3:170469115-170469137 GAGGATGTTAGGGCCCGGGAAGG - Intronic
967849010 3:194068494-194068516 ATGGTTATTAGAGGCTGGGAAGG + Intergenic
970011330 4:11462829-11462851 ATGGTTGCTAGAGGCTGGGAAGG + Intergenic
973208312 4:47585650-47585672 ATGGTTATCAGAGCCTGGGAAGG - Intronic
973600427 4:52537323-52537345 CAGTTAGTTATAGCCTGGGGTGG - Intergenic
975220275 4:71806133-71806155 CACATTGTTAGAGGCTAGGAAGG + Intergenic
976230162 4:82834375-82834397 GTGGGTGTTAAAGCCTGGGAGGG + Intronic
976298648 4:83497029-83497051 GAGGATATTAGAGACTGGGAAGG - Intronic
976381927 4:84409093-84409115 GTGGTTGATAGAGCCTGCGATGG + Intergenic
976445448 4:85125920-85125942 CACATTGTTAGATGCTGGGAAGG + Intergenic
977202782 4:94136565-94136587 AAGATTGTTTGAGCCTGGGAAGG + Intergenic
977325125 4:95565198-95565220 GTGGTTATTAGAGGCTGGGAAGG - Intergenic
977341520 4:95764274-95764296 CTGGTAGTTAGGGCCTGGAATGG - Intergenic
977495545 4:97770830-97770852 CAGGATGTAAGAGGCAGGGATGG + Intronic
978037818 4:104017987-104018009 CTGGTTATTAGAGGCTGCGAAGG + Intergenic
982382016 4:154759266-154759288 CAAGTTATTAGAGCCTGGCAAGG - Intergenic
982668860 4:158296917-158296939 TATGTTATTAGAGGCTGGGAAGG - Intergenic
982979971 4:162119832-162119854 GAGGATACTAGAGCCTGGGAAGG - Intronic
984051339 4:174868839-174868861 CAGTTTGTGAGAGCCTATGAGGG - Intronic
985017917 4:185656710-185656732 CAGCTTCTGAGAGCCTGGGCAGG - Intronic
985608721 5:873821-873843 AACGTTCTCAGAGCCTGGGAAGG + Intronic
986370880 5:7078887-7078909 CAGGTTTTCAAAGCCTGGCAGGG + Intergenic
986841984 5:11708133-11708155 AGGGTTGCTTGAGCCTGGGATGG - Intronic
987093608 5:14528875-14528897 CAGGATGTTGAAGCCAGGGATGG + Intronic
987510670 5:18834019-18834041 GAGGTTACTAGAGACTGGGAAGG - Intergenic
989009933 5:36858460-36858482 AAGATTGTGATAGCCTGGGATGG - Intergenic
989593914 5:43138066-43138088 CGGGTTGCTAGGGGCTGGGAGGG + Intronic
990150817 5:52815304-52815326 TAGGTTTTGGGAGCCTGGGATGG + Intronic
992308551 5:75468786-75468808 CATGTTGTTAGATCCTGGGCAGG - Intronic
994331943 5:98516531-98516553 GTGGTTATTAGAGGCTGGGAAGG - Intergenic
995535647 5:113133300-113133322 GTGGTTATTAGAGGCTGGGAAGG - Intronic
996102888 5:119463017-119463039 CTGGTTACTAGAGGCTGGGAAGG - Intronic
997834420 5:137180758-137180780 CTGTTTGTCAGAGACTGGGAAGG - Intronic
998079053 5:139259633-139259655 CATTTTGTTAGAGCTGGGGAAGG - Intronic
998758186 5:145403561-145403583 CAGGTGTTTTGAGCCTGGGAAGG - Intergenic
999003612 5:147951524-147951546 GTGGTTACTAGAGCCTGGGAGGG - Intergenic
999718462 5:154380796-154380818 GAGGTTGTTACAAGCTGGGAGGG - Intronic
1000107852 5:158077615-158077637 GTGGTTTTTAGAGGCTGGGAAGG - Intergenic
1000443147 5:161286426-161286448 CAGTTTCTCAGAGACTGGGAGGG - Intergenic
1002414773 5:179114239-179114261 CAGCTTGTTGTAGCCTGGGATGG + Exonic
1003028857 6:2582870-2582892 CAGGAGACTAGAGCCTGGGAAGG - Intergenic
1005433019 6:25778436-25778458 CAGTATGCTAGTGCCTGGGAGGG - Intronic
1006423024 6:33947355-33947377 CAGGTTGGGAGAGACTGTGAGGG + Intergenic
1006575929 6:35045838-35045860 CAGGGTGTTAGGTCCTGGGCTGG - Intronic
1006620564 6:35360996-35361018 CGGGTAGCTAGAGGCTGGGAGGG + Intronic
1006887073 6:37390791-37390813 CAGGTAGTGCGAGCCTGAGATGG + Exonic
1007255560 6:40525790-40525812 CAGGTTGTAAGAGCCAGGGCTGG - Intronic
1007337918 6:41167976-41167998 CAGGATGTTAGACCAAGGGAAGG + Intergenic
1007822716 6:44572709-44572731 CAGGTTCTGAGAGCCTGGCCTGG - Intergenic
1009760674 6:68001368-68001390 AGGGTTGTCAGAGGCTGGGAAGG - Intergenic
1010123648 6:72408511-72408533 CAGATTGATTGAGCCTGGGAGGG + Intergenic
1012377012 6:98574366-98574388 GAGGGTGTTAGAAGCTGGGAGGG - Intergenic
1017186387 6:151605056-151605078 GTGGTTATTAGAGGCTGGGAAGG - Intronic
1017607635 6:156150458-156150480 AGGGTTGGCAGAGCCTGGGATGG - Intergenic
1018660686 6:166084012-166084034 GAGGATGCTAGAGGCTGGGAAGG + Intergenic
1018786170 6:167109669-167109691 GAGGATGCTAGAGGCTGGGAAGG - Intergenic
1018815987 6:167331418-167331440 GAGGTTTCTAGAGGCTGGGAAGG - Intronic
1019255951 7:51148-51170 GAGGATATTAGAGGCTGGGAAGG + Intergenic
1020483040 7:8685755-8685777 AAGGTTACCAGAGCCTGGGAAGG + Intronic
1021097516 7:16550127-16550149 GAGGATGCTTGAGCCTGGGAGGG + Intronic
1022685460 7:32592111-32592133 CAGGATGTGAGAGCCAAGGACGG - Intergenic
1023117887 7:36880173-36880195 AAGGGTGATAGAGGCTGGGAAGG + Intronic
1024043332 7:45571655-45571677 CGTGTTGTTAAACCCTGGGAGGG - Intergenic
1024329727 7:48143935-48143957 CATGTTGTTAGAGGCTGGGAAGG - Intergenic
1026313699 7:69210131-69210153 GAGGATGGTTGAGCCTGGGAGGG - Intergenic
1027587553 7:80076691-80076713 CAGGGTGTCAGAGCCTTAGAGGG + Intergenic
1028564846 7:92218467-92218489 AAGGTTGCTTGAGTCTGGGAGGG - Intronic
1030896910 7:115072019-115072041 ATGGTTATTAGAGGCTGGGAAGG + Intergenic
1031725506 7:125233121-125233143 GAGGCTGCTTGAGCCTGGGAGGG - Intergenic
1032930810 7:136667669-136667691 GTGGTTGTTAGAGGATGGGAAGG - Intergenic
1034716679 7:153249621-153249643 TTGGTTGTCACAGCCTGGGAAGG - Intergenic
1035240873 7:157528362-157528384 AAGATTGCTTGAGCCTGGGAGGG - Intergenic
1035240884 7:157528416-157528438 AAGATTGTTTGAGCCTGGGAGGG - Intergenic
1036107119 8:5853258-5853280 TACGTTATTAGAGGCTGGGAAGG + Intergenic
1036635913 8:10549368-10549390 ATGGTTGTAAGAGCCTAGGAGGG + Intronic
1037733041 8:21545169-21545191 AAGGTTCTCAGAACCTGGGATGG + Intergenic
1038305039 8:26392604-26392626 GTGCTTCTTAGAGCCTGGGATGG + Intronic
1039660895 8:39463617-39463639 ATGGTTGCCAGAGCCTGGGAAGG + Intergenic
1040061304 8:43105346-43105368 CAGTTTTCTAGAGGCTGGGAAGG - Intronic
1040396755 8:47007889-47007911 CAGGTTGTTAATGCTTGTGAAGG - Intergenic
1043605819 8:81998296-81998318 CAAGGTGCTAGAGGCTGGGAAGG - Intergenic
1043925177 8:86028676-86028698 CAGGTTGGTTGAACCTGGGGTGG - Intronic
1044198855 8:89411291-89411313 CAGGATACTAGAGGCTGGGAAGG + Intergenic
1045108992 8:98921574-98921596 CAAGTTGTTACAGCCTATGATGG + Intronic
1047434452 8:124824253-124824275 TAGATTGTAAGAGCCTGGCAGGG + Intergenic
1047816822 8:128473780-128473802 AAGTGTGTCAGAGCCTGGGAGGG - Intergenic
1048996704 8:139799051-139799073 ATGGTGTTTAGAGCCTGGGATGG + Intronic
1050398762 9:5228943-5228965 CACGTTATTAAAGGCTGGGAAGG - Intergenic
1050761623 9:9079215-9079237 GAGGATATTAGAGGCTGGGAAGG - Intronic
1050925283 9:11256474-11256496 TATGTTATTAGAGGCTGGGAAGG + Intergenic
1052812142 9:33070852-33070874 ATGGTTGTCAGAGGCTGGGAAGG + Intronic
1055622863 9:78144273-78144295 CAGGTTGTAAGAGCCAGGAGAGG + Intergenic
1056572424 9:87827633-87827655 CAGGTCTTTAAAGCCTGGAAAGG - Intergenic
1056587338 9:87937465-87937487 CAGGTGGTAGGAGCCTGGTAGGG - Intergenic
1056609539 9:88115478-88115500 CAGGTGGTAGGAGCCTGGTAGGG + Intergenic
1057778826 9:98033651-98033673 CTGGTTGATAGAGCTTTGGAAGG + Intergenic
1058085260 9:100741290-100741312 ATGGTTATTAGAGGCTGGGAAGG - Intergenic
1059995736 9:119907091-119907113 CACATTGTAAGATCCTGGGAGGG + Intergenic
1060547717 9:124470679-124470701 TAGGGTGTCAGGGCCTGGGAGGG + Intronic
1061978511 9:134086186-134086208 AAGATTGCTGGAGCCTGGGAGGG - Intergenic
1062319265 9:135982461-135982483 CAGGTGGTGAGAGCCAGAGATGG + Intergenic
1062384371 9:136303280-136303302 CAGGTGCGCAGAGCCTGGGAGGG + Exonic
1185943576 X:4348793-4348815 TTGGTTATTAGAGGCTGGGAAGG - Intergenic
1186924526 X:14318332-14318354 GTGGTTGTCAGAGCCTGGGAAGG + Intergenic
1187020179 X:15373442-15373464 CAGCTTTTTAAAGCCTTGGAAGG - Intronic
1187788015 X:22915324-22915346 CAGGTTTTTAGAGCATGAGAGGG - Intergenic
1188085727 X:25899074-25899096 CACATTGTTAGAGGCTGGGAAGG - Intergenic
1188192825 X:27193272-27193294 AAGGATGTAAGACCCTGGGAAGG + Intergenic
1188210963 X:27422826-27422848 ATGGTTATTAGAGGCTGGGAAGG + Intergenic
1188469680 X:30524018-30524040 GTGGTTATTAGAGGCTGGGAAGG - Intergenic
1188845430 X:35066075-35066097 GAGAGTGTTAGGGCCTGGGAAGG + Intergenic
1189121580 X:38400710-38400732 CAGGTTGGAACAGCCTGGGGAGG + Intronic
1189993870 X:46620330-46620352 GAGATTGCTTGAGCCTGGGAGGG + Intronic
1190217375 X:48488965-48488987 CAGGCTGTGTGACCCTGGGAAGG + Intergenic
1190430631 X:50374941-50374963 CAGGGGGTTGGAGTCTGGGAGGG - Intronic
1191957828 X:66665320-66665342 CACCTTGCTAGAGCCTGGCAAGG + Intergenic
1193055732 X:77147740-77147762 CTGGTTGCTAGAGGCTGGGAAGG + Intergenic
1193811910 X:86061766-86061788 CTGGTTATTAGAGGCTGGGAAGG + Intergenic
1193993039 X:88332621-88332643 TAGGATGTTGGAGCCTGAGAGGG + Intergenic
1194002049 X:88442724-88442746 GAGGTTATCAGAGACTGGGAGGG - Intergenic
1194515804 X:94852744-94852766 TAGATAGATAGAGCCTGGGAGGG - Intergenic
1195057981 X:101165145-101165167 CAGGTCCTTATAGCCTGGCATGG + Intergenic
1195729400 X:107950695-107950717 AAGATTGCTTGAGCCTGGGAAGG + Intergenic
1195741648 X:108070886-108070908 CAGATAGTGAGAGTCTGGGAAGG + Intronic
1195822994 X:108967672-108967694 CATGTAGTTAGAGCTTGGGAGGG + Intergenic
1197721477 X:129747631-129747653 CTGTCTGTTAGAGCCTTGGAGGG - Exonic
1198387322 X:136141955-136141977 GTGGTTACTAGAGCCTGGGAAGG + Intergenic
1199618429 X:149677670-149677692 TATGTTATTAGAGGCTGGGAAGG + Intergenic
1199624213 X:149725579-149725601 TATGTTATTAGAGGCTGGGAAGG - Intergenic
1200077848 X:153560501-153560523 CTGGTTGGTTGAGCCTGGGGTGG + Intronic
1200097738 X:153672087-153672109 CAGGCTGTGGGAGCCGGGGAGGG - Intronic
1200824055 Y:7620801-7620823 CATGTTGTTACAGAGTGGGAAGG + Intergenic
1201920372 Y:19227456-19227478 CTGGTTGCTAGAGACTGAGAAGG + Intergenic
1202039005 Y:20663523-20663545 CATGTTGTTAGAGGCTGGGAAGG - Intergenic
1202236001 Y:22710287-22710309 CATGTTGTTACAGAGTGGGAAGG - Intergenic
1202307162 Y:23485881-23485903 CATGTTGTTACAGAGTGGGAAGG + Intergenic
1202563643 Y:26184705-26184727 CATGTTGTTACAGAGTGGGAAGG - Intergenic