ID: 1161285195

View in Genome Browser
Species Human (GRCh38)
Location 19:3464836-3464858
Sequence GGCCCACGCTTTGATCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1161285195_1161285212 10 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285212 19:3464869-3464891 AGGGCGGGCGGGGGAGGGGGTGG 0: 1
1: 5
2: 64
3: 925
4: 6776
1161285195_1161285205 0 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285205 19:3464859-3464881 GCTCTCCGGGAGGGCGGGCGGGG 0: 1
1: 0
2: 1
3: 37
4: 265
1161285195_1161285204 -1 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285204 19:3464858-3464880 CGCTCTCCGGGAGGGCGGGCGGG 0: 1
1: 0
2: 3
3: 19
4: 189
1161285195_1161285198 -10 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285198 19:3464849-3464871 AGCGTGGGCCGCTCTCCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 76
1161285195_1161285200 -6 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285200 19:3464853-3464875 TGGGCCGCTCTCCGGGAGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 331
1161285195_1161285215 27 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285215 19:3464886-3464908 GGGTGGTCGGGTTGTGCCATTGG 0: 1
1: 0
2: 1
3: 4
4: 71
1161285195_1161285211 7 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285211 19:3464866-3464888 GGGAGGGCGGGCGGGGGAGGGGG 0: 1
1: 9
2: 76
3: 943
4: 6632
1161285195_1161285203 -2 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285203 19:3464857-3464879 CCGCTCTCCGGGAGGGCGGGCGG 0: 1
1: 0
2: 3
3: 25
4: 193
1161285195_1161285207 4 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285207 19:3464863-3464885 TCCGGGAGGGCGGGCGGGGGAGG 0: 1
1: 0
2: 18
3: 569
4: 1262
1161285195_1161285216 28 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285216 19:3464887-3464909 GGTGGTCGGGTTGTGCCATTGGG 0: 1
1: 0
2: 0
3: 1
4: 50
1161285195_1161285206 1 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285206 19:3464860-3464882 CTCTCCGGGAGGGCGGGCGGGGG 0: 1
1: 0
2: 3
3: 30
4: 751
1161285195_1161285214 15 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285214 19:3464874-3464896 GGGCGGGGGAGGGGGTGGTCGGG 0: 1
1: 0
2: 21
3: 302
4: 2380
1161285195_1161285217 29 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285217 19:3464888-3464910 GTGGTCGGGTTGTGCCATTGGGG 0: 1
1: 0
2: 0
3: 2
4: 66
1161285195_1161285210 6 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285210 19:3464865-3464887 CGGGAGGGCGGGCGGGGGAGGGG 0: 1
1: 4
2: 40
3: 361
4: 3183
1161285195_1161285209 5 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285209 19:3464864-3464886 CCGGGAGGGCGGGCGGGGGAGGG 0: 1
1: 0
2: 14
3: 148
4: 1576
1161285195_1161285213 14 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285213 19:3464873-3464895 CGGGCGGGGGAGGGGGTGGTCGG 0: 1
1: 0
2: 23
3: 251
4: 2134
1161285195_1161285201 -5 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285201 19:3464854-3464876 GGGCCGCTCTCCGGGAGGGCGGG 0: 1
1: 0
2: 0
3: 22
4: 216
1161285195_1161285199 -9 Left 1161285195 19:3464836-3464858 CCTTGGGGATCAAAGCGTGGGCC 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1161285199 19:3464850-3464872 GCGTGGGCCGCTCTCCGGGAGGG 0: 1
1: 0
2: 0
3: 4
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1161285195 Original CRISPR GGCCCACGCTTTGATCCCCA AGG (reversed) Intronic
900616430 1:3567639-3567661 GGCCCACGGTGTGATGGCCAAGG - Intronic
905344265 1:37300760-37300782 GGCCCACTCTGAGATCCCCAAGG - Intergenic
906431225 1:45757245-45757267 GGGCCAAGATTTGGTCCCCAAGG - Intergenic
922869641 1:228891770-228891792 GGTCCACCCTTTGGTCCCCGAGG + Intergenic
1066667867 10:37803758-37803780 GGCCCAGGCCTTGATTCTCAGGG - Intronic
1067290750 10:44937923-44937945 GACCCACGGTGTGACCCCCAGGG - Intergenic
1071496454 10:86170554-86170576 GGTCCCCACTTTGCTCCCCAAGG + Intronic
1076273613 10:129177829-129177851 GGTCTACGCTTTAATCACCAGGG + Intergenic
1077500750 11:2908901-2908923 GGCCCACCCTTTGGTCCCCTGGG + Intronic
1081082245 11:38756571-38756593 GGCCCACCCTTGGCTACCCATGG - Intergenic
1089487741 11:118860247-118860269 GGGCCACGCTGTGAACCACAAGG + Intergenic
1092895066 12:13002477-13002499 GGCCCAGACGATGATCCCCAAGG - Intergenic
1097361759 12:58666073-58666095 GGCCCACACTTTGAGAACCATGG - Intronic
1100636210 12:96436914-96436936 GGCCCTTGCTTGGATCCGCAAGG + Intergenic
1102229594 12:111253272-111253294 GGCCCTCGCAGTGACCCCCAGGG + Intronic
1110368075 13:74709850-74709872 GGCCCACACCTTGAGCTCCAGGG + Intergenic
1113432478 13:110262634-110262656 GGCCCAGGCTTTTAACCCCCAGG + Intronic
1113906840 13:113823270-113823292 GGCCCGCGGTGGGATCCCCAGGG - Intronic
1113941659 13:114021572-114021594 AGGCCACGCTTTGTTCCCCCAGG + Intronic
1114765300 14:25364081-25364103 GGGCCACGGGTTGATCCACATGG - Intergenic
1117189252 14:53274752-53274774 GCCCCAGGCTTTGTGCCCCATGG - Intergenic
1123704570 15:22941663-22941685 GGCCCACTCTTTGGTGCTCAGGG + Intronic
1123783217 15:23646341-23646363 GGCCCCCGCTGTGATCCGCCAGG - Exonic
1125524952 15:40368783-40368805 GGACTCCGCTTTGATGCCCATGG + Exonic
1127275441 15:57439301-57439323 GGCCCACGCTCTGTTTCCCACGG - Exonic
1128328361 15:66739830-66739852 GGGCCTCGCTTTGTTGCCCAGGG + Intronic
1129876757 15:78980732-78980754 AGCACACGCTGTGATCCCCGAGG + Intronic
1133275942 16:4638552-4638574 CACCCACGCATTGATCCCCCTGG - Intronic
1133311000 16:4847002-4847024 GGCACCGGCTTTGATCCCCGAGG - Intronic
1140953199 16:79838706-79838728 GGCACACGCTTTGATTACCACGG + Intergenic
1141900206 16:86985993-86986015 GGACCACGCTGTGCTTCCCACGG + Intergenic
1141948385 16:87325223-87325245 GGCACAGGCTTTGTTCTCCAGGG - Intronic
1144849268 17:18235813-18235835 GGCCCACGCTGAGCTGCCCAGGG + Intronic
1145011814 17:19372581-19372603 GGCCCATTCTTAGCTCCCCAGGG + Intronic
1145785746 17:27592759-27592781 GGCTCAAGATATGATCCCCAAGG - Intronic
1147308835 17:39581998-39582020 GGCCCTCTCTTTCATCCCCATGG - Intergenic
1147610084 17:41796672-41796694 GGGCCACTCTTTGTTCCCAAGGG + Intergenic
1153227423 18:2909238-2909260 GGCCCACCCAGTGATCCCCTTGG - Intronic
1158346551 18:56521963-56521985 TGCCCTGGCTTTGATCACCAGGG - Intergenic
1161285195 19:3464836-3464858 GGCCCACGCTTTGATCCCCAAGG - Intronic
1167323103 19:48808159-48808181 GACCCACGCTCTGATCACCCCGG - Intronic
1167717594 19:51154056-51154078 TGCCCATGATTTCATCCCCAGGG + Intergenic
925378523 2:3406658-3406680 GGCCCATGCTCTGTTCCCAAGGG + Intronic
932886567 2:75554335-75554357 TGCCCCCTCTTTGATCACCAAGG - Intronic
936343733 2:111659575-111659597 GCCCCACGCCCTGATCTCCAGGG + Intergenic
941594364 2:167456948-167456970 GCCCCACTCTTTGACCTCCAAGG - Intergenic
947593825 2:231399005-231399027 GGCCTAGCCTTTGGTCCCCAAGG + Exonic
948525210 2:238567147-238567169 GGCACAAGCGTTGATTCCCAGGG - Intergenic
948829597 2:240591864-240591886 GGCCCCCTCTCTGATTCCCATGG - Intronic
1171461145 20:25298701-25298723 GGGCGATGCTTTGGTCCCCAGGG - Intronic
1175769017 20:61611219-61611241 GCCCCACCCTCTGATCCCCAGGG - Intronic
1181102876 22:20553034-20553056 TGCCCAAGCCTTAATCCCCACGG - Intronic
1181484850 22:23224170-23224192 GGCCACCTCTCTGATCCCCAGGG + Intronic
1183076803 22:35432557-35432579 GGCCCTTGCTTTCCTCCCCAAGG - Intergenic
1183866825 22:40710826-40710848 GCCCCACACTTGGCTCCCCACGG + Intergenic
1184644118 22:45886883-45886905 GGACCATGTTTTGATCACCATGG + Intergenic
953015725 3:39074099-39074121 GGACCACACTTTGAGACCCATGG + Intronic
954334616 3:49909095-49909117 GGCTGACGCCTTGGTCCCCAGGG + Exonic
955599502 3:60630011-60630033 CCCATACGCTTTGATCCCCAGGG - Intronic
969532315 4:7736775-7736797 TGCCCACGCTTCGATTCTCAGGG + Intronic
969533664 4:7742613-7742635 GGCCCACGCCTGGATCTCCATGG - Exonic
973718818 4:53703049-53703071 GCCCCACTTTTTGTTCCCCAGGG - Intronic
976679936 4:87745565-87745587 GGCCCACCCATTGCTTCCCATGG - Intergenic
990365854 5:55069646-55069668 CACCCACACTTTCATCCCCAGGG + Intergenic
994891982 5:105647796-105647818 GGCCCAGGCTGTGGTCACCAAGG + Intergenic
998264974 5:140661047-140661069 GTGCCAGGCTTTGATTCCCATGG + Intronic
1005144530 6:22673128-22673150 GGCCCATGCTCTGAAGCCCATGG + Intergenic
1006341955 6:33452122-33452144 TGCCCTCTCTTTGACCCCCAGGG + Exonic
1006739057 6:36294369-36294391 GACCCACGCATTGTTCCCCCCGG + Exonic
1015143303 6:129958912-129958934 GGCCCGCCCTTGGATGCCCATGG + Intergenic
1022490461 7:30813582-30813604 GACCCACGGTTTGCTACCCAAGG + Intronic
1026780959 7:73267015-73267037 GGTCCTCGGTTTGCTCCCCAAGG + Intergenic
1027021813 7:74820457-74820479 GGTCCTCGGTTTGCTCCCCAAGG + Intronic
1027066208 7:75125460-75125482 GGTCCTCGGTTTGCTCCCCAAGG - Intronic
1057693405 9:97307257-97307279 CGCCCACGCTTTTCTTCCCAGGG - Intergenic
1059425805 9:114220306-114220328 GGCCCAGGCTCTGTTCCCCGAGG + Intronic
1060140946 9:121209393-121209415 GCCCCACTCTTTGCTCACCATGG - Intronic
1061235103 9:129337523-129337545 AGCCCTGTCTTTGATCCCCACGG + Intergenic
1188386175 X:29561594-29561616 GGCCCACGATTTGTTTCACAGGG - Intronic
1193417463 X:81241462-81241484 GGCCCACCCATGGCTCCCCATGG + Intronic