ID: 1161284701

View in Genome Browser
Species Human (GRCh38)
Location 19:3463302-3463324
Sequence CGTCCTCGGTGGGGGCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 162}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161284701_1161284720 20 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284720 19:3463345-3463367 AGACACAGCGGACCCCGGCCGGG 0: 1
1: 0
2: 1
3: 4
4: 131
1161284701_1161284715 -3 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284715 19:3463322-3463344 ACGCAGCCACTGGGGGGAAAGGG 0: 1
1: 0
2: 0
3: 11
4: 180
1161284701_1161284719 19 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284719 19:3463344-3463366 GAGACACAGCGGACCCCGGCCGG 0: 1
1: 0
2: 1
3: 9
4: 113
1161284701_1161284711 -10 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284711 19:3463315-3463337 ACCGAGGACGCAGCCACTGGGGG 0: 1
1: 0
2: 0
3: 8
4: 104
1161284701_1161284714 -4 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284714 19:3463321-3463343 GACGCAGCCACTGGGGGGAAAGG 0: 1
1: 0
2: 2
3: 23
4: 246
1161284701_1161284718 15 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284718 19:3463340-3463362 AAGGGAGACACAGCGGACCCCGG 0: 1
1: 0
2: 0
3: 12
4: 170
1161284701_1161284717 8 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284717 19:3463333-3463355 GGGGGGAAAGGGAGACACAGCGG 0: 1
1: 0
2: 7
3: 122
4: 1247
1161284701_1161284713 -9 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284713 19:3463316-3463338 CCGAGGACGCAGCCACTGGGGGG 0: 1
1: 0
2: 0
3: 13
4: 153
1161284701_1161284721 26 Left 1161284701 19:3463302-3463324 CCCCTCAGCCCCCACCGAGGACG 0: 1
1: 0
2: 0
3: 17
4: 162
Right 1161284721 19:3463351-3463373 AGCGGACCCCGGCCGGGCAGCGG 0: 1
1: 0
2: 0
3: 15
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161284701 Original CRISPR CGTCCTCGGTGGGGGCTGAG GGG (reversed) Intronic
900323571 1:2096521-2096543 TGTCCTCGGTGGGCGCTCAGAGG + Intronic
900343412 1:2199314-2199336 GCCCCTGGGTGGGGGCTGAGTGG - Intronic
900603614 1:3514371-3514393 CTCCCTTGCTGGGGGCTGAGGGG - Intronic
900611204 1:3545330-3545352 AGCCCTGGGTGGGGGCTGAGTGG + Intronic
901068630 1:6506426-6506448 TCTCCTCGGTGGGGGCTCCGAGG - Intronic
901109977 1:6785964-6785986 GGTCCACGGTGGGGGCCGCGGGG + Intronic
902394305 1:16124273-16124295 CTTCCTGGGTGGGAGTTGAGGGG - Intergenic
902707061 1:18212863-18212885 TGTCCTTGGTGGTGGGTGAGGGG - Intronic
903280201 1:22245826-22245848 TGTCCTCGGTGGGCAGTGAGGGG + Intergenic
903538112 1:24080848-24080870 CTTCCTCAGTGGGAGGTGAGGGG + Intronic
904270501 1:29346784-29346806 CTATCTTGGTGGGGGCTGAGGGG - Intergenic
910917025 1:92299543-92299565 CGTCCTCTCTGGGGGAAGAGGGG - Intronic
912272972 1:108229142-108229164 CCGCCTCGGTGGGGGCTGAAAGG + Exonic
912295247 1:108465180-108465202 CCGCCTCGGTGGGGGCTGAAAGG - Exonic
915473723 1:156140305-156140327 GGCACTCGGTGGTGGCTGAGGGG + Intergenic
916007193 1:160673507-160673529 CATCATTGGTGGGAGCTGAGTGG - Intergenic
916660721 1:166920664-166920686 CCTCCTCCGAGGGGACTGAGCGG - Intronic
917538023 1:175888372-175888394 CTGCCTCGGAGGGGCCTGAGCGG + Intergenic
920041938 1:203103697-203103719 CAACCTCGTTGGGGGTTGAGGGG + Intronic
920495927 1:206454863-206454885 CGTCCTCGCTGGGGGAGAAGGGG - Exonic
922572427 1:226642019-226642041 CCTCCTCGGTGGGGGCCTCGGGG + Exonic
923543739 1:234908888-234908910 CGGCCTCGGAGGGTGCTGGGAGG - Intergenic
1062767495 10:76552-76574 CCTCCGGGGTGGGTGCTGAGAGG + Intergenic
1063657705 10:8008707-8008729 AGTCCTCGGGGGGGCCTGACAGG - Intronic
1065325379 10:24546007-24546029 GGTCCTGTTTGGGGGCTGAGAGG - Exonic
1072916697 10:99541101-99541123 CGTCCTGGGTGGGGCTTAAGGGG + Intergenic
1073115885 10:101091409-101091431 CCTGCTGGGTGGGGCCTGAGGGG - Intronic
1076630224 10:131847810-131847832 TGTGCTGGGTGGGGGCCGAGGGG - Intergenic
1076712665 10:132347306-132347328 CGTGCTCAGTGGGGCCTGTGTGG + Intronic
1076712729 10:132347568-132347590 TGTGCTCGGTGGGGCCTGCGTGG + Intronic
1077195780 11:1279279-1279301 CTTCCACGGTGTGGGCTGAGGGG + Intronic
1077249149 11:1553128-1553150 TGCCCTCGGTGGGGGGTGGGGGG + Intergenic
1083628043 11:64082057-64082079 CGTCCTGGGCTGGGGCAGAGGGG + Intronic
1083628502 11:64084195-64084217 AGGCCTGGGAGGGGGCTGAGAGG - Intronic
1085413480 11:76305644-76305666 AGGCCTCGGTGGGTGCTGAGTGG + Intergenic
1085455002 11:76660668-76660690 CATTCCCGCTGGGGGCTGAGAGG + Exonic
1089325842 11:117656232-117656254 CGTCTTGGGTGGGGGCAGCGGGG + Intronic
1091587280 12:1823428-1823450 CGTGCTCTGAGGGGGCCGAGTGG + Intronic
1092105232 12:5917060-5917082 AGCCATGGGTGGGGGCTGAGAGG + Intronic
1097889224 12:64760274-64760296 CGCCCACGGTGGGCGGTGAGAGG - Intergenic
1101782225 12:107846185-107846207 CGCCCTGGCTGGAGGCTGAGTGG + Intergenic
1104640836 12:130465872-130465894 GGTGCTGGGTGGGGGCAGAGGGG - Intronic
1104763306 12:131311284-131311306 CTTCCTGGGTGGGGACTGCGTGG - Intergenic
1104816192 12:131646786-131646808 CTTCCTGGGTGGGGACTGCGTGG + Intergenic
1108089804 13:46837225-46837247 TGTCCATGGTGGGGGCTGGGTGG - Intronic
1112630024 13:101150236-101150258 CGTCCTGGGTGGGGGTGGCGGGG + Intronic
1113899517 13:113788441-113788463 TGGCCTGGGTGGGGGCTCAGGGG + Intronic
1114351872 14:21861565-21861587 CGTCCTAGATGGGGGCTGACAGG + Intergenic
1114416013 14:22544951-22544973 CTTCCTCAGTGGGCTCTGAGAGG + Intergenic
1114879147 14:26762150-26762172 CGGACTCAGTGGGGGCGGAGGGG - Intergenic
1118736331 14:68704253-68704275 CCTCCCCAGTGGGGGCTGCGGGG - Intronic
1121357994 14:93231233-93231255 CGTCCTGGGAGAGGGCTAAGTGG + Intergenic
1121916565 14:97841073-97841095 CGTCCTCGGGAGGAGATGAGTGG + Intergenic
1122107315 14:99468249-99468271 CTGCCTAGGTGTGGGCTGAGTGG - Intronic
1125664972 15:41423374-41423396 CATCTTGGGTGGGGGCTGGGTGG - Intronic
1127427020 15:58866975-58866997 CGTGCCCGGTGGGGGCTGTGTGG + Intronic
1128689906 15:69715690-69715712 CCTCCTAGGTGAGGGCTGTGTGG + Intergenic
1132655667 16:1040811-1040833 CCTCCTTGGTGTGGGGTGAGGGG - Intergenic
1132664905 16:1077125-1077147 AGTCCTGGCTGGGGGCTGTGGGG - Intergenic
1132767219 16:1540508-1540530 TGTCCTGGGTGGAGGCCGAGAGG - Intronic
1132931773 16:2462355-2462377 CGTTCTTGGTGGGAGCAGAGGGG + Intronic
1134235975 16:12466792-12466814 GGTCCTCGGTGGGCTCCGAGGGG + Intronic
1137590602 16:49691057-49691079 AGCCGTCGGAGGGGGCTGAGCGG + Intronic
1138381737 16:56607572-56607594 CTTCCCCTGTGGAGGCTGAGGGG - Intergenic
1141045578 16:80713534-80713556 ATTCCTCGGTGGGGGATGACCGG + Intronic
1143513663 17:7408690-7408712 CGTCCTCGGTGGGCACGTAGAGG - Exonic
1145205538 17:20983255-20983277 AGTCCTGGGTGGGGGCGGGGTGG + Intergenic
1145783132 17:27577267-27577289 CAGACTCGGTGGGGGGTGAGGGG - Intronic
1146668356 17:34719895-34719917 CATCATCGGTGGAGGCAGAGAGG + Intergenic
1147167975 17:38603458-38603480 GGTCCTCGGGGAGTGCTGAGTGG - Intronic
1147669062 17:42166232-42166254 AGTCCTCAGTGGGGGTTGCGGGG + Intronic
1147911614 17:43859420-43859442 CGTCCACAGTGGAGGCAGAGGGG + Intronic
1152080464 17:78184237-78184259 GGCCTTCGGTGGGAGCTGAGGGG - Intronic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1153624033 18:7006202-7006224 TGTCCTCGGTCAGGGCTGCGAGG + Intronic
1155055697 18:22180934-22180956 TGTCCACGGTGGGGGGTGGGCGG + Intronic
1157132074 18:45016417-45016439 CTTCCTAGGTGGGGGCTGAAGGG - Intronic
1157136718 18:45063586-45063608 CGACTGCTGTGGGGGCTGAGCGG - Exonic
1160386656 18:78500985-78501007 GGGCCTCGGTGGGTGCTGGGGGG + Intergenic
1160588891 18:79928799-79928821 CGCCATGGGTGGGGGCTGAGTGG - Intronic
1160836472 19:1127004-1127026 CATTGTCCGTGGGGGCTGAGGGG - Intronic
1160864904 19:1252216-1252238 GCTCCTCGGTGGGGGCGGAGGGG - Intronic
1161028988 19:2049357-2049379 CGTGCATGGTGGGGGCTGTGGGG + Intronic
1161284701 19:3463302-3463324 CGTCCTCGGTGGGGGCTGAGGGG - Intronic
1161808764 19:6459666-6459688 CGGCCTCAGTGGGGGCTTCGCGG + Exonic
1161960057 19:7518180-7518202 CGTCCAGGTTTGGGGCTGAGAGG + Intronic
1161975307 19:7605209-7605231 CGTGCTCTGTGGGGGCATAGAGG - Exonic
1162525636 19:11204497-11204519 AGCCCTCTGTGGGAGCTGAGTGG - Intronic
1163762567 19:19145665-19145687 CCTCCGCGGTGGGGGCTTGGAGG - Exonic
1165247360 19:34505147-34505169 CAGCCTGGGTGGGGGCTCAGAGG + Exonic
1165662677 19:37595251-37595273 TGTCCTCTGTGGGTGCAGAGTGG + Intronic
1166071929 19:40393007-40393029 CTTCCTGGGTGGGGCCAGAGTGG + Intergenic
1166888620 19:45976226-45976248 CCTCGGGGGTGGGGGCTGAGCGG - Intergenic
1167258072 19:48442913-48442935 CGGCTTCTGCGGGGGCTGAGCGG - Exonic
1167459379 19:49616197-49616219 CGTCCTCGCTGGGGGCTCCAGGG - Exonic
1167596730 19:50432138-50432160 CGTCCCCGGTGGGGGCGGGTGGG - Intergenic
1168665658 19:58203158-58203180 CTTCCTGGGGGGGGGCTAAGTGG - Intronic
925344359 2:3160017-3160039 CTCCCGTGGTGGGGGCTGAGAGG + Intergenic
925822659 2:7815591-7815613 AGTCCATGGTGGGGGCAGAGAGG - Intergenic
926083931 2:10009619-10009641 TGTGTTCGGTGGGGGCTGTGCGG + Intergenic
926300289 2:11597109-11597131 TGTGCTCGGTGGGCGATGAGAGG + Intronic
926801798 2:16665807-16665829 CGTACTCGGCGGCGGCGGAGCGG - Exonic
927558736 2:24053961-24053983 AGGACTGGGTGGGGGCTGAGGGG - Intronic
930096623 2:47570829-47570851 CCTCCTAGGTGCGGGCTGTGCGG + Exonic
934712945 2:96527590-96527612 GGTCCTCGGTGGGGGTGGAATGG + Intergenic
936970696 2:118173756-118173778 CGTACTCTGTGGGGGCAGTGTGG + Intergenic
937183187 2:120013715-120013737 CGTCCCGGGTGGGGGCGGGGCGG - Intronic
940945769 2:159615947-159615969 CGTCCTGGGTGGGAGGTGGGGGG - Intronic
945114528 2:206398187-206398209 AGTTCTCCCTGGGGGCTGAGTGG + Intergenic
1173808837 20:45943738-45943760 AGTCCTCCTTGGAGGCTGAGTGG - Exonic
1176071200 20:63227266-63227288 GGTCCTGGGTGGGGGCTTATGGG + Intergenic
1176071225 20:63227350-63227372 GGTCCTAGGTGGGGGCTTACGGG + Intergenic
1176071239 20:63227392-63227414 GGTCCTAGGTGGGGGCTTACGGG + Intergenic
1180043318 21:45291692-45291714 GGTCCCCGGTGGGGGGTGGGGGG - Intergenic
1180067154 21:45418231-45418253 CATCCCTGGTGGGGGCAGAGGGG + Intronic
1180650004 22:17369668-17369690 GGTCCTCGGCGGGGGCGGCGGGG - Exonic
1183296695 22:37034015-37034037 AGTGCTGGGTGCGGGCTGAGTGG - Intergenic
1183662010 22:39226701-39226723 CGTGATCGGACGGGGCTGAGAGG - Intronic
1185186831 22:49406236-49406258 CTCCCTCCGTGGGGGCTGTGAGG - Intergenic
950837679 3:15936277-15936299 AGGCCTGGGTAGGGGCTGAGGGG - Intergenic
956741844 3:72281489-72281511 CTTCCTCAGCAGGGGCTGAGGGG + Intergenic
958425415 3:93973722-93973744 GGTCCTGGGTGGGCGCTGCGGGG - Exonic
961324392 3:126101723-126101745 CGGCCTGGCTGTGGGCTGAGAGG + Intergenic
961674093 3:128554709-128554731 CGTTGTCGGTATGGGCTGAGGGG - Intergenic
961818079 3:129561509-129561531 CCTCCTTGGTGGGGGCTGGGCGG - Intronic
962324619 3:134422972-134422994 CTTCCTGGGTGCAGGCTGAGAGG - Intergenic
962876377 3:139538957-139538979 CGTCTGCGGTGGGGGTTGAACGG + Exonic
968131981 3:196197407-196197429 CGTCCTGGGTGAGGGCTTGGAGG - Intergenic
968739599 4:2320787-2320809 GGTCCTGTGTGGGGGATGAGGGG - Intronic
968903872 4:3443042-3443064 CGTCCTCGGTGAGTGCTGTGGGG - Exonic
968915632 4:3495997-3496019 CCTCGTGGGTGGGGGCTGGGAGG - Intronic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
972213120 4:36862401-36862423 TGTCTGCGGTGGTGGCTGAGTGG + Intergenic
973717315 4:53690080-53690102 AGACCTGGGTGGGGGCTGAGAGG - Intronic
977716571 4:100190267-100190289 CGGCCTTGGTGGGGGCAGCGGGG - Intronic
981354676 4:143774483-143774505 CAACCTTGGTGGGAGCTGAGGGG + Intergenic
984104514 4:175528356-175528378 AGTCTCTGGTGGGGGCTGAGGGG - Intergenic
985467701 5:12986-13008 CGTCCCCGGCGGGGGCGGGGTGG + Intergenic
985520490 5:371970-371992 AGCCCTCGGCGGGGCCTGAGTGG - Intronic
985655663 5:1130323-1130345 TGTCCTCGCTGGGTGTTGAGCGG - Intergenic
987031129 5:13977786-13977808 AGTCCTTGGTGGGGGCTGGGAGG + Intergenic
993307586 5:86290819-86290841 CCGCCTCGGTGGGGGCTGAAAGG - Intergenic
995757358 5:115522120-115522142 CCTCCTCTTTGGGGGCTGGGTGG - Exonic
998014684 5:138722831-138722853 CGTTGTTGGTGGGGGGTGAGGGG + Intronic
1001082113 5:168675081-168675103 CACCCTCGGCGGGGGCTGGGAGG + Intronic
1001555005 5:172631183-172631205 AGTCCTTGCTGGTGGCTGAGTGG + Intergenic
1005327916 6:24720414-24720436 GGTCCCAGGTGGGGGCTGAGCGG - Exonic
1006116244 6:31777486-31777508 CGTCTGTGGTGGGGGCAGAGAGG - Intergenic
1019306073 7:336285-336307 CGTCCTCCGTGGTGGTGGAGAGG - Intergenic
1019306093 7:336342-336364 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306104 7:336371-336393 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306125 7:336428-336450 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306148 7:336485-336507 CGTCCTCCGTGGTGGTGGAGAGG - Intergenic
1019306258 7:336802-336824 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306320 7:336975-336997 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019569384 7:1703639-1703661 CTTCCTCTGTCGGTGCTGAGCGG + Intronic
1019735518 7:2648157-2648179 GCTCTGCGGTGGGGGCTGAGCGG + Intronic
1020111564 7:5450912-5450934 CAGCCTTGCTGGGGGCTGAGAGG - Intronic
1020925608 7:14320135-14320157 AGTCATAGGTGGGAGCTGAGGGG + Intronic
1027390299 7:77696982-77697004 CGGTCTCGGTGGGGCCCGAGAGG + Exonic
1028417744 7:90597018-90597040 CTTGCGCGGTGGGGGCCGAGGGG - Intronic
1029163418 7:98569178-98569200 CGTCCTGGCTGTGAGCTGAGGGG - Intergenic
1029305566 7:99617137-99617159 CGCCCTCAGCCGGGGCTGAGCGG - Intronic
1029811527 7:103053990-103054012 TGTTCAAGGTGGGGGCTGAGAGG - Intronic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1036705155 8:11040992-11041014 CGTGCTAGGTGGGGGCTGCAGGG + Intronic
1036953917 8:13166832-13166854 GGACCTAGGTGGGGCCTGAGAGG + Intronic
1049473113 8:142785030-142785052 CATCCTCTGTGGGGTCTGTGGGG + Exonic
1059354075 9:113686390-113686412 CCTCCTAGCTGGGGGCAGAGTGG - Intergenic
1060813925 9:126625156-126625178 CGTCCTCGGAAGGGGTGGAGGGG - Intronic
1062518523 9:136947734-136947756 CGGCCTGGGTGGGGGCAGGGAGG + Intronic
1062525914 9:136978069-136978091 CGTGCGCGGTGGGGGTTGGGAGG + Intronic
1186829778 X:13378929-13378951 CGTCGTCGCTGGGGGCTGGCAGG + Intergenic
1187483133 X:19676346-19676368 CTACCTGGGTGGGGGCTGGGTGG + Intronic
1190485044 X:50915786-50915808 AGTCCTCGGTTTGGTCTGAGAGG - Exonic
1197097637 X:122614249-122614271 CTTCCTCGGTTGGGGCACAGAGG - Intergenic
1201396691 Y:13556025-13556047 CCTCCTCAGTTGGGGCAGAGAGG - Intergenic
1201439315 Y:13991490-13991512 TGTCCTTGGTGGGGGGTCAGGGG - Intergenic
1201445258 Y:14051218-14051240 TGTCCTTGGTGGGGGGTCAGGGG + Intergenic